Starting /dee2/code/volunteer_pipeline.sh SRR12671654 current disk space = 3051357474816 free memory = 1431785952 SRR12671654 SRAfilesize b397f8ee799e86927e78823ba001f423 SRR12671654.sra SRR12671654.sra file validated SRR12671654 is paired end SRR12671654 is conventional basespace SRR12671654 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671654_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3505 37.0 37.0 37.0 37.0 37.0 2 36.28875 37.0 37.0 37.0 37.0 37.0 3 36.4845 37.0 37.0 37.0 37.0 37.0 4 36.592 37.0 37.0 37.0 37.0 37.0 5 36.557 37.0 37.0 37.0 37.0 37.0 6 36.538 37.0 37.0 37.0 37.0 37.0 7 36.4535 37.0 37.0 37.0 37.0 37.0 8 36.5905 37.0 37.0 37.0 37.0 37.0 9 36.5495 37.0 37.0 37.0 37.0 37.0 10-14 36.5538 37.0 37.0 37.0 37.0 37.0 15-19 36.5269 37.0 37.0 37.0 37.0 37.0 20-24 36.5256 37.0 37.0 37.0 37.0 37.0 25-29 36.524699999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4996 37.0 37.0 37.0 37.0 37.0 35-39 36.4394 37.0 37.0 37.0 37.0 37.0 40-44 36.454 37.0 37.0 37.0 37.0 37.0 45-49 36.43849999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.4356 37.0 37.0 37.0 37.0 37.0 55-59 36.3758 37.0 37.0 37.0 37.0 37.0 60-64 36.3929 37.0 37.0 37.0 37.0 37.0 65-69 36.337599999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2707 37.0 37.0 37.0 37.0 37.0 75-79 36.3346 37.0 37.0 37.0 37.0 37.0 80-84 36.2973 37.0 37.0 37.0 37.0 37.0 85-89 36.2699 37.0 37.0 37.0 37.0 37.0 90-94 36.2313 37.0 37.0 37.0 37.0 37.0 95-99 36.1772 37.0 37.0 37.0 37.0 37.0 100-104 36.257600000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.159499999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.163599999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1708 37.0 37.0 37.0 37.0 37.0 120-124 36.08710000000001 37.0 37.0 37.0 37.0 37.0 125-129 36.058800000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.0336 37.0 37.0 37.0 37.0 37.0 135-139 36.0573 37.0 37.0 37.0 37.0 37.0 140-144 35.952600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.896100000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.48675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 3.0 27 4.0 28 11.0 29 22.0 30 21.0 31 35.0 32 55.0 33 80.0 34 107.0 35 302.0 36 2976.0 37 383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.125 14.649999999999999 10.775 46.45 2 19.353221358736526 20.481323640010025 40.561544246678366 19.603910754575082 3 17.125 26.05 28.275 28.549999999999997 4 21.2 33.0 22.575 23.225 5 20.7 37.5 22.85 18.95 6 16.525000000000002 36.275 26.625 20.575 7 13.525 21.4 45.074999999999996 20.0 8 17.375 22.575 30.225 29.825000000000003 9 16.5 22.925 33.1 27.474999999999998 10-14 19.689999999999998 29.134999999999998 26.83 24.345 15-19 19.29 28.84 27.43 24.44 20-24 19.205 29.115000000000002 27.67 24.01 25-29 19.32 28.735 27.855 24.09 30-34 18.509999999999998 28.65 28.439999999999998 24.4 35-39 19.88 29.110000000000003 27.66 23.35 40-44 19.814999999999998 29.345 27.575 23.265 45-49 19.81 28.449999999999996 27.62 24.12 50-54 20.165 28.765 27.750000000000004 23.32 55-59 20.01 28.49 27.584999999999997 23.915 60-64 19.63 28.555000000000003 28.325 23.49 65-69 20.419999999999998 28.835 27.389999999999997 23.355 70-74 20.13 28.365000000000002 27.944999999999997 23.56 75-79 19.515 28.744999999999997 28.33 23.41 80-84 20.1 28.275 27.425 24.2 85-89 20.175 27.975 28.715000000000003 23.135 90-94 20.07 29.03 27.334999999999997 23.565 95-99 19.695 28.22 27.715 24.37 