Starting /dee2/code/volunteer_pipeline.sh SRR12671650 current disk space = 3051704291328 free memory = 1470604328 SRR12671650 SRAfilesize 5b1b6fc38876fba98e40a43fbf8d8ae3 SRR12671650.sra SRR12671650.sra file validated SRR12671650 is paired end SRR12671650 is conventional basespace SRR12671650 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671650_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2665 37.0 37.0 37.0 37.0 37.0 2 36.22 37.0 37.0 37.0 37.0 37.0 3 36.5265 37.0 37.0 37.0 37.0 37.0 4 36.551 37.0 37.0 37.0 37.0 37.0 5 36.514 37.0 37.0 37.0 37.0 37.0 6 36.526 37.0 37.0 37.0 37.0 37.0 7 36.4755 37.0 37.0 37.0 37.0 37.0 8 36.575 37.0 37.0 37.0 37.0 37.0 9 36.5355 37.0 37.0 37.0 37.0 37.0 10-14 36.5543 37.0 37.0 37.0 37.0 37.0 15-19 36.497499999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.4799 37.0 37.0 37.0 37.0 37.0 25-29 36.4351 37.0 37.0 37.0 37.0 37.0 30-34 36.4409 37.0 37.0 37.0 37.0 37.0 35-39 36.4234 37.0 37.0 37.0 37.0 37.0 40-44 36.4115 37.0 37.0 37.0 37.0 37.0 45-49 36.402 37.0 37.0 37.0 37.0 37.0 50-54 36.3403 37.0 37.0 37.0 37.0 37.0 55-59 36.360200000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.3667 37.0 37.0 37.0 37.0 37.0 65-69 36.3289 37.0 37.0 37.0 37.0 37.0 70-74 36.2962 37.0 37.0 37.0 37.0 37.0 75-79 36.2522 37.0 37.0 37.0 37.0 37.0 80-84 36.2991 37.0 37.0 37.0 37.0 37.0 85-89 36.2753 37.0 37.0 37.0 37.0 37.0 90-94 36.2037 37.0 37.0 37.0 37.0 37.0 95-99 36.150000000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.239700000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.0824 37.0 37.0 37.0 37.0 37.0 110-114 36.09310000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.1114 37.0 37.0 37.0 37.0 37.0 120-124 36.0585 37.0 37.0 37.0 37.0 37.0 125-129 35.9807 37.0 37.0 37.0 37.0 37.0 130-134 35.9089 37.0 37.0 37.0 37.0 37.0 135-139 35.8625 37.0 37.0 37.0 37.0 37.0 140-144 35.8247 37.0 37.0 37.0 37.0 37.0 145-149 35.8043 37.0 37.0 37.0 37.0 37.0 150-151 35.208749999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 0.0 25 1.0 26 3.0 27 7.0 28 14.0 29 14.0 30 33.0 31 34.0 32 66.0 33 73.0 34 125.0 35 323.0 36 2938.0 37 367.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.049999999999997 16.825000000000003 11.825 41.3 2 20.426065162907268 22.957393483709275 37.44360902255639 19.172932330827066 3 16.900000000000002 28.599999999999998 27.150000000000002 27.35 4 20.8 34.625 23.175 21.4 5 19.900000000000002 37.45 24.325 18.325 6 18.325 35.725 25.874999999999996 20.075000000000003 7 13.625000000000002 21.275 45.800000000000004 19.3 8 17.025000000000002 24.474999999999998 28.799999999999997 29.7 9 16.150000000000002 21.5 32.75 29.599999999999998 10-14 19.66 28.76 26.900000000000002 24.68 15-19 19.835 28.57 27.495000000000005 24.099999999999998 20-24 19.57 28.525 27.73 24.175 25-29 19.305 28.46 27.950000000000003 24.285 30-34 19.72 28.384999999999998 28.005000000000003 23.89 35-39 19.355 28.194999999999997 27.935 24.515 40-44 19.84 28.849999999999998 27.634999999999998 23.674999999999997 45-49 19.88 28.48 27.13 24.51 50-54 19.965 28.660000000000004 27.46 23.915 55-59 19.68 28.99 27.425 23.905 60-64 20.165 28.405 27.54 23.89 65-69 19.93 28.599999999999998 27.065 24.404999999999998 70-74 20.525 28.360000000000003 27.435 23.68 75-79 20.285 28.125 27.825 23.765 80-84 20.64 27.889999999999997 27.634999999999998 23.835 85-89 20.419999999999998 28.439999999999998 27.255000000000003 23.885 90-94 19.935 28.51 27.675 23.880000000000003 95-99 20.674999999999997 28.22 27.435 23.669999999999998 100-104 20.57 28.17 27.195000000000004 24.065 105-109 20.674999999999997 27.500000000000004 28.025 23.799999999999997 110-114 20.275000000000002 28.549999999999997 27.384999999999998 23.79 115-119 20.5 28.325 27.229999999999997 23.945 120-124 20.655 27.38 27.79 24.175 125-129 20.380000000000003 28.425 27.534999999999997 23.66 130-134 20.595 28.560000000000002 27.12 23.724999999999998 135-139 20.735 28.199999999999996 27.029999999999998 24.035 140-144 21.205 28.244999999999997 26.71 23.84 145-149 21.07 28.15 27.1 23.68 150-151 20.175 28.6875 26.75 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.5 23 3.5 24 2.0 25 3.0 26 6.5 27 10.5 28 15.5 29 18.5 30 21.5 31 27.0 32 28.0 33 35.5 34 54.0 35 74.0 36 94.0 37 107.5 38 123.5 39 152.0 40 192.5 41 224.5 42 231.5 43 233.5 44 267.0 45 306.0 46 289.0 47 244.0 48 212.0 49 195.0 50 172.0 51 136.0 52 115.0 53 101.5 54 89.0 55 58.0 56 31.5 57 32.0 58 25.5 59 19.5 60 14.5 61 8.0 62 4.5 63 4.5 64 5.0 65 3.