Starting /dee2/code/volunteer_pipeline.sh SRR12671651 current disk space = 3051547930624 free memory = 1445795132 SRR12671651 SRAfilesize 5d7f13e4218e0d3253640147bc97ca65 SRR12671651.sra SRR12671651.sra file validated SRR12671651 is paired end SRR12671651 is conventional basespace SRR12671651 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671651_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.386 37.0 37.0 37.0 37.0 37.0 2 36.2325 37.0 37.0 37.0 37.0 37.0 3 36.558 37.0 37.0 37.0 37.0 37.0 4 36.4745 37.0 37.0 37.0 37.0 37.0 5 36.538 37.0 37.0 37.0 37.0 37.0 6 36.506 37.0 37.0 37.0 37.0 37.0 7 36.512 37.0 37.0 37.0 37.0 37.0 8 36.6275 37.0 37.0 37.0 37.0 37.0 9 36.5085 37.0 37.0 37.0 37.0 37.0 10-14 36.55989999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5047 37.0 37.0 37.0 37.0 37.0 20-24 36.507799999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.482299999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4799 37.0 37.0 37.0 37.0 37.0 35-39 36.44199999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4362 37.0 37.0 37.0 37.0 37.0 45-49 36.390699999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.4182 37.0 37.0 37.0 37.0 37.0 55-59 36.3529 37.0 37.0 37.0 37.0 37.0 60-64 36.374 37.0 37.0 37.0 37.0 37.0 65-69 36.326800000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.3028 37.0 37.0 37.0 37.0 37.0 75-79 36.3193 37.0 37.0 37.0 37.0 37.0 80-84 36.3094 37.0 37.0 37.0 37.0 37.0 85-89 36.2944 37.0 37.0 37.0 37.0 37.0 90-94 36.2461 37.0 37.0 37.0 37.0 37.0 95-99 36.1712 37.0 37.0 37.0 37.0 37.0 100-104 36.2309 37.0 37.0 37.0 37.0 37.0 105-109 36.105999999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1399 37.0 37.0 37.0 37.0 37.0 115-119 36.183800000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.068799999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.0112 37.0 37.0 37.0 37.0 37.0 130-134 35.991 37.0 37.0 37.0 37.0 37.0 135-139 35.9241 37.0 37.0 37.0 37.0 37.0 140-144 35.9208 37.0 37.0 37.0 37.0 37.0 145-149 35.8391 37.0 37.0 37.0 37.0 37.0 150-151 35.41075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 0.0 26 2.0 27 6.0 28 11.0 29 12.0 30 24.0 31 27.0 32 42.0 33 82.0 34 139.0 35 343.0 36 2935.0 37 373.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.55 16.475 11.774999999999999 41.199999999999996 2 19.36372745490982 21.968937875751504 38.77755511022044 19.88977955911824 3 17.8 27.675 28.449999999999996 26.075 4 20.65 34.699999999999996 23.3 21.349999999999998 5 19.325 37.0 24.474999999999998 19.2 6 18.75 35.775 25.224999999999998 20.25 7 14.45 19.425 45.7 20.424999999999997 8 17.75 23.599999999999998 29.549999999999997 29.099999999999998 9 16.775000000000002 22.475 34.0 26.75 10-14 19.405 28.92 27.139999999999997 24.535 15-19 19.38 28.965000000000003 27.55 24.104999999999997 20-24 19.53 29.535 27.139999999999997 23.794999999999998 25-29 19.115 29.145 28.044999999999998 23.695 30-34 19.7 28.544999999999998 28.165000000000003 23.59 35-39 19.994999999999997 28.720000000000002 27.900000000000002 23.385 40-44 20.21 28.560000000000002 27.229999999999997 24.0 45-49 19.245 28.599999999999998 27.755000000000003 24.4 50-54 19.865 27.79 28.435 23.91 55-59 19.43 28.744999999999997 27.589999999999996 24.235 60-64 19.38 28.575 27.894999999999996 24.15 65-69 20.215 28.199999999999996 27.534999999999997 24.05 70-74 20.044999999999998 28.64 27.57 23.745 75-79 20.315 27.92 27.689999999999998 24.075 