Starting /dee2/code/volunteer_pipeline.sh SRR12671655 current disk space = 3051540054016 free memory = 1406828732 SRR12671655 SRAfilesize 1fe0aa0c1e69dd46fcba556d5349bcae SRR12671655.sra SRR12671655.sra file validated SRR12671655 is paired end SRR12671655 is conventional basespace SRR12671655 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671655_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4065 37.0 37.0 37.0 37.0 37.0 2 36.17475 37.0 37.0 37.0 37.0 37.0 3 36.412 37.0 37.0 37.0 37.0 37.0 4 36.45 37.0 37.0 37.0 37.0 37.0 5 36.485 37.0 37.0 37.0 37.0 37.0 6 36.557 37.0 37.0 37.0 37.0 37.0 7 36.4475 37.0 37.0 37.0 37.0 37.0 8 36.582 37.0 37.0 37.0 37.0 37.0 9 36.5775 37.0 37.0 37.0 37.0 37.0 10-14 36.523900000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5278 37.0 37.0 37.0 37.0 37.0 20-24 36.506299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4407 37.0 37.0 37.0 37.0 37.0 30-34 36.4434 37.0 37.0 37.0 37.0 37.0 35-39 36.4026 37.0 37.0 37.0 37.0 37.0 40-44 36.3899 37.0 37.0 37.0 37.0 37.0 45-49 36.3787 37.0 37.0 37.0 37.0 37.0 50-54 36.3743 37.0 37.0 37.0 37.0 37.0 55-59 36.341699999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.349999999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.303999999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2722 37.0 37.0 37.0 37.0 37.0 75-79 36.3365 37.0 37.0 37.0 37.0 37.0 80-84 36.223299999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2402 37.0 37.0 37.0 37.0 37.0 90-94 36.2442 37.0 37.0 37.0 37.0 37.0 95-99 36.149499999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.201299999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1261 37.0 37.0 37.0 37.0 37.0 110-114 36.1234 37.0 37.0 37.0 37.0 37.0 115-119 36.1221 37.0 37.0 37.0 37.0 37.0 120-124 36.043699999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.0702 37.0 37.0 37.0 37.0 37.0 130-134 35.9572 37.0 37.0 37.0 37.0 37.0 135-139 35.942400000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.855000000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.813599999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.43 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 0.0 24 0.0 25 1.0 26 5.0 27 4.0 28 17.0 29 33.0 30 27.0 31 35.0 32 45.0 33 57.0 34 134.0 35 311.0 36 2922.0 37 406.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.65 13.65 14.000000000000002 42.699999999999996 2 20.370834377349034 19.04284640440992 39.13806063643197 21.44825858180907 3 18.425 25.35 26.900000000000002 29.325000000000003 4 22.075 32.15 22.825 22.95 5 23.325000000000003 34.75 22.1 19.825 6 17.675 37.724999999999994 24.5 20.1 7 13.575000000000001 21.9 45.225 19.3 8 18.65 22.075 29.175 30.099999999999998 9 17.45 23.325000000000003 31.7 27.525 10-14 19.580000000000002 29.080000000000002 26.91 24.43 15-19 19.615 27.92 27.93 24.535 20-24 19.24 27.944999999999997 28.525 24.29 25-29 19.705000000000002 28.044999999999998 27.775 24.474999999999998 30-34 19.255 28.49 28.24 24.015 35-39 20.369999999999997 27.985 27.310000000000002 24.335 40-44 19.75 28.225 27.62 24.404999999999998 45-49 20.035 28.22 27.07 24.675 50-54 20.205000000000002 27.400000000000002 28.225 24.169999999999998 55-59 19.97 28.415000000000003 27.705000000000002 23.91 60-64 20.724999999999998 27.735 28.060000000000002 23.48 65-69 20.345 27.57 27.375 24.709999999999997 70-74 20.65 28.395 27.175 23.78 75-79 20.415 28.015 27.48 24.09 80-84 20.62 28.804999999999996 27.07 23.505000000000003 85-89 20.45 28.01 27.755000000000003 23.785 90-94 20.48 27.779999999999998 27.675 24.065 95-99 20.19 28.415000000000003 27.279999999999998 24.115000000000002 100-104 20.025000000000002 28.139999999999997 27.365000000000002 24.47 105-109 19.755 28.535 27.639999999999997 24.07 110-114 20.76 27.875 27.589999999999996 23.775 115-119 20.655 27.82 27.82 23.705000000000002 120-124 20.54 27.905 27.27 24.285 125-129 20.419999999999998 28.07 27.46 24.05 