Starting /dee2/code/volunteer_pipeline.sh SRR12671652 current disk space = 3051790667776 free memory = 1407314996 SRR12671652 SRAfilesize cc48fe16bf7531ad869f5fa61caba5f0 SRR12671652.sra SRR12671652.sra file validated SRR12671652 is paired end SRR12671652 is conventional basespace SRR12671652 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671652_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4365 37.0 37.0 37.0 37.0 37.0 2 36.226 37.0 37.0 37.0 37.0 37.0 3 36.5065 37.0 37.0 37.0 37.0 37.0 4 36.5115 37.0 37.0 37.0 37.0 37.0 5 36.5065 37.0 37.0 37.0 37.0 37.0 6 36.471 37.0 37.0 37.0 37.0 37.0 7 36.4795 37.0 37.0 37.0 37.0 37.0 8 36.4405 37.0 37.0 37.0 37.0 37.0 9 36.5555 37.0 37.0 37.0 37.0 37.0 10-14 36.5214 37.0 37.0 37.0 37.0 37.0 15-19 36.4867 37.0 37.0 37.0 37.0 37.0 20-24 36.4871 37.0 37.0 37.0 37.0 37.0 25-29 36.4297 37.0 37.0 37.0 37.0 37.0 30-34 36.4393 37.0 37.0 37.0 37.0 37.0 35-39 36.3822 37.0 37.0 37.0 37.0 37.0 40-44 36.3752 37.0 37.0 37.0 37.0 37.0 45-49 36.3356 37.0 37.0 37.0 37.0 37.0 50-54 36.3258 37.0 37.0 37.0 37.0 37.0 55-59 36.29549999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.234300000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.264900000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.288000000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.21810000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.259 37.0 37.0 37.0 37.0 37.0 85-89 36.2399 37.0 37.0 37.0 37.0 37.0 90-94 36.2029 37.0 37.0 37.0 37.0 37.0 95-99 36.1536 37.0 37.0 37.0 37.0 37.0 100-104 36.1897 37.0 37.0 37.0 37.0 37.0 105-109 36.122400000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.061 37.0 37.0 37.0 37.0 37.0 115-119 36.0882 37.0 37.0 37.0 37.0 37.0 120-124 36.0413 37.0 37.0 37.0 37.0 37.0 125-129 35.9551 37.0 37.0 37.0 37.0 37.0 130-134 35.9636 37.0 37.0 37.0 37.0 37.0 135-139 35.9569 37.0 37.0 37.0 37.0 37.0 140-144 35.8633 37.0 37.0 37.0 37.0 37.0 145-149 35.808099999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.359 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 2.0 26 3.0 27 7.0 28 10.0 29 19.0 30 33.0 31 43.0 32 59.0 33 77.0 34 130.0 35 343.0 36 2911.0 37 361.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.425000000000004 15.475 10.125 38.975 2 20.908634538152608 19.503012048192772 38.55421686746988 21.03413654618474 3 16.875 25.55 29.099999999999998 28.475 4 21.5 32.9 23.075000000000003 22.525000000000002 5 21.099999999999998 36.1 23.974999999999998 18.825 6 17.9 36.7 25.55 19.85 7 14.625 20.674999999999997 43.95 20.75 8 18.325 23.275000000000002 31.35 27.05 9 17.349999999999998 21.375 33.7 27.575 10-14 19.7 28.439999999999998 26.97 24.89 15-19 20.025000000000002 27.555000000000003 28.194999999999997 24.224999999999998 20-24 19.485 28.225 27.500000000000004 24.79 25-29 20.185 28.689999999999998 27.834999999999997 23.29 30-34 20.43 27.85 27.35 24.37 35-39 19.705000000000002 28.46 27.450000000000003 24.385 40-44 20.455000000000002 28.325 27.935 23.285 45-49 20.21 28.76 27.284999999999997 23.745 50-54 19.99 28.33 27.58 24.099999999999998 55-59 19.96 28.499999999999996 27.215 24.325 60-64 20.31 28.050000000000004 27.76 23.880000000000003 65-69 20.185 27.97 27.735 24.11 70-74 19.84 28.194999999999997 27.689999999999998 24.275 75-79 20.150000000000002 28.325 27.265 24.26 80-84 20.3 28.134999999999998 27.725 23.84 85-89 20.635 27.884999999999998 27.445000000000004 24.035 90-94 20.555 27.48 27.605 24.36 95-99 20.415 28.27 27.435 23.880000000000003 100-104 20.32 28.405 27.685 23.59 105-109 20.575 27.51 28.21 23.705000000000002 110-114 20.65 27.6 27.455000000000002 24.295 115-119 20.955 27.85 27.35 23.845 120-124 20.990000000000002 26.939999999999998 27.529999999999998 24.54 125-129 20.775 28.315 27.02 23.89 130-134 21.46 27.950000000000003 27.055 23.535 135-139 21.12 27.57 27.26 24.05 140-144 21.305 27.48 27.07 24.145 145-149 21.135 28.005000000000003 26.790000000000003 24.07 150-151 21.712500000000002 27.9125 27.037499999999998 23.