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.7 #Duplication Level Percentage of deduplicated Percentage of total 1 93.7033084311633 87.8 2 5.923159018143009 11.1 3 0.32017075773745995 0.8999999999999999 4 0.05336179295624333 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.1375000000000002 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.65 0.0 0.0 0.0 0.0 126-127 1.85 0.0 0.0 0.0 0.0 128-129 2.0625 0.0 0.0 0.0 0.0 130-131 2.25 0.0 0.0 0.0 0.0 132-133 2.5125 0.0 0.0 0.0 0.0 134-135 2.625 0.0 0.0 0.0 0.0 136-137 2.825 0.0 0.0 0.0 0.0 138-139 3.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671650 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671650_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2265 37.0 37.0 37.0 37.0 37.0 2 36.0025 37.0 37.0 37.0 37.0 37.0 3 36.0765 37.0 37.0 37.0 37.0 37.0 4 36.0235 37.0 37.0 37.0 37.0 37.0 5 36.1515 37.0 37.0 37.0 37.0 37.0 6 36.1575 37.0 37.0 37.0 37.0 37.0 7 36.0245 37.0 37.0 37.0 37.0 37.0 8 36.187 37.0 37.0 37.0 37.0 37.0 9 36.1665 37.0 37.0 37.0 37.0 37.0 10-14 36.1823 37.0 37.0 37.0 37.0 37.0 15-19 36.116200000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.07430000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.044799999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.052 37.0 37.0 37.0 37.0 37.0 35-39 35.9733 37.0 37.0 37.0 37.0 37.0 40-44 36.005900000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.962900000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.9302 37.0 37.0 37.0 37.0 37.0 55-59 35.92059999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.818 37.0 37.0 37.0 37.0 37.0 65-69 35.8237 37.0 37.0 37.0 37.0 37.0 70-74 35.8457 37.0 37.0 37.0 37.0 37.0 75-79 35.766200000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.722899999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.7725 37.0 37.0 37.0 37.0 37.0 90-94 35.712399999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.7269 37.0 37.0 37.0 37.0 37.0 100-104 35.635 37.0 37.0 37.0 37.0 37.0 105-109 35.5997 37.0 37.0 37.0 37.0 37.0 110-114 35.568200000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.554899999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.5243 37.0 37.0 37.0 37.0 37.0 125-129 35.4932 37.0 37.0 37.0 37.0 37.0 130-134 35.4747 37.0 37.0 37.0 37.0 37.0 135-139 35.4105 37.0 37.0 37.0 37.0 37.0 140-144 35.170500000000004 37.0 37.0 37.0 27.4 37.0 145-149 35.1996 37.0 37.0 37.0 32.2 37.0 150-151 34.84375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 3.0 15 2.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 2.0 22 9.0 23 2.0 24 8.0 25 9.0 26 17.0 27 16.0 28 16.0 29 26.0 30 28.0 31 47.0 32 72.0 33 108.0 34 227.0 35 573.0 36 2636.0 37 191.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.625 19.775000000000002 15.049999999999999 30.55 2 25.8 24.7 34.025 15.475 3 19.3 28.1 30.65 21.95 4 22.2 37.05 22.1 18.65 5 22.575 36.525 21.5 19.400000000000002 6 18.825 37.724999999999994 23.200000000000003 20.25 7 17.875 17.825 42.225 22.075 8 19.875 23.974999999999998 26.5 29.65 9 20.9 24.825 28.95 25.324999999999996 10-14 23.095 27.625 26.995 22.285 15-19 22.435 27.715 27.905 21.945 20-24 22.39 28.384999999999998 28.13 21.095 25-29 22.785 28.060000000000002 28.21 20.945 30-34 22.295 28.09 28.410000000000004 21.205 35-39 22.515 27.16 28.57 21.755 40-44 22.28 28.110000000000003 28.23 21.38 45-49 22.58 27.54 28.23 21.65 50-54 