Starting /dee2/code/volunteer_pipeline.sh SRR12671653 current disk space = 3051676971008 free memory = 1069008732 SRR12671653 SRAfilesize f8b122c972c1ff358f1d5e8115a6b569 SRR12671653.sra SRR12671653.sra file validated SRR12671653 is paired end SRR12671653 is conventional basespace SRR12671653 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671653_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.237 37.0 37.0 37.0 37.0 37.0 2 36.22075 37.0 37.0 37.0 37.0 37.0 3 36.438 37.0 37.0 37.0 37.0 37.0 4 36.417 37.0 37.0 37.0 37.0 37.0 5 36.561 37.0 37.0 37.0 37.0 37.0 6 36.427 37.0 37.0 37.0 37.0 37.0 7 36.489 37.0 37.0 37.0 37.0 37.0 8 36.5465 37.0 37.0 37.0 37.0 37.0 9 36.538 37.0 37.0 37.0 37.0 37.0 10-14 36.548199999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.53529999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.53059999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.4782 37.0 37.0 37.0 37.0 37.0 30-34 36.5052 37.0 37.0 37.0 37.0 37.0 35-39 36.4721 37.0 37.0 37.0 37.0 37.0 40-44 36.4714 37.0 37.0 37.0 37.0 37.0 45-49 36.4144 37.0 37.0 37.0 37.0 37.0 50-54 36.340199999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.378699999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.3758 37.0 37.0 37.0 37.0 37.0 65-69 36.3648 37.0 37.0 37.0 37.0 37.0 70-74 36.296299999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.27470000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.293099999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.24 37.0 37.0 37.0 37.0 37.0 90-94 36.2211 37.0 37.0 37.0 37.0 37.0 95-99 36.175599999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2308 37.0 37.0 37.0 37.0 37.0 105-109 36.1176 37.0 37.0 37.0 37.0 37.0 110-114 36.1037 37.0 37.0 37.0 37.0 37.0 115-119 36.1365 37.0 37.0 37.0 37.0 37.0 120-124 36.0622 37.0 37.0 37.0 37.0 37.0 125-129 35.9741 37.0 37.0 37.0 37.0 37.0 130-134 35.9431 37.0 37.0 37.0 37.0 37.0 135-139 35.930699999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.8589 37.0 37.0 37.0 37.0 37.0 145-149 35.8187 37.0 37.0 37.0 37.0 37.0 150-151 35.3085 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 2.0 27 10.0 28 5.0 29 24.0 30 23.0 31 40.0 32 48.0 33 69.0 34 107.0 35 350.0 36 2989.0 37 330.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.625 16.85 8.799999999999999 38.725 2 19.85460015041364 21.985460015041365 39.53371772374029 18.62622211080471 3 17.525 28.9 28.199999999999996 25.374999999999996 4 21.125 35.225 22.85 20.8 5 20.125 38.425 23.3 18.15 6 17.275 37.425000000000004 24.25 21.05 7 14.825 20.525 46.150000000000006 18.5 8 18.15 23.400000000000002 27.85 30.599999999999998 9 17.275 21.975 32.725 28.025 10-14 19.994999999999997 29.044999999999998 26.395000000000003 24.565 15-19 19.415 28.060000000000002 28.110000000000003 24.415 20-24 19.580000000000002 28.1 28.665000000000003 23.655 25-29 19.775000000000002 27.985 28.255000000000003 23.985 30-34 19.52 29.310000000000002 27.725 23.445 35-39 18.775 28.82 27.915 24.490000000000002 40-44 19.509999999999998 28.505000000000003 27.52 24.465 45-49 20.145 28.449999999999996 27.38 24.025 50-54 19.405 28.904999999999998 27.834999999999997 23.855 55-59 20.169999999999998 28.999999999999996 27.67 23.16 60-64 19.8 28.349999999999998 