100-104 20.145 28.720000000000002 27.855 23.28 105-109 20.674999999999997 28.415000000000003 27.305 23.605 110-114 20.405 28.794999999999998 27.13 23.669999999999998 115-119 20.849999999999998 28.384999999999998 27.215 23.549999999999997 120-124 20.385 27.92 28.000000000000004 23.695 125-129 20.66 28.249999999999996 27.310000000000002 23.78 130-134 20.97 28.505000000000003 27.215 23.31 135-139 20.305 28.935 26.955000000000002 23.805 140-144 20.830000000000002 28.395 27.685 23.09 145-149 20.815 28.499999999999996 27.075 23.61 150-151 20.837500000000002 28.449999999999996 26.25 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.5 22 1.5 23 2.0 24 2.5 25 2.5 26 7.0 27 7.5 28 12.0 29 21.5 30 24.0 31 30.0 32 38.0 33 43.5 34 56.0 35 73.5 36 90.0 37 111.0 38 137.5 39 175.0 40 219.5 41 251.5 42 249.5 43 253.5 44 260.0 45 247.0 46 255.0 47 251.0 48 224.5 49 194.5 50 165.0 51 139.0 52 112.5 53 87.5 54 64.0 55 49.5 56 40.0 57 28.0 58 18.0 59 15.5 60 13.0 61 8.5 62 6.0 63 4.0 64 1.0 65 0.5 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.3 #Duplication Level Percentage of deduplicated Percentage of total 1 94.4591728525981 89.075 2 5.1166489925768825 9.65 3 0.3711558854718982 1.05 4 0.02651113467656416 0.1 5 0.02651113467656416 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGCTTCCCATAGTTGTCAAACCTTCTTTTTGTCTTCTCGACAGTAGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.175 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.7000000000000002 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.2125 0.0 0.0 0.0 0.0 128-129 2.5374999999999996 0.0 0.0 0.0 0.0 130-131 2.7875 0.0 0.0 0.0 0.0 132-133 3.15 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.8125 0.0 0.0 0.0 0.0 138-139 4.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATCTG 10 0.006830828 145.0 4 CCCATAG 10 0.006830828 145.0 8 TGCTTCC 10 0.006830828 145.0 3 TTGATCT 10 0.006830828 145.0 3 CCATAGT 10 0.006830828 145.0 9 TCACAAT 10 0.006830828 145.0 9 GCTTCCC 10 0.006830828 145.0 4 TTGCTTC 10 0.006830828 145.0 2 GAGAGAG 50 0.0013298223 17.4 135-139 >>END_MODULE SRR12671654 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671654_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1605 37.0 37.0 37.0 37.0 37.0 2 36.0305 37.0 37.0 37.0 37.0 37.0 3 36.2585 37.0 37.0 37.0 37.0 37.0 4 36.0235 37.0 37.0 37.0 37.0 37.0 5 36.197 37.0 37.0 37.0 37.0 37.0 6 36.177 37.0 37.0 37.0 37.0 37.0 7 36.2025 37.0 37.0 37.0 37.0 37.0 8 36.25 37.0 37.0 37.0 37.0 37.0 9 36.2925 37.0 37.0 37.0 37.0 37.0 10-14 36.2333 37.0 37.0 37.0 37.0 37.0 15-19 36.224199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.1957 37.0 37.0 37.0 37.0 37.0 25-29 36.1148 37.0 37.0 37.0 37.0 37.0 30-34 36.1599 37.0 37.0 37.0 37.0 37.0 35-39 36.1025 37.0 37.0 37.0 37.0 37.0 40-44 36.1083 37.0 37.0 37.0 37.0 37.0 45-49 36.049899999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.0475 37.0 37.0 37.0 37.0 37.0 55-59 36.0019 37.0 37.0 37.0 37.0 37.0 60-64 35.964999999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.9029 37.0 37.0 37.0 37.0 37.0 70-74 35.9425 37.0 37.0 37.0 37.0 37.0 75-79 35.9134 37.0 37.0 37.0 37.0 37.0 80-84 35.8957 37.0 37.0 37.0 37.0 37.0 85-89 35.7838 37.0 37.0 37.0 37.0 37.0 90-94 35.778299999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.8358 37.0 37.0 37.0 37.0 37.0 100-104 35.820100000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.7447 37.0 37.0 37.0 37.0 37.0 110-114 