22.259999999999998 28.27 28.38 21.09 55-59 22.43 27.685 28.139999999999997 21.745 60-64 22.919999999999998 27.275 27.860000000000003 21.945 65-69 22.759999999999998 27.775 27.655 21.81 70-74 22.759999999999998 27.55 27.82 21.87 75-79 22.75 27.605 27.98 21.665 80-84 22.945 27.605 27.794999999999998 21.654999999999998 85-89 23.3 27.634999999999998 27.365000000000002 21.7 90-94 23.474999999999998 28.51 27.11 20.905 95-99 22.88 27.575 27.915 21.63 100-104 23.72 27.560000000000002 27.105 21.615000000000002 105-109 23.72 27.655 27.939999999999998 20.685000000000002 110-114 23.865 28.325 27.025 20.785 115-119 23.445 27.865000000000002 27.77 20.919999999999998 120-124 24.16 27.58 27.48 20.78 125-129 24.11 27.794999999999998 27.025 21.07 130-134 24.015 27.589999999999996 27.55 20.845 135-139 23.919999999999998 27.884999999999998 27.855 20.34 140-144 24.055 27.68 28.03 20.235 145-149 25.095 27.975 27.115000000000002 19.814999999999998 150-151 24.7375 28.625 27.0 19.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.5 13 1.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 1.0 23 2.5 24 3.5 25 3.5 26 6.0 27 6.0 28 8.0 29 11.0 30 14.0 31 20.0 32 28.5 33 36.5 34 45.5 35 72.5 36 85.5 37 98.0 38 137.5 39 180.0 40 204.0 41 213.5 42 225.5 43 251.5 44 273.0 45 262.0 46 249.0 47 242.0 48 237.5 49 210.5 50 169.5 51 135.5 52 112.0 53 98.5 54 70.5 55 54.0 56 48.0 57 41.0 58 33.5 59 29.0 60 25.0 61 13.0 62 8.0 63 6.5 64 4.0 65 2.0 66 1.0 67 0.5 68 0.5 69 1.5 70 1.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.83342231713829 87.875 2 5.632674853176722 10.549999999999999 3 0.4805125467164976 1.35 4 0.026695141484249865 0.1 5 0.026695141484249865 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.45 0.0 0.0 0.0 0.0 122-123 1.5750000000000002 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.1375 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.5875 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 2.9000000000000004 0.0 0.0 0.0 0.0 138-139 3.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054431 spots for SRR12671650.sra Written 1054431 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra Read 1054424 spots for SRR12671650.sra Written 1054424 spots for SRR12671650.sra SRR ids: ['SRR12671650.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oetw7kl1 SRR12671650.sra spots: 21088487 blocks: [[1, 1054424], [1054425, 2108848], [2108849, 3163272], [3163273, 4217696], [4217697, 5272120], [5272121, 6326544], [6326545, 7380968], [7380969, 8435392], [8435393, 9489816], [9489817, 10544240], [10544241, 11598664], [11598665, 12653088], [12653089, 13707512], [13707513, 14761936], [14761937, 15816360], [15816361, 16870784], [16870785, 17925208], [17925209, 18979632], [18979633, 20034056], [20034057, 21088487]] SRR12671650 file size 7145090 SRR12671650 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671650 SRR12671650_1.fastq SRR12671650_2.fastq Input file: SRR12671650_1.fastq Paired file: SRR12671650_2.fastq trimmed: SRR12671650-trimmed-pair1.fastq, SRR12671650-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:08:32 2025 >> started Wed Feb 12 00:08:59 2025 >> done (26.158s) 21088487 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 1764 ( 0.01%) empty read pairs filtered out after trimming by size control 21086699 (99.99%) read pairs available; of these: 1058321 ( 5.02%) trimmed read pairs available after processing 20028378 (94.