27.894999999999996 23.955000000000002 65-69 19.915 28.335 27.884999999999998 23.865 70-74 20.435 28.23 28.005000000000003 23.330000000000002 75-79 20.419999999999998 28.000000000000004 27.634999999999998 23.945 80-84 20.365 28.74 27.075 23.82 85-89 21.09 28.105000000000004 26.979999999999997 23.825 90-94 19.855 28.835 27.334999999999997 23.974999999999998 95-99 20.515 28.075 27.500000000000004 23.91 100-104 20.23 28.349999999999998 27.765 23.655 105-109 20.724999999999998 28.084999999999997 27.37 23.82 110-114 19.97 28.28 28.1 23.65 115-119 20.445 28.115000000000002 27.644999999999996 23.794999999999998 120-124 20.71 28.16 27.76 23.369999999999997 125-129 20.62 28.035 28.105000000000004 23.24 130-134 21.195 28.585 26.86 23.36 135-139 20.845 28.03 27.6 23.525 140-144 20.895 27.965 27.275 23.865 145-149 20.585 28.92 27.12 23.375 150-151 20.0125 27.975 27.537499999999998 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 1.5 25 1.5 26 3.0 27 6.5 28 13.5 29 19.0 30 21.5 31 30.0 32 38.5 33 46.5 34 54.0 35 74.5 36 97.5 37 111.0 38 136.5 39 174.5 40 192.0 41 203.5 42 243.5 43 265.0 44 260.5 45 263.5 46 265.5 47 249.0 48 214.0 49 184.0 50 180.5 51 152.5 52 114.0 53 89.0 54 67.5 55 65.5 56 47.5 57 30.5 58 24.5 59 17.0 60 10.5 61 5.0 62 6.5 63 7.0 64 4.5 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.05 #Duplication Level Percentage of deduplicated Percentage of total 1 94.07230196703881 88.47500000000001 2 5.5289739500265815 10.4 3 0.3987240829346092 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.2 0.0 0.0 0.0 0.0 120-121 1.2999999999999998 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.8 0.0 0.0 0.0 0.0 128-129 2.0375 0.0 0.0 0.0 0.0 130-131 2.375 0.0 0.0 0.0 0.0 132-133 2.7249999999999996 0.0 0.0 0.0 0.0 134-135 2.9625 0.0 0.0 0.0 0.0 136-137 3.175 0.0 0.0 0.0 0.0 138-139 3.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTATCC 10 0.006830828 145.0 6 CGATCCG 10 0.006830828 145.0 145 >>END_MODULE SRR12671653 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671653_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.207 37.0 37.0 37.0 37.0 37.0 2 35.9565 37.0 37.0 37.0 37.0 37.0 3 36.0285 37.0 37.0 37.0 37.0 37.0 4 35.9805 37.0 37.0 37.0 37.0 37.0 5 36.0725 37.0 37.0 37.0 37.0 37.0 6 36.0815 37.0 37.0 37.0 37.0 37.0 7 36.0995 37.0 37.0 37.0 37.0 37.0 8 36.07 37.0 37.0 37.0 37.0 37.0 9 36.1235 37.0 37.0 37.0 37.0 37.0 10-14 36.1958 37.0 37.0 37.0 37.0 37.0 15-19 36.1504 37.0 37.0 37.0 37.0 37.0 20-24 36.1318 37.0 37.0 37.0 37.0 37.0 25-29 36.0515 37.0 37.0 37.0 37.0 37.0 30-34 36.0621 37.0 37.0 37.0 37.0 37.0 35-39 35.938599999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.9621 37.0 37.0 37.0 37.0 37.0 45-49 35.96679999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.9422 37.0 37.0 37.0 37.0 37.0 55-59 35.9105 37.0 37.0 37.0 37.0 37.0 60-64 35.8597 37.0 37.0 37.0 37.0 37.0 65-69 35.7696 37.0 37.0 37.0 37.0 37.0 70-74 35.7938 37.0 37.0 37.0 37.0 37.0 75-79 35.75320000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.7567 37.0 37.0 37.0 37.0 37.0 85-89 35.6528 37.0 37.0 37.0 37.0 37.0 90-94 35.58579999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.7211 37.0 37.0 37.0 37.0 37.0 100-104 