80-84 20.435 28.505000000000003 27.43 23.630000000000003 85-89 20.265 28.435 27.21 24.09 90-94 20.07 27.825 27.68 24.425 95-99 20.575 28.035 27.384999999999998 24.005000000000003 100-104 19.869999999999997 28.465 27.589999999999996 24.075 105-109 20.424999999999997 28.005000000000003 27.815 23.755000000000003 110-114 20.78 28.075 27.46 23.685000000000002 115-119 20.515 27.83 27.625 24.03 120-124 20.345 28.1 27.62 23.935000000000002 125-129 20.43 27.755000000000003 27.534999999999997 24.279999999999998 130-134 20.915 28.050000000000004 27.22 23.815 135-139 20.685000000000002 27.26 28.294999999999998 23.76 140-144 21.044999999999998 28.02 27.82 23.115 145-149 20.95 28.29 27.075 23.685000000000002 150-151 21.2625 27.1 27.5125 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.5 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.0 21 2.0 22 1.5 23 2.5 24 3.0 25 4.0 26 4.5 27 7.0 28 10.0 29 15.5 30 20.5 31 24.5 32 32.0 33 44.5 34 60.0 35 77.5 36 93.0 37 104.5 38 136.5 39 166.5 40 191.5 41 219.0 42 233.5 43 258.0 44 283.0 45 271.0 46 259.5 47 249.0 48 216.5 49 209.5 50 184.0 51 132.5 52 108.5 53 93.5 54 73.5 55 51.5 56 39.0 57 33.0 58 27.0 59 20.0 60 13.0 61 9.5 62 3.5 63 2.0 64 2.0 65 0.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.825 #Duplication Level Percentage of deduplicated Percentage of total 1 94.11137756461497 88.3 2 5.2491340261124435 9.85 3 0.5861977084998667 1.6500000000000001 4 0.05329070077271516 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5375000000000001 0.0 0.0 0.0 0.0 112-113 0.6000000000000001 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.8375 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.525 0.0 0.0 0.0 0.0 132-133 1.6125 0.0 0.0 0.0 0.0 134-135 1.7374999999999998 0.0 0.0 0.0 0.0 136-137 1.85 0.0 0.0 0.0 0.0 138-139 1.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAAGC 10 0.006830828 145.0 6 >>END_MODULE SRR12671651 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671651_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.122 37.0 37.0 37.0 37.0 37.0 2 36.1085 37.0 37.0 37.0 37.0 37.0 3 36.2645 37.0 37.0 37.0 37.0 37.0 4 36.207 37.0 37.0 37.0 37.0 37.0 5 36.246 37.0 37.0 37.0 37.0 37.0 6 36.2755 37.0 37.0 37.0 37.0 37.0 7 36.321 37.0 37.0 37.0 37.0 37.0 8 36.265 37.0 37.0 37.0 37.0 37.0 9 36.3445 37.0 37.0 37.0 37.0 37.0 10-14 36.257600000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.251200000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.290299999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.237700000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.1924 37.0 37.0 37.0 37.0 37.0 35-39 36.130700000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1671 37.0 37.0 37.0 37.0 37.0 45-49 36.1278 37.0 37.0 37.0 37.0 37.0 50-54 36.14829999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.0985 37.0 37.0 37.0 37.0 37.0 60-64 36.020799999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.0843 37.0 37.0 37.0 37.0 37.0 70-74 36.05160000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.9414 37.0 37.0 37.0 37.0 37.0 80-84 35.993399999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.952200000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.909800000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.8944 37.0 37.0 37.0 37.0 37.0 100-104 35.8717 37.0 37.0 37.0 37.0 37.0 105-109 35.8278 37.0 37.0 37.0 37.0 37.0 110-114 