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 5 0.00% 23 4 0.00% 24 2 0.00% 25 4 0.00% 26 3 0.00% 27 3 0.00% 28 4 0.00% 29 4 0.00% 30 5 0.00% 31 4 0.00% 32 7 0.00% 33 10 0.00% 34 9 0.00% 35 16 0.00% 36 9 0.00% 37 18 0.00% 38 15 0.00% 39 24 0.00% 40 24 0.00% 41 30 0.00% 42 20 0.00% 43 19 0.00% 44 32 0.00% 45 37 0.00% 46 25 0.00% 47 31 0.00% 48 45 0.00% 49 41 0.00% 50 59 0.00% 51 54 0.00% 52 74 0.00% 53 66 0.00% 54 83 0.00% 55 82 0.00% 56 75 0.00% 57 93 0.00% 58 102 0.00% 59 104 0.00% 60 146 0.00% 61 156 0.00% 62 155 0.00% 63 183 0.00% 64 225 0.00% 65 206 0.00% 66 225 0.00% 67 269 0.00% 68 242 0.00% 69 324 0.00% 70 377 0.00% 71 389 0.00% 72 493 0.00% 73 537 0.00% 74 621 0.00% 75 676 0.00% 76 719 0.00% 77 706 0.00% 78 765 0.00% 79 912 0.00% 80 1010 0.00% 81 1205 0.01% 82 1307 0.01% 83 1548 0.01% 84 1762 0.01% 85 1895 0.01% 86 1969 0.01% 87 2150 0.01% 88 2244 0.01% 89 2366 0.01% 90 2684 0.01% 91 2987 0.01% 92 3360 0.02% 93 3804 0.02% 94 4225 0.02% 95 4542 0.02% 96 4469 0.02% 97 4751 0.02% 98 5096 0.02% 99 5296 0.03% 100 5782 0.03% 101 6106 0.03% 102 6837 0.03% 103 7363 0.03% 104 7841 0.04% 105 8297 0.04% 106 8671 0.04% 107 8683 0.04% 108 9201 0.04% 109 9564 0.05% 110 10073 0.05% 111 10256 0.05% 112 11063 0.05% 113 11779 0.06% 114 12402 0.06% 115 13198 0.06% 116 13552 0.06% 117 13950 0.07% 118 14131 0.07% 119 14416 0.07% 120 15248 0.07% 121 15676 0.07% 122 16291 0.08% 123 17267 0.08% 124 18396 0.09% 125 19178 0.09% 126 19542 0.09% 127 20244 0.10% 128 20132 0.10% 129 20637 0.10% 130 21012 0.10% 131 21556 0.10% 132 22567 0.11% 133 23958 0.11% 134 24676 0.12% 135 25828 0.12% 136 26454 0.13% 137 26926 0.13% 138 27533 0.13% 139 27695 0.13% 140 27679 0.13% 141 28344 0.13% 142 29800 0.14% 143 30245 0.14% 144 32451 0.15% 145 33308 0.16% 146 34561 0.16% 147 34635 0.16% 148 34956 0.17% 149 34728 0.16% 150 35387 0.17% 151 20028378 94.98% 21086699 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=40 prefix-density=0.71 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=66.42 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=2.8 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=1.05 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=35 prefix-density=1.05 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=66.53 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.8 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671650 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:09:44 Started mapping on | Feb 12 00:09:45 Finished on | Feb 12 00:11:58 Mapping speed, Million of reads per hour | 570.77 Number of input reads | 21086699 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19719627 Uniquely mapped reads % | 93.52% Average mapped length | 298.44 Number of splices: Total | 20091931 Number of splices: Annotated (sjdb) | 19697776 Number of splices: GT/AG | 19692106 Number of splices: GC/AG | 327035 Number of splices: AT/AC | 11227 Number of splices: Non-canonical | 61563 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 473144 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 109726 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 893928 893928 893928 N_multimapping 473144 473144 473144 N_noFeature 669330 19379636 768395 N_ambiguous 360369 1264 118745 UnstrandedReadsAssigned:18689928 PositiveStrandReadsAssigned:338727 NegativeStrandReadsAssigned:18832487 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671650 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671650-trimmed-pair1.fastq SRR12671650-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,086,699 reads, 18,770,189 reads pseudoaligned [quant] estimated average fragment length: 309.983 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52401 SRR12671650.ke.tsv 34699 SRR12671650.se.tsv 87100 total ==> SRR12671650.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1709.02 792 21.6754 Potri.005G024800.1.v4.1 1035 726.017 309 19.9067 Potri.004G059700.1.v4.1 961 652.717 0 0 Potri.007G009000.2.v4.1 1416 1107.02 0 0 Potri.003G141000.2.v4.1 2943 2634.02 1038 18.4318 Potri.016G087400.1.v4.1 270 73.6408 759.116 482.144 Potri.015G069301.1.v4.1 564 286.547 0 0 Potri.010G195200.1.v4.1 1773 1464.02 123 3.92959 Potri.012G127500.1.v4.1 977 668.385 128 8.95718 ==> SRR12671650.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 195 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 246 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671650 completed mapping pipeline successfully