35.681799999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.531099999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.5587 37.0 37.0 37.0 37.0 37.0 115-119 35.5554 37.0 37.0 37.0 37.0 37.0 120-124 35.527300000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.3818 37.0 37.0 37.0 34.6 37.0 130-134 35.4338 37.0 37.0 37.0 37.0 37.0 135-139 35.3457 37.0 37.0 37.0 34.6 37.0 140-144 35.0955 37.0 37.0 37.0 27.4 37.0 145-149 35.2112 37.0 37.0 37.0 32.2 37.0 150-151 34.745999999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 0.0 16 1.0 17 2.0 18 0.0 19 4.0 20 0.0 21 4.0 22 3.0 23 2.0 24 8.0 25 10.0 26 9.0 27 7.0 28 21.0 29 27.0 30 32.0 31 52.0 32 78.0 33 136.0 34 255.0 35 628.0 36 2542.0 37 175.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.475 18.65 12.825000000000001 30.049999999999997 2 24.425 24.349999999999998 35.199999999999996 16.025 3 18.7 28.299999999999997 33.375 19.625 4 22.975 35.775 22.025 19.225 5 21.9 37.875 22.025 18.2 6 19.0 38.1 22.775000000000002 20.125 7 17.625 16.900000000000002 44.175 21.3 8 20.0 22.675 26.724999999999998 30.599999999999998 9 20.825 24.8 29.25 25.124999999999996 10-14 22.55 28.77 26.575 22.105 15-19 22.95 28.084999999999997 27.82 21.145 20-24 22.06 28.29 28.15 21.5 25-29 22.625 28.285 28.02 21.07 30-34 22.55 28.22 27.939999999999998 21.29 35-39 22.55 27.839999999999996 28.310000000000002 21.3 40-44 22.665 28.689999999999998 27.589999999999996 21.055 45-49 22.41 28.23 27.97 21.39 50-54 22.485 27.88 28.18 21.455 55-59 22.66 27.700000000000003 28.084999999999997 21.555 60-64 22.46 27.72 28.355000000000004 21.465 65-69 23.04 27.515 28.32 21.125 70-74 23.22 28.335 27.33 21.115000000000002 75-79 22.900000000000002 27.875 27.37 21.855 80-84 23.36 27.47 27.705000000000002 21.465 85-89 23.24 27.529999999999998 28.110000000000003 21.12 90-94 23.68 27.435 27.889999999999997 20.995 95-99 23.165 28.12 27.089999999999996 21.625 100-104 23.064999999999998 28.185 27.744999999999997 21.005 105-109 23.635 27.815 27.275 21.275 110-114 23.150000000000002 27.950000000000003 28.16 20.74 115-119 23.565 27.650000000000002 27.57 21.215 120-124 23.46 27.865000000000002 27.639999999999997 21.035 125-129 24.055 27.82 27.639999999999997 20.485 130-134 24.22 26.834999999999997 28.08 20.865000000000002 135-139 24.425 27.139999999999997 27.935 20.5 140-144 24.54 27.605 27.355 20.5 145-149 24.62 27.905 27.055 20.419999999999998 150-151 23.775 27.8625 27.925 20.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 2.0 23 1.0 24 0.5 25 5.0 26 8.5 27 8.0 28 7.5 29 10.0 30 22.5 31 28.0 32 30.5 33 33.5 34 44.0 35 71.0 36 92.0 37 107.5 38 136.0 39 167.5 40 180.5 41 207.5 42 238.0 43 257.0 44 274.0 45 274.5 46 265.0 47 255.5 48 227.5 49 204.5 50 178.0 51 141.5 52 107.0 53 83.5 54 74.0 55 58.0 56 45.5 57 39.0 58 30.5 59 21.0 60 17.0 61 8.5 62 7.0 63 7.0 64 4.5 65 2.5 66 1.5 67 2.5 68 1.