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 4.0 24 4.5 25 1.5 26 3.0 27 7.5 28 12.0 29 13.0 30 19.5 31 29.5 32 33.0 33 37.0 34 60.5 35 78.5 36 82.0 37 107.0 38 124.5 39 146.5 40 183.0 41 203.0 42 229.0 43 245.5 44 254.5 45 263.5 46 253.5 47 247.0 48 242.0 49 205.5 50 170.0 51 154.0 52 130.0 53 100.0 54 74.0 55 60.5 56 56.0 57 55.0 58 41.5 59 22.5 60 12.5 61 9.5 62 7.5 63 5.5 64 3.0 65 0.0 66 1.5 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.58288770053476 87.5 2 5.909090909090909 11.05 3 0.4812834224598931 1.35 4 0.026737967914438502 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 0.9874999999999999 0.0 0.0 0.0 0.0 114-115 1.1125 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.6125 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.2375 0.0 0.0 0.0 0.0 130-131 2.575 0.0 0.0 0.0 0.0 132-133 2.9000000000000004 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.375 0.0 0.0 0.0 0.0 138-139 3.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTAC 10 0.006830828 145.0 5 CACTATA 10 0.006830828 145.0 1 >>END_MODULE SRR12671652 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671652_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.161 37.0 37.0 37.0 37.0 37.0 2 35.9165 37.0 37.0 37.0 37.0 37.0 3 36.068 37.0 37.0 37.0 37.0 37.0 4 36.0305 37.0 37.0 37.0 37.0 37.0 5 36.1795 37.0 37.0 37.0 37.0 37.0 6 36.1135 37.0 37.0 37.0 37.0 37.0 7 36.1195 37.0 37.0 37.0 37.0 37.0 8 36.2455 37.0 37.0 37.0 37.0 37.0 9 36.21 37.0 37.0 37.0 37.0 37.0 10-14 36.1346 37.0 37.0 37.0 37.0 37.0 15-19 36.1442 37.0 37.0 37.0 37.0 37.0 20-24 36.0844 37.0 37.0 37.0 37.0 37.0 25-29 36.005399999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.012699999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.026599999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.0144 37.0 37.0 37.0 37.0 37.0 45-49 35.9243 37.0 37.0 37.0 37.0 37.0 50-54 35.9452 37.0 37.0 37.0 37.0 37.0 55-59 35.858799999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.8806 37.0 37.0 37.0 37.0 37.0 65-69 35.7889 37.0 37.0 37.0 37.0 37.0 70-74 35.7671 37.0 37.0 37.0 37.0 37.0 75-79 35.7394 37.0 37.0 37.0 37.0 37.0 80-84 35.80380000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.67659999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.6722 37.0 37.0 37.0 37.0 37.0 95-99 35.7307 37.0 37.0 37.0 37.0 37.0 100-104 35.6235 37.0 37.0 37.0 37.0 37.0 105-109 35.568 37.0 37.0 37.0 37.0 37.0 110-114 35.5646 37.0 37.0 37.0 37.0 37.0 115-119 35.556200000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.473299999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.4708 37.0 37.0 37.0 37.0 37.0 130-134 35.4019 37.0 37.0 37.0 37.0 37.0 135-139 35.347300000000004 37.0 37.0 37.0 34.6 37.0 140-144 35.187400000000004 37.0 37.0 37.0 29.8 37.0 145-149 35.2143 37.0 37.0 37.0 32.2 37.0 150-151 34.80525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 0.0 15 3.0 16 0.0 17 1.0 18 1.0 19 3.0 20 1.0 21 5.0 22 3.0 23 2.0 24 7.0 25 14.0 26 8.0 27 21.0 28 20.0 29 23.0 30 32.0 31 58.0 32 73.0 33 105.0 34 233.0 35 594.0 36 2583.0 37 206.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.9 20.549999999999997 14.05 28.499999999999996 2 26.924999999999997 23.075000000000003 34.675 15.325 3 18.925 27.35 34.525 19.2 4 22.05 34.1 23.275000000000002 20.575 5 22.6 37.325 21.5 18.575 6 18.625 39.35 21.75 20.275000000000002 7 19.925 17.675 41.575 20.825 8 20.549999999999997 22.575 25.674999999999997 31.2 9 20.4 25.074999999999996 28.775000000000002 25.75 10-14 23.01 28.694999999999997 25.990000000000002 22.305 15-19 22.945 27.175 27.939999999999998 21.94 20-24 22.345000000000002 28.08 27.175 22.400000000000002 25-29 22.575 27.965 27.55 21.91 30-34 22.325 28.42 27.644999999999996 21.61 35-39 22.115000000000002 27.605 28.349999999999998 21.93 40-44 22.759999999999998 27.675 27.76 21.805 45-49 23.035 27.46 27.805000000000003 21.7 50-54 22.725 28.050000000000004 27.07 22.155 55-59 22.895 27.87 27.13 22.105 60-64 23.105 27.339999999999996 27.275 22.28 65-69 22.55 28.575 26.705000000000002 