35.74829999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.6899 37.0 37.0 37.0 37.0 37.0 120-124 35.6821 37.0 37.0 37.0 37.0 37.0 125-129 35.6327 37.0 37.0 37.0 37.0 37.0 130-134 35.6098 37.0 37.0 37.0 37.0 37.0 135-139 35.5243 37.0 37.0 37.0 37.0 37.0 140-144 35.276799999999994 37.0 37.0 37.0 29.8 37.0 145-149 35.3907 37.0 37.0 37.0 34.6 37.0 150-151 35.03475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 2.0 22 4.0 23 4.0 24 3.0 25 8.0 26 9.0 27 13.0 28 15.0 29 27.0 30 38.0 31 57.0 32 62.0 33 98.0 34 201.0 35 537.0 36 2726.0 37 191.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.05 17.4 15.299999999999999 36.25 2 25.2 22.6 37.8 14.399999999999999 3 18.6 26.674999999999997 32.925 21.8 4 22.025 34.849999999999994 21.725 21.4 5 22.225 38.324999999999996 22.1 17.349999999999998 6 16.875 39.275 24.325 19.525000000000002 7 18.25 17.025000000000002 43.225 21.5 8 19.8 22.675 27.825 29.7 9 21.349999999999998 22.400000000000002 31.6 24.65 10-14 22.0 27.685 27.750000000000004 22.564999999999998 15-19 22.38 28.575 27.455000000000002 21.59 20-24 22.62 27.91 28.03 21.44 25-29 22.375 28.065 28.384999999999998 21.175 30-34 22.2 27.85 28.24 21.709999999999997 35-39 22.759999999999998 27.834999999999997 28.59 20.815 40-44 22.88 27.925 28.26 20.935000000000002 45-49 22.400000000000002 27.925 28.035 21.64 50-54 22.994999999999997 27.845 28.384999999999998 20.775 55-59 22.89 27.96 27.810000000000002 21.34 60-64 23.02 27.915 28.22 20.845 65-69 22.82 27.639999999999997 28.199999999999996 21.34 70-74 22.59 27.889999999999997 28.37 21.15 75-79 22.55 27.865000000000002 28.82 20.765 80-84 23.125 28.33 27.37 21.175 85-89 22.75 27.85 27.779999999999998 21.62 90-94 23.695 28.32 27.42 20.565 95-99 22.86 28.125 27.965 21.05 100-104 23.14 28.23 27.500000000000004 21.13 105-109 23.335 28.095 28.134999999999998 20.435 110-114 23.72 28.38 27.92 19.98 115-119 23.69 27.389999999999997 27.875 21.044999999999998 120-124 23.94 27.284999999999997 27.985 20.79 125-129 24.175 27.694999999999997 27.279999999999998 20.849999999999998 130-134 23.855 27.73 27.389999999999997 21.025 135-139 24.395 28.215 27.485 19.905 140-144 24.73 28.494999999999997 26.795 19.98 145-149 23.93 28.38 27.37 20.32 150-151 24.675 27.35 27.725 20.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 3.0 25 4.0 26 5.0 27 10.5 28 12.5 29 12.5 30 14.5 31 22.5 32 29.0 33 37.0 34 53.5 35 65.0 36 80.5 37 111.0 38 144.5 39 174.0 40 206.5 41 230.0 42 239.5 43 257.5 44 282.5 45 280.5 46 266.5 47 251.0 48 223.5 49 200.5 50 162.0 51 120.0 52 104.0 53 94.5 54 75.0 55 57.0 56 42.5 57 30.0 58 26.5 59 23.5 60 14.0 61 7.0 62 5.5 63 3.0 64 2.5 65 4.5 66 3.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.025 #Duplication Level Percentage of deduplicated Percentage of total 1 94.3100239298059 88.675 2 5.184791278915182 9.75 3 0.3988300983780909 1.125 4 0.05317734645041213 0.2 5 0.05317734645041213 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit CATCACCACTCCAAGCATTCTCTGCTGCACTTGCACTCTCTTCCATCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.725 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.1125 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.625 0.0 0.0 0.0 0.0 130-131 2.8875 0.0 0.0 0.0 0.0 132-133 3.25 0.0 0.0 0.0 0.0 134-135 3.5875 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138-139 4.