35.80499999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.6822 37.0 37.0 37.0 37.0 37.0 120-124 35.72240000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.579800000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.6755 37.0 37.0 37.0 37.0 37.0 135-139 35.598400000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.39640000000001 37.0 37.0 37.0 32.2 37.0 145-149 35.5083 37.0 37.0 37.0 37.0 37.0 150-151 35.03625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 5.0 24 4.0 25 4.0 26 8.0 27 13.0 28 16.0 29 13.0 30 30.0 31 47.0 32 62.0 33 108.0 34 207.0 35 535.0 36 2707.0 37 235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.6 18.675 14.124999999999998 34.599999999999994 2 26.25 23.799999999999997 35.725 14.224999999999998 3 18.875 28.449999999999996 32.225 20.45 4 21.325 36.875 23.325000000000003 18.475 5 23.974999999999998 37.675 20.7 17.65 6 18.85 38.0 22.15 21.0 7 17.150000000000002 18.15 42.825 21.875 8 20.25 24.125 27.224999999999998 28.4 9 21.85 24.725 29.375 24.05 10-14 21.58 28.76 26.75 22.91 15-19 21.925 28.189999999999998 28.060000000000002 21.825 20-24 22.12 27.72 27.98 22.18 25-29 21.94 28.225 27.805000000000003 22.03 30-34 22.485 27.955000000000002 28.165000000000003 21.395 35-39 22.36 28.294999999999998 27.834999999999997 21.51 40-44 22.564999999999998 27.71 27.775 21.95 45-49 22.005 28.33 27.950000000000003 21.715 50-54 22.395 27.975 27.889999999999997 21.740000000000002 55-59 22.955000000000002 27.43 27.97 21.645 60-64 22.85 27.589999999999996 27.67 21.89 65-69 23.200000000000003 27.33 27.46 22.009999999999998 70-74 23.05 27.855 27.195000000000004 21.9 75-79 22.75 27.345000000000002 28.360000000000003 21.545 80-84 23.035 28.189999999999998 26.900000000000002 21.875 85-89 23.355 27.474999999999998 27.845 21.325 90-94 23.185 27.805000000000003 27.955000000000002 21.055 95-99 23.044999999999998 27.915 27.750000000000004 21.29 100-104 23.34 27.644999999999996 27.62 21.395 105-109 23.44 28.175 27.295 21.09 110-114 23.325000000000003 28.549999999999997 27.245 20.880000000000003 115-119 23.695 28.345 27.175 20.785 120-124 23.54 27.145000000000003 27.765 21.55 125-129 23.724999999999998 28.444999999999997 27.0 20.830000000000002 130-134 23.775 27.965 27.450000000000003 20.810000000000002 135-139 23.990000000000002 27.305 28.265 20.44 140-144 23.825 27.72 27.089999999999996 21.365000000000002 145-149 23.915 28.035 27.36 20.69 150-151 24.65 27.224999999999998 27.6125 20.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 0.5 23 1.5 24 4.0 25 3.5 26 3.5 27 5.0 28 6.0 29 12.0 30 17.0 31 22.5 32 28.5 33 36.0 34 55.5 35 68.5 36 75.5 37 96.5 38 123.5 39 159.0 40 182.0 41 204.0 42 233.0 43 249.0 44 292.5 45 298.5 46 270.0 47 261.0 48 250.0 49 207.0 50 158.0 51 126.5 52 104.5 53 90.5 54 72.0 55 68.5 56 54.5 57 34.0 58 27.0 59 30.0 60 22.5 61 11.5 62 11.5 63 6.5 64 3.0 65 2.5 66 0.5 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.9125770984178 87.55 2 5.256100831322071 9.8 3 0.6436041834271923 1.7999999999999998 4 0.10726736390453205 0.4 5 0.026816840976133013 0.125 6 0.026816840976133013 0.15 7 0.026816840976133013 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5375000000000001 0.0 0.0 0.0 0.0 112-113 0.6000000000000001 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.8375 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.525 0.0 0.0 0.0 0.0 132-133 1.6125 0.0 0.0 0.0 0.0 134-135 1.75 0.0 0.0 0.0 0.0 136-137 1.875 0.0 0.0 0.0 0.0 138-139 1.