130-134 20.41 28.050000000000004 27.52 24.02 135-139 20.985 27.62 27.22 24.175 140-144 21.240000000000002 28.37 26.735 23.655 145-149 20.965 27.92 27.22 23.895 150-151 21.1875 28.237499999999997 26.775 23.799999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 1.5 24 1.5 25 2.5 26 5.0 27 9.0 28 11.0 29 9.5 30 17.5 31 25.5 32 28.0 33 38.0 34 50.5 35 70.0 36 86.5 37 101.5 38 127.5 39 153.5 40 177.0 41 203.5 42 229.0 43 251.0 44 262.5 45 269.5 46 259.0 47 248.5 48 250.5 49 227.5 50 192.5 51 159.5 52 123.0 53 94.0 54 68.0 55 46.5 56 44.5 57 39.0 58 30.0 59 23.0 60 18.0 61 15.0 62 8.0 63 5.5 64 6.0 65 2.5 66 2.0 67 1.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.875 #Duplication Level Percentage of deduplicated Percentage of total 1 94.14114513981359 88.375 2 5.326231691078561 10.0 3 0.42609853528628494 1.2 4 0.07989347536617843 0.3 5 0.02663115845539281 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.0750000000000002 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.175 0.0 0.0 0.0 0.0 118-119 1.2625000000000002 0.0 0.0 0.0 0.0 120-121 1.3875000000000002 0.0 0.0 0.0 0.0 122-123 1.6125 0.0 0.0 0.0 0.0 124-125 1.7000000000000002 0.0 0.0 0.0 0.0 126-127 1.8125 0.0 0.0 0.0 0.0 128-129 2.075 0.0 0.0 0.0 0.0 130-131 2.3375 0.0 0.0 0.0 0.0 132-133 2.5250000000000004 0.0 0.0 0.0 0.0 134-135 2.7375 0.0 0.0 0.0 0.0 136-137 3.0875 0.0 0.0 0.0 0.0 138-139 3.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671655 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671655_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2195 37.0 37.0 37.0 37.0 37.0 2 36.1385 37.0 37.0 37.0 37.0 37.0 3 36.164 37.0 37.0 37.0 37.0 37.0 4 36.135 37.0 37.0 37.0 37.0 37.0 5 36.299 37.0 37.0 37.0 37.0 37.0 6 36.191 37.0 37.0 37.0 37.0 37.0 7 36.243 37.0 37.0 37.0 37.0 37.0 8 36.1655 37.0 37.0 37.0 37.0 37.0 9 36.2695 37.0 37.0 37.0 37.0 37.0 10-14 36.2822 37.0 37.0 37.0 37.0 37.0 15-19 36.264300000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.244800000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.212 37.0 37.0 37.0 37.0 37.0 30-34 36.1815 37.0 37.0 37.0 37.0 37.0 35-39 36.14790000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.159800000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.0724 37.0 37.0 37.0 37.0 37.0 50-54 36.1094 37.0 37.0 37.0 37.0 37.0 55-59 36.0872 37.0 37.0 37.0 37.0 37.0 60-64 35.987300000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.962199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.007 37.0 37.0 37.0 37.0 37.0 75-79 35.9113 37.0 37.0 37.0 37.0 37.0 80-84 35.90260000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.902 37.0 37.0 37.0 37.0 37.0 90-94 35.846199999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.940099999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.8064 37.0 37.0 37.0 37.0 37.0 105-109 35.827999999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.6904 37.0 37.0 37.0 37.0 37.0 115-119 35.730599999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.6773 37.0 37.0 37.0 37.0 37.0 125-129 35.60510000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.5517 37.0 37.0 37.0 37.0 37.0 135-139 35.5306 37.0 37.0 37.0 37.0 37.0 140-144 35.309799999999996 37.0 37.0 37.0 32.2 37.0 145-149 35.33540000000001 37.0 37.0 37.0 34.6 37.0 150-151 35.023 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 0.0 18 1.0 19 0.0 20 1.0 21 0.0 22 1.0 23 6.0 24 5.0 25 8.0 26 6.0 27 12.0 28 23.0 29 31.0 30 38.0 31 32.0 32 69.0 33 121.0 34 185.0 35 535.0 36 2688.0 37 236.