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACTCC 10 0.006830828 145.0 6 CACTCCA 10 0.006830828 145.0 7 CACCACT 10 0.006830828 145.0 4 CCCTCCA 10 0.006830828 145.0 4 >>END_MODULE Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185940 spots for SRR12671654.sra Written 1185940 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra Read 1185939 spots for SRR12671654.sra Written 1185939 spots for SRR12671654.sra SRR ids: ['SRR12671654.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_19mlsnpd SRR12671654.sra spots: 23718781 blocks: [[1, 1185939], [1185940, 2371878], [2371879, 3557817], [3557818, 4743756], [4743757, 5929695], [5929696, 7115634], [7115635, 8301573], [8301574, 9487512], [9487513, 10673451], [10673452, 11859390], [11859391, 13045329], [13045330, 14231268], [14231269, 15417207], [15417208, 16603146], [16603147, 17789085], [17789086, 18975024], [18975025, 20160963], [20160964, 21346902], [21346903, 22532841], [22532842, 23718781]] SRR12671654 file size 8038979 SRR12671654 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671654 SRR12671654_1.fastq SRR12671654_2.fastq Input file: SRR12671654_1.fastq Paired file: SRR12671654_2.fastq trimmed: SRR12671654-trimmed-pair1.fastq, SRR12671654-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:35:02 2025 >> started Wed Feb 12 00:35:39 2025 >> done (37.520s) 23718781 read pairs processed; of these: 12 ( 0.00%) short read pairs filtered out after trimming by size control 1189 ( 0.01%) empty read pairs filtered out after trimming by size control 23717580 (99.99%) read pairs available; of these: 1710464 ( 7.21%) trimmed read pairs available after processing 22007116 (92.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 4 0.00% 21 0 0.00% 22 3 0.00% 23 1 0.00% 24 1 0.00% 25 7 0.00% 26 3 0.00% 27 5 0.00% 28 7 0.00% 29 9 0.00% 30 8 0.00% 31 10 0.00% 32 13 0.00% 33 16 0.00% 34 9 0.00% 35 18 0.00% 36 14 0.00% 37 15 0.00% 38 16 0.00% 39 27 0.00% 40 23 0.00% 41 26 0.00% 42 30 0.00% 43 16 0.00% 44 22 0.00% 45 33 0.00% 46 38 0.00% 47 49 0.00% 48 44 0.00% 49 52 0.00% 50 74 0.00% 51 84 0.00% 52 95 0.00% 53 89 0.00% 54 81 0.00% 55 90 0.00% 56 100 0.00% 57 85 0.00% 58 139 0.00% 59 126 0.00% 60 172 0.00% 61 179 0.00% 62 242 0.00% 63 256 0.00% 64 273 0.00% 65 249 0.00% 66 276 0.00% 67 304 0.00% 68 363 0.00% 69 367 0.00% 70 401 0.00% 71 515 0.00% 72 563 0.00% 73 685 0.00% 74 772 0.00% 75 842 0.00% 76 901 0.00% 77 965 0.00% 78 1056 0.00% 79 1199 0.01% 80 1392 0.01% 81 1565 0.01% 82 1728 0.01% 83 1971 0.01% 84 2336 0.01% 85 2440 0.01% 86 2741 0.01% 87 2914 0.01% 88 3346 0.01% 89 3597 0.02% 90 3889 0.02% 91 4326 0.02% 92 4857 0.02% 93 5355 0.02% 94 5775 0.02% 95 6260 0.03% 96 6724 0.03% 97 7408 0.03% 98 7721 0.03% 99 8299 0.03% 100 8789 0.04% 101 9647 0.04% 102 10710 0.05% 103 11106 0.05% 104 12003 0.05% 105 12790 0.05% 106 13734 0.06% 107 14262 0.06% 108 15041 0.06% 109 15750 0.07% 110 16366 0.07% 111 17330 0.07% 112 18359 0.08% 113 18940 0.08% 114 20135 0.08% 115 21468 0.09% 116 21979 0.09% 117 23132 0.10% 118 23819 0.10% 119 24846 0.10% 120 25560 0.11% 121 26663 0.11% 122 27328 0.12% 123 28634 0.12% 124 30263 0.13% 125 31401 0.13% 126 32008 0.13% 127 33150 0.14% 128 33682 0.14% 129 34631 0.15% 130 35689 0.15% 131 36667 0.15% 132 38344 0.16% 133 39969 0.17% 134 40776 0.17% 135 41826 0.18% 136 43005 0.18% 137 43604 0.18% 138 44668 0.19% 139 45467 0.19% 140 46229 0.19% 141 47037 0.20% 142 48564 0.20% 143 49596 0.21% 144 52192 0.22% 145 52305 0.22% 146 53829 0.23% 147 53988 0.23% 148 55336 0.23% 