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCAAA 10 0.006830828 145.0 145 TTTGGTG 10 0.006830828 145.0 6 CTTCGCC 10 0.006830828 145.0 1 >>END_MODULE Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985992 spots for SRR12671651.sra Written 985992 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra Read 985991 spots for SRR12671651.sra Written 985991 spots for SRR12671651.sra SRR ids: ['SRR12671651.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pybkd5ls SRR12671651.sra spots: 19719821 blocks: [[1, 985991], [985992, 1971982], [1971983, 2957973], [2957974, 3943964], [3943965, 4929955], [4929956, 5915946], [5915947, 6901937], [6901938, 7887928], [7887929, 8873919], [8873920, 9859910], [9859911, 10845901], [10845902, 11831892], [11831893, 12817883], [12817884, 13803874], [13803875, 14789865], [14789866, 15775856], [15775857, 16761847], [16761848, 17747838], [17747839, 18733829], [18733830, 19719821]] SRR12671651 file size 6679957 SRR12671651 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671651 SRR12671651_1.fastq SRR12671651_2.fastq Input file: SRR12671651_1.fastq Paired file: SRR12671651_2.fastq trimmed: SRR12671651-trimmed-pair1.fastq, SRR12671651-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:21:55 2025 >> started Wed Feb 12 00:22:19 2025 >> done (23.402s) 19719821 read pairs processed; of these: 8 ( 0.00%) short read pairs filtered out after trimming by size control 1596 ( 0.01%) empty read pairs filtered out after trimming by size control 19718217 (99.99%) read pairs available; of these: 648579 ( 3.29%) trimmed read pairs available after processing 19069638 (96.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 1 0.00% 25 4 0.00% 26 1 0.00% 27 4 0.00% 28 4 0.00% 29 4 0.00% 30 6 0.00% 31 6 0.00% 32 9 0.00% 33 7 0.00% 34 5 0.00% 35 10 0.00% 36 6 0.00% 37 10 0.00% 38 12 0.00% 39 13 0.00% 40 14 0.00% 41 30 0.00% 42 34 0.00% 43 21 0.00% 44 25 0.00% 45 13 0.00% 46 18 0.00% 47 18 0.00% 48 31 0.00% 49 25 0.00% 50 50 0.00% 51 47 0.00% 52 53 0.00% 53 56 0.00% 54 60 0.00% 55 43 0.00% 56 49 0.00% 57 67 0.00% 58 55 0.00% 59 67 0.00% 60 100 0.00% 61 79 0.00% 62 92 0.00% 63 103 0.00% 64 125 0.00% 65 134 0.00% 66 109 0.00% 67 157 0.00% 68 137 0.00% 69 178 0.00% 70 182 0.00% 71 206 0.00% 72 252 0.00% 73 343 0.00% 74 284 0.00% 75 358 0.00% 76 390 0.00% 77 413 0.00% 78 460 0.00% 79 516 0.00% 80 517 0.00% 81 627 0.00% 82 699 0.00% 83 793 0.00% 84 972 0.00% 85 1004 0.01% 86 996 0.01% 87 1096 0.01% 88 1207 0.01% 89 1301 0.01% 90 1490 0.01% 91 1547 0.01% 92 1802 0.01% 93 1964 0.01% 94 2320 0.01% 95 2376 0.01% 96 2573 0.01% 97 2535 0.01% 98 2657 0.01% 99 2885 0.01% 100 2935 0.01% 101 3287 0.02% 102 3641 0.02% 103 3935 0.02% 104 4087 0.02% 105 4571 0.02% 106 4822 0.02% 107 4814 0.02% 108 5137 0.03% 109 5214 0.03% 110 5223 0.03% 111 5663 0.03% 112 6237 0.03% 113 6443 0.03% 114 7150 0.04% 115 7444 0.04% 116 7745 0.04% 117 7985 0.04% 118 8204 0.04% 119 8218 0.04% 120 8698 0.04% 121 9347 0.05% 122 9508 0.05% 123 10140 0.05% 124 10814 0.05% 125 11107 0.06% 126 11828 0.06% 127 12014 0.06% 128 12217 0.06% 129 12502 0.06% 130 12619 0.06% 131 13157 0.07% 132 13697 0.07% 133 14805 0.08% 134 15612 0.08% 135 15996 0.08% 136 16416 0.08% 137 17029 0.09% 138 17535 0.09% 139 17880 0.09% 140 17927 0.09% 141 18150 0.09% 142 19082 0.10% 143 20014 0.10% 144 21523 0.11% 145 21699 0.11% 146 22958 0.12% 147 23354 0.12% 148 