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.0 #Duplication Level Percentage of deduplicated Percentage of total 1 94.30851063829788 88.64999999999999 2 5.079787234042553 9.55 3 0.5319148936170213 1.5 4 0.07978723404255318 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 0.9125000000000001 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.2999999999999998 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.8 0.0 0.0 0.0 0.0 128-129 2.0375 0.0 0.0 0.0 0.0 130-131 2.375 0.0 0.0 0.0 0.0 132-133 2.7249999999999996 0.0 0.0 0.0 0.0 134-135 2.9625 0.0 0.0 0.0 0.0 136-137 3.175 0.0 0.0 0.0 0.0 138-139 3.4749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGTG 10 0.006830828 145.0 7 TTACAAA 10 0.006830828 145.0 145 CTTGGAC 10 0.006830828 145.0 6 TTGGACT 10 0.006830828 145.0 7 CTCAAGT 10 0.006830828 145.0 6 GGGGGGG 20 0.00593511 29.0 135-139 >>END_MODULE Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947173 spots for SRR12671653.sra Written 947173 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra Read 947169 spots for SRR12671653.sra Written 947169 spots for SRR12671653.sra SRR ids: ['SRR12671653.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t3io8fe8 SRR12671653.sra spots: 18943384 blocks: [[1, 947169], [947170, 1894338], [1894339, 2841507], [2841508, 3788676], [3788677, 4735845], [4735846, 5683014], [5683015, 6630183], [6630184, 7577352], [7577353, 8524521], [8524522, 9471690], [9471691, 10418859], [10418860, 11366028], [11366029, 12313197], [12313198, 13260366], [13260367, 14207535], [14207536, 15154704], [15154705, 16101873], [16101874, 17049042], [17049043, 17996211], [17996212, 18943384]] SRR12671653 file size 6416090 SRR12671653 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671653 SRR12671653_1.fastq SRR12671653_2.fastq Input file: SRR12671653_1.fastq Paired file: SRR12671653_2.fastq trimmed: SRR12671653-trimmed-pair1.fastq, SRR12671653-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:14:55 2025 >> started Wed Feb 12 00:15:17 2025 >> done (21.287s) 18943384 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 1399 ( 0.01%) empty read pairs filtered out after trimming by size control 18941965 (99.99%) read pairs available; of these: 888663 ( 4.69%) trimmed read pairs available after processing 18053302 (95.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 4 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 2 0.00% 25 8 0.00% 26 3 0.00% 27 4 0.00% 28 8 0.00% 29 3 0.00% 30 3 0.00% 31 9 0.00% 32 9 0.00% 33 6 0.00% 34 9 0.00% 35 17 0.00% 36 13 0.00% 37 5 0.00% 38 9 0.00% 39 7 0.00% 40 19 0.00% 41 10 0.00% 42 23 0.00% 43 22 0.00% 44 18 0.00% 45 26 0.00% 46 22 0.00% 47 30 0.00% 48 23 0.00% 49 32 0.00% 50 57 0.00% 51 45 0.00% 52 40 0.00% 53 51 0.00% 54 63 0.00% 55 58 0.00% 56 57 0.00% 57 62 0.00% 58 67 0.00% 59 95 0.00% 60 89 0.00% 61 120 0.00% 62 127 0.00% 63 135 0.00% 64 147 0.00% 65 166 0.00% 66 159 0.00% 67 188 0.00% 68 194 0.00% 69 224 0.00% 70 241 0.00% 71 298 0.00% 72 342 0.00% 73 430 0.00% 74 450 0.00% 75 521 0.00% 76 478 0.00% 77 557 0.00% 78 625 0.00% 79 690 0.00% 80 733 0.00% 81 873 0.00% 82 1015 0.01% 83 1137 0.01% 84 1379 0.01% 85 1348 0.01% 86 1537 0.01% 87 1603 0.01% 88 1663 0.01% 89 1783 0.01% 90 1983 0.01% 91 2242 0.01% 92 2522 0.01% 93 2969 0.02% 94 3304 0.02% 95 3574 0.02% 96 3649 0.02% 97 3733 0.02% 98 3789 0.02% 99 4040 0.02% 100 4477 0.02% 101 4755 0.03% 102 5278 0.03% 103 5815 0.03% 104 6099 0.03% 105 6675 0.04% 106 6926 0.04% 107 7016 0.04% 108 7275 0.04% 109 7335 0.04% 110 7809 0.04% 111 8392 0.04% 112 9043 0.05% 113 9633 0.05% 114 10274 0.05% 115 10796 0.06% 116 11369 