149 55461 0.23% 150 55680 0.23% 151 22007116 92.79% 23717580 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=34 prefix-density=0.41 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=102.92 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.1 sequence=TCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGATATAGCTAGGGACACATCAAGTTCTGGGACGACTTAGACACCTTTCGGCTTGGCGGCAATAAAGCTGATGCACTGCACTTGACG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=4.33 fanout-score-rank=23 prefix-density=0.76 prefix-fanout=2.0 sequence=ATGGCTTCCTCCTCTATGATCTCATCGGCAGCCGTTGCCACCGTCAACCGCACCCCGGCACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGCTAATGACATTACTTCCATTGCAAGCAATGGTGGACGAGTTCAATGCATGCAGGTGTGGCCACCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACAGAGGAGGAATTGGCCAAGGAAATTGATTACCTTCTTCGCTCGAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGTGAGCACCACAGCTCACCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAGCTACCCATGTTTGGATGCACTGAGGCATCTCAAGTGTTGCTTGAGCTTGAGGAGGCAAAGAAAGCTTACCCTAACGCCTTTATCCGTATAATCGGATTCGACAACACGCGTCAAGTGCAGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=21 fanout-score=39.15 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=13.1 sequence=AAAGAAAAGAAAA SRR12671654 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:36:58 Started mapping on | Feb 12 00:36:58 Finished on | Feb 12 00:39:07 Mapping speed, Million of reads per hour | 661.89 Number of input reads | 23717580 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 21441438 Uniquely mapped reads % | 90.40% Average mapped length | 294.49 Number of splices: Total | 21924629 Number of splices: Annotated (sjdb) | 21455374 Number of splices: GT/AG | 21495117 Number of splices: GC/AG | 353289 Number of splices: AT/AC | 12494 Number of splices: Non-canonical | 63729 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 526551 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 67581 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.02% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1749591 1749591 1749591 N_multimapping 526551 526551 526551 N_noFeature 789390 21134119 880492 N_ambiguous 393659 2015 176312 UnstrandedReadsAssigned:20258389 PositiveStrandReadsAssigned:305304 NegativeStrandReadsAssigned:20384634 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671654 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671654-trimmed-pair1.fastq SRR12671654-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,717,580 reads, 21,284,331 reads pseudoaligned [quant] estimated average fragment length: 281.296 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR12671654.ke.tsv 34699 SRR12671654.se.tsv 87100 total ==> SRR12671654.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.7 1073 27.9819 Potri.005G024800.1.v4.1 1035 754.704 419 25.1589 Potri.004G059700.1.v4.1 961 681.204 0 0 Potri.007G009000.2.v4.1 1416 1135.7 0 0 Potri.003G141000.2.v4.1 2943 2662.7 1149.14 19.5571 Potri.016G087400.1.v4.1 270 81.2751 1349 752.157 Potri.015G069301.1.v4.1 564 306.16 0 0 Potri.010G195200.1.v4.1 1773 1492.7 85 2.58047 Potri.012G127500.1.v4.1 977 696.949 147 9.55807 ==> SRR12671654.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 338 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 266 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 35 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 25 SRR12671654 completed mapping pipeline successfully