23725 0.12% 149 23565 0.12% 150 24039 0.12% 151 19069638 96.71% 19718217 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=26 prefix-density=0.48 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=141.06 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=8.3 sequence=TCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGATATAGCTAGGGACACATCAAGTTCTGGGACGACTTAGACACCTTTCGGCTTGGCGGCAATAAAGCTGATGCACTGCACTTGACG criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=23 prefix-density=0.65 prefix-fanout=2.7 sequence=ATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGCTAATGACATTACTTCCATTGCAAGCAATGGTGGACGAGTTCAATGCATGCAGGTGTGGCCACCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACAGAGGAGGAATTGGCCAAGGAAATTGATTACCTTCTTCGCTCGAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGTGAGCACCACAGCTCACCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAGCTACCCATGTTTGGATGCACTGAGGCATCTCAAGTGTTGCTTGAGCTTGAGGAGGCAAAGAAAGCTTACCCTAACGCCTTTATCCGTATAATCGGATTCGACAACACGCGTCAAGTGCAGTGCATCAGCTTTATTGCCGCCAAGCCGAAAGGTGTCTAAGTCGTCCCAGAACTTGATGTGTCCCTAGCTA criterion=fanout-score sequence-density=0.08 sequence-density-rank=30 fanout-score=66.53 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=8.2 sequence=AAAAGAAAAGAAAA SRR12671651 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:23:10 Started mapping on | Feb 12 00:23:10 Finished on | Feb 12 00:25:20 Mapping speed, Million of reads per hour | 546.04 Number of input reads | 19718217 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 18477463 Uniquely mapped reads % | 93.71% Average mapped length | 299.38 Number of splices: Total | 18849573 Number of splices: Annotated (sjdb) | 18477198 Number of splices: GT/AG | 18476481 Number of splices: GC/AG | 305864 Number of splices: AT/AC | 10754 Number of splices: Non-canonical | 56474 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 438161 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 68010 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.64% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 802593 802593 802593 N_multimapping 438161 438161 438161 N_noFeature 632601 18157685 716369 N_ambiguous 347247 1159 110600 UnstrandedReadsAssigned:17497615 PositiveStrandReadsAssigned:318619 NegativeStrandReadsAssigned:17650494 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671651 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671651-trimmed-pair1.fastq SRR12671651-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,718,217 reads, 17,557,814 reads pseudoaligned [quant] estimated average fragment length: 320.134 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR12671651.ke.tsv 34699 SRR12671651.se.tsv 87100 total ==> SRR12671651.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1698.87 569 16.3448 Potri.005G024800.1.v4.1 1035 715.866 206 14.0431 Potri.004G059700.1.v4.1 961 642.419 6 0.455785 Potri.007G009000.2.v4.1 1416 1096.87 0 0 Potri.003G141000.2.v4.1 2943 2623.87 1128.96 20.9972 Potri.016G087400.1.v4.1 270 67.762 723.705 521.197 Potri.015G069301.1.v4.1 564 275.975 0 0 Potri.010G195200.1.v4.1 1773 1453.87 115 3.86012 Potri.012G127500.1.v4.1 977 658.136 98 7.2667 ==> SRR12671651.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 409 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 264 Potri.001G212900.v4.1 30 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR12671651 completed mapping pipeline successfully