0.06% 117 11551 0.06% 118 11778 0.06% 119 11956 0.06% 120 12527 0.07% 121 12765 0.07% 122 13399 0.07% 123 14492 0.08% 124 15441 0.08% 125 16218 0.09% 126 16574 0.09% 127 17092 0.09% 128 16887 0.09% 129 17391 0.09% 130 17846 0.09% 131 18353 0.10% 132 18935 0.10% 133 20171 0.11% 134 21016 0.11% 135 22174 0.12% 136 22608 0.12% 137 22871 0.12% 138 23917 0.13% 139 23815 0.13% 140 23916 0.13% 141 24508 0.13% 142 25565 0.13% 143 26039 0.14% 144 27834 0.15% 145 28861 0.15% 146 29656 0.16% 147 29777 0.16% 148 30731 0.16% 149 30589 0.16% 150 30435 0.16% 151 18053302 95.31% 18941965 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=33 prefix-density=0.37 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=22.87 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.3 sequence=AGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAA criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=34 prefix-density=0.51 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=27 fanout-score=21.38 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=8.2 sequence=CAAGGAAAATCCTTCCAGTGTGAACT SRR12671653 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:16:01 Started mapping on | Feb 12 00:16:01 Finished on | Feb 12 00:18:29 Mapping speed, Million of reads per hour | 460.75 Number of input reads | 18941965 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17629628 Uniquely mapped reads % | 93.07% Average mapped length | 298.55 Number of splices: Total | 17490146 Number of splices: Annotated (sjdb) | 17123967 Number of splices: GT/AG | 17139113 Number of splices: GC/AG | 286581 Number of splices: AT/AC | 11811 Number of splices: Non-canonical | 52641 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 440353 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 79285 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.07% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 871984 871984 871984 N_multimapping 440353 440353 440353 N_noFeature 677174 17357614 761985 N_ambiguous 312207 1227 124345 UnstrandedReadsAssigned:16640247 PositiveStrandReadsAssigned:270787 NegativeStrandReadsAssigned:16743298 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671653 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671653-trimmed-pair1.fastq SRR12671653-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,941,965 reads, 16,735,497 reads pseudoaligned [quant] estimated average fragment length: 309.653 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR12671653.ke.tsv 34699 SRR12671653.se.tsv 87100 total ==> SRR12671653.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1709.35 925 30.2493 Potri.005G024800.1.v4.1 1035 726.347 354 27.2435 Potri.004G059700.1.v4.1 961 653.196 0 0 Potri.007G009000.2.v4.1 1416 1107.35 0 0 Potri.003G141000.2.v4.1 2943 2634.35 1279 27.1394 Potri.016G087400.1.v4.1 270 72.8051 867 665.673 Potri.015G069301.1.v4.1 564 286.326 0 0 Potri.010G195200.1.v4.1 1773 1464.35 158 6.03138 Potri.012G127500.1.v4.1 977 668.777 95 7.94046 ==> SRR12671653.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 382 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 246 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12671653 completed mapping pipeline successfully