22.17 70-74 23.405 28.29 26.13 22.175 75-79 22.825 28.04 27.065 22.07 80-84 23.1 28.58 26.784999999999997 21.535 85-89 23.455000000000002 27.245 27.18 22.12 90-94 23.47 27.975 26.950000000000003 21.605 95-99 23.215 27.735 27.42 21.63 100-104 23.07 27.565 27.625 21.740000000000002 105-109 23.585 27.465 27.794999999999998 21.154999999999998 110-114 23.645 27.715 27.07 21.57 115-119 23.605 26.96 27.85 21.584999999999997 120-124 23.445 27.694999999999997 27.43 21.43 125-129 23.95 27.98 27.224999999999998 20.845 130-134 24.15 27.584999999999997 27.43 20.835 135-139 24.115000000000002 28.205000000000002 26.545 21.135 140-144 23.96 27.875 26.974999999999998 21.19 145-149 24.385 27.675 27.08 20.86 150-151 24.462500000000002 28.787499999999998 26.85 19.900000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 1.5 23 4.0 24 4.0 25 3.0 26 2.0 27 4.0 28 9.5 29 10.5 30 10.0 31 15.0 32 27.0 33 36.0 34 46.5 35 62.0 36 69.5 37 99.5 38 120.5 39 139.0 40 176.5 41 207.0 42 239.5 43 263.0 44 276.0 45 258.0 46 237.5 47 235.5 48 239.0 49 218.5 50 180.0 51 164.0 52 132.5 53 103.0 54 100.5 55 76.0 56 44.5 57 33.5 58 31.0 59 32.5 60 29.0 61 18.5 62 10.5 63 7.0 64 4.0 65 2.0 66 1.0 67 1.5 68 1.5 69 0.5 70 0.0 71 0.5 72 1.0 73 0.5 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.25 #Duplication Level Percentage of deduplicated Percentage of total 1 93.53887399463807 87.225 2 5.7640750670241285 10.75 3 0.6166219839142092 1.725 4 0.08042895442359249 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.8374999999999999 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.175 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.45 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.65 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.1625 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.825 0.0 0.0 0.0 0.0 134-135 3.05 0.0 0.0 0.0 0.0 136-137 3.3 0.0 0.0 0.0 0.0 138-139 3.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTTTG 10 0.006830828 145.0 145 AGAGGCT 10 0.006830828 145.0 6 CAGAGGC 10 0.006830828 145.0 5 AGAGCGT 10 0.006830828 145.0 145 >>END_MODULE Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983211 spots for SRR12671652.sra Written 983211 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra Read 983209 spots for SRR12671652.sra Written 983209 spots for SRR12671652.sra SRR ids: ['SRR12671652.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dxcl915b SRR12671652.sra spots: 19664182 blocks: [[1, 983209], [983210, 1966418], [1966419, 2949627], [2949628, 3932836], [3932837, 4916045], [4916046, 5899254], [5899255, 6882463], [6882464, 7865672], [7865673, 8848881], [8848882, 9832090], [9832091, 10815299], [10815300, 11798508], [11798509, 12781717], [12781718, 13764926], [13764927, 14748135], [14748136, 15731344], [15731345, 16714553], [16714554, 17697762], [17697763, 18680971], [18680972, 19664182]] SRR12671652 file size 6661048 SRR12671652 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671652 SRR12671652_1.fastq SRR12671652_2.fastq Input file: SRR12671652_1.fastq Paired file: SRR12671652_2.fastq trimmed: SRR12671652-trimmed-pair1.fastq, SRR12671652-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:03:31 2025 >> started Wed Feb 12 00:03:53 2025 >> done (21.486s) 19664182 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 2850 ( 0.01%) empty read pairs filtered out after trimming by size control 19661315 (99.99%) read pairs available; of these: 1078234 ( 5.48%) trimmed read pairs available after processing 18583081 (94.