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.925 16.8 17.424999999999997 31.85 2 26.950000000000003 22.650000000000002 34.575 15.825 3 21.475 26.974999999999998 29.799999999999997 21.75 4 22.525000000000002 36.449999999999996 22.425 18.6 5 23.474999999999998 37.325 22.2 17.0 6 18.675 37.4 23.575 20.349999999999998 7 18.35 17.549999999999997 42.699999999999996 21.4 8 20.875 23.525 27.875 27.725 9 21.775 23.825 30.275000000000002 24.125 10-14 22.400000000000002 28.37 26.979999999999997 22.25 15-19 22.11 27.794999999999998 28.375 21.72 20-24 22.845 28.02 27.810000000000002 21.325 25-29 22.685 27.884999999999998 27.77 21.66 30-34 22.23 27.715 28.055000000000003 22.0 35-39 22.17 28.335 27.834999999999997 21.66 40-44 22.555 27.810000000000002 27.965 21.67 45-49 22.830000000000002 27.534999999999997 27.46 22.175 50-54 23.044999999999998 28.075 27.51 21.37 55-59 22.99 27.450000000000003 27.82 21.740000000000002 60-64 22.89 28.189999999999998 27.694999999999997 21.224999999999998 65-69 22.515 27.395000000000003 27.584999999999997 22.505 70-74 23.62 27.13 27.805000000000003 21.445 75-79 23.35 27.650000000000002 27.250000000000004 21.75 80-84 23.305 28.22 26.935 21.54 85-89 23.330000000000002 27.975 27.13 21.565 90-94 22.965 27.615000000000002 27.450000000000003 21.97 95-99 23.68 27.125 28.194999999999997 21.0 100-104 23.61 27.615000000000002 27.12 21.654999999999998 105-109 23.405 27.865000000000002 27.584999999999997 21.145 110-114 23.595 28.09 27.534999999999997 20.78 115-119 23.64 28.499999999999996 27.365000000000002 20.495 120-124 23.745 27.055 28.315 20.885 125-129 24.22 27.295 27.439999999999998 21.044999999999998 130-134 24.224999999999998 27.650000000000002 27.155 20.97 135-139 24.445 27.415 27.595 20.544999999999998 140-144 24.77 27.189999999999998 26.97 21.07 145-149 24.245 27.74 27.565 20.45 150-151 24.925 27.400000000000002 27.6375 20.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 2.5 25 2.5 26 2.5 27 2.5 28 3.0 29 8.5 30 16.0 31 26.0 32 27.5 33 26.5 34 37.0 35 55.0 36 72.5 37 100.0 38 129.5 39 158.5 40 196.0 41 236.5 42 249.5 43 254.5 44 255.5 45 258.5 46 265.5 47 249.0 48 235.0 49 213.0 50 186.0 51 149.0 52 122.0 53 116.0 54 82.5 55 51.0 56 47.0 57 35.5 58 34.5 59 31.5 60 16.0 61 8.5 62 8.0 63 5.5 64 4.0 65 3.5 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.28950863213812 88.75 2 5.232403718459495 9.85 3 0.4249667994687915 1.2 4 0.05312084993359894 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8374999999999999 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.625 0.0 0.0 0.0 0.0 124-125 1.7000000000000002 0.0 0.0 0.0 0.0 126-127 1.8125 0.0 0.0 0.0 0.0 128-129 2.075 0.0 0.0 0.0 0.0 130-131 2.3125 0.0 0.0 0.0 0.0 132-133 2.5 0.0 0.0 0.0 0.0 134-135 2.7125 0.0 0.0 0.0 0.0 136-137 3.0999999999999996 0.0 0.0 0.0 0.0 138-139 3.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAGAT 10 0.006830828 145.0 1 TGGAAAG 10 0.006830828 145.0 1 >>END_MODULE Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014236 spots for SRR12671655.sra Written 1014236 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra Read 1014233 spots for SRR12671655.sra Written 1014233 spots for SRR12671655.sra SRR ids: ['SRR12671655.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v6l5f0zy SRR12671655.sra spots: 20284663 blocks: [[1, 1014233], [1014234, 2028466], [2028467, 3042699], [3042700, 4056932], [4056933, 5071165], [5071166, 6085398], [6085399, 7099631], [7099632, 8113864], [8113865, 9128097], [9128098, 10142330], [10142331, 11156563], [11156564, 12170796], [12170797, 13185029], [13185030, 14199262], [14199263, 15213495], [15213496, 16227728], [16227729, 17241961], [17241962, 18256194], [18256195, 19270427], [19270428, 20284663]] SRR12671655 file size 6871915 SRR12671655 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671655 SRR12671655_1.fastq SRR12671655_2.fastq Input file: SRR12671655_1.fastq Paired file: SRR12671655_2.fastq trimmed: SRR12671655-trimmed-pair1.fastq, SRR12671655-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:23:34 2025 >> started Wed Feb 12 00:23:59 2025 >> done (25.254s) 20284663 read pairs processed; of these: 12 ( 0.00%) short read pairs filtered out after trimming by size control 4399 ( 0.02%) empty read pairs filtered out after trimming by size control 20280252 (99.98%) read pairs available; of these: 1031027 ( 5.08%) trimmed read pairs available after processing 19249225 (94.