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 2 0.00% 21 3 0.00% 22 5 0.00% 23 1 0.00% 24 7 0.00% 25 3 0.00% 26 4 0.00% 27 5 0.00% 28 9 0.00% 29 7 0.00% 30 5 0.00% 31 10 0.00% 32 5 0.00% 33 12 0.00% 34 5 0.00% 35 19 0.00% 36 12 0.00% 37 13 0.00% 38 9 0.00% 39 22 0.00% 40 17 0.00% 41 18 0.00% 42 24 0.00% 43 19 0.00% 44 33 0.00% 45 19 0.00% 46 31 0.00% 47 29 0.00% 48 42 0.00% 49 34 0.00% 50 39 0.00% 51 45 0.00% 52 53 0.00% 53 66 0.00% 54 57 0.00% 55 55 0.00% 56 58 0.00% 57 87 0.00% 58 70 0.00% 59 83 0.00% 60 107 0.00% 61 118 0.00% 62 156 0.00% 63 149 0.00% 64 184 0.00% 65 180 0.00% 66 167 0.00% 67 201 0.00% 68 219 0.00% 69 244 0.00% 70 291 0.00% 71 330 0.00% 72 352 0.00% 73 459 0.00% 74 489 0.00% 75 502 0.00% 76 551 0.00% 77 637 0.00% 78 699 0.00% 79 782 0.00% 80 838 0.00% 81 1003 0.01% 82 1159 0.01% 83 1301 0.01% 84 1422 0.01% 85 1656 0.01% 86 1722 0.01% 87 1887 0.01% 88 1886 0.01% 89 2247 0.01% 90 2295 0.01% 91 2709 0.01% 92 2944 0.01% 93 3300 0.02% 94 3785 0.02% 95 4032 0.02% 96 4257 0.02% 97 4404 0.02% 98 4689 0.02% 99 5060 0.03% 100 5377 0.03% 101 5814 0.03% 102 6259 0.03% 103 6959 0.04% 104 7247 0.04% 105 7756 0.04% 106 8212 0.04% 107 8419 0.04% 108 9036 0.05% 109 9037 0.05% 110 9686 0.05% 111 10017 0.05% 112 10824 0.06% 113 11314 0.06% 114 12356 0.06% 115 13141 0.07% 116 13601 0.07% 117 14111 0.07% 118 14379 0.07% 119 14726 0.07% 120 15285 0.08% 121 15744 0.08% 122 16724 0.09% 123 17802 0.09% 124 18365 0.09% 125 19385 0.10% 126 20199 0.10% 127 20621 0.10% 128 21016 0.11% 129 21377 0.11% 130 21820 0.11% 131 22277 0.11% 132 23662 0.12% 133 24822 0.13% 134 25443 0.13% 135 26906 0.14% 136 27307 0.14% 137 28298 0.14% 138 28714 0.15% 139 28743 0.15% 140 29196 0.15% 141 29972 0.15% 142 31221 0.16% 143 32138 0.16% 144 33973 0.17% 145 34952 0.18% 146 35971 0.18% 147 36085 0.18% 148 37802 0.19% 149 36639 0.19% 150 37048 0.19% 151 18583081 94.52% 19661315 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=29 prefix-density=0.64 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=153.57 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=8.3 sequence=TCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=28 prefix-density=0.60 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=51.24 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.4 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR12671652 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:04:36 Started mapping on | Feb 12 00:04:36 Finished on | Feb 12 00:06:31 Mapping speed, Million of reads per hour | 615.48 Number of input reads | 19661315 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18376740 Uniquely mapped reads % | 93.47% Average mapped length | 298.35 Number of splices: Total | 18815763 Number of splices: Annotated (sjdb) | 18464227 Number of splices: GT/AG | 18452565 Number of splices: GC/AG | 304786 Number of splices: AT/AC | 10262 Number of splices: Non-canonical | 48150 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453051 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 141346 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.32% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 831524 831524 831524 N_multimapping 453051 453051 453051 N_noFeature 620814 18122698 697669 N_ambiguous 289454 1155 111759 UnstrandedReadsAssigned:17466472 PositiveStrandReadsAssigned:252887 NegativeStrandReadsAssigned:17567312 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671652 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671652-trimmed-pair1.fastq SRR12671652-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,661,315 reads, 17,609,917 reads pseudoaligned [quant] estimated average fragment length: 297.989 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR12671652.ke.tsv 34699 SRR12671652.se.tsv 87100 total ==> SRR12671652.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1721.01 589 17.6166 Potri.005G024800.1.v4.1 1035 738.011 285 19.878 Potri.004G059700.1.v4.1 961 664.437 6 0.464824 Potri.007G009000.2.v4.1 1416 1119.01 0 0 Potri.003G141000.2.v4.1 2943 2646.01 1028 19.9983 Potri.016G087400.1.v4.1 270 74.4917 690 476.796 Potri.015G069301.1.v4.1 564 292.078 0 0 Potri.010G195200.1.v4.1 1773 1476.01 75 2.61555 Potri.012G127500.1.v4.1 977 680.264 98 7.41549 ==> SRR12671652.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 387 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 190 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12671652 completed mapping pipeline successfully