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 2 0.00% 22 2 0.00% 23 1 0.00% 24 7 0.00% 25 2 0.00% 26 4 0.00% 27 5 0.00% 28 7 0.00% 29 7 0.00% 30 11 0.00% 31 6 0.00% 32 7 0.00% 33 12 0.00% 34 14 0.00% 35 14 0.00% 36 12 0.00% 37 16 0.00% 38 20 0.00% 39 13 0.00% 40 19 0.00% 41 25 0.00% 42 19 0.00% 43 20 0.00% 44 27 0.00% 45 33 0.00% 46 38 0.00% 47 43 0.00% 48 37 0.00% 49 47 0.00% 50 65 0.00% 51 50 0.00% 52 51 0.00% 53 53 0.00% 54 55 0.00% 55 58 0.00% 56 101 0.00% 57 85 0.00% 58 82 0.00% 59 95 0.00% 60 119 0.00% 61 128 0.00% 62 157 0.00% 63 143 0.00% 64 173 0.00% 65 190 0.00% 66 177 0.00% 67 195 0.00% 68 224 0.00% 69 282 0.00% 70 279 0.00% 71 377 0.00% 72 434 0.00% 73 452 0.00% 74 483 0.00% 75 559 0.00% 76 585 0.00% 77 668 0.00% 78 714 0.00% 79 844 0.00% 80 908 0.00% 81 1059 0.01% 82 1174 0.01% 83 1318 0.01% 84 1482 0.01% 85 1651 0.01% 86 1725 0.01% 87 1831 0.01% 88 2059 0.01% 89 2292 0.01% 90 2414 0.01% 91 2754 0.01% 92 3017 0.01% 93 3286 0.02% 94 3744 0.02% 95 4007 0.02% 96 4107 0.02% 97 4317 0.02% 98 4757 0.02% 99 4968 0.02% 100 5339 0.03% 101 5731 0.03% 102 5851 0.03% 103 6612 0.03% 104 7047 0.03% 105 7464 0.04% 106 7932 0.04% 107 8194 0.04% 108 8666 0.04% 109 8978 0.04% 110 9554 0.05% 111 10134 0.05% 112 10534 0.05% 113 10948 0.05% 114 11424 0.06% 115 12117 0.06% 116 12440 0.06% 117 13423 0.07% 118 13708 0.07% 119 14364 0.07% 120 14597 0.07% 121 15387 0.08% 122 15844 0.08% 123 16804 0.08% 124 17429 0.09% 125 18060 0.09% 126 18742 0.09% 127 19268 0.10% 128 19684 0.10% 129 20288 0.10% 130 21170 0.10% 131 21595 0.11% 132 22640 0.11% 133 23818 0.12% 134 24487 0.12% 135 24749 0.12% 136 25665 0.13% 137 26328 0.13% 138 26934 0.13% 139 27728 0.14% 140 28164 0.14% 141 28762 0.14% 142 29802 0.15% 143 30774 0.15% 144 32238 0.16% 145 33096 0.16% 146 34293 0.17% 147 34130 0.17% 148 35248 0.17% 149 35682 0.18% 150 35943 0.18% 151 19249225 94.92% 20280252 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=30 prefix-density=0.58 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCAT criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=23.96 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=7.6 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=27 prefix-density=0.98 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=42.55 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.9 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGT SRR12671655 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:24:59 Started mapping on | Feb 12 00:24:59 Finished on | Feb 12 00:27:20 Mapping speed, Million of reads per hour | 517.79 Number of input reads | 20280252 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19064935 Uniquely mapped reads % | 94.01% Average mapped length | 298.69 Number of splices: Total | 19313360 Number of splices: Annotated (sjdb) | 18949383 Number of splices: GT/AG | 18932942 Number of splices: GC/AG | 318626 Number of splices: AT/AC | 11529 Number of splices: Non-canonical | 50263 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 473052 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 177860 % of reads mapped to too many loci | 0.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 742265 742265 742265 N_multimapping 473052 473052 473052 N_noFeature 668677 18777642 757207 N_ambiguous 328640 1180 129140 UnstrandedReadsAssigned:18067618 PositiveStrandReadsAssigned:286113 NegativeStrandReadsAssigned:18178588 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671655 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671655-trimmed-pair1.fastq SRR12671655-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,280,252 reads, 18,216,084 reads pseudoaligned [quant] estimated average fragment length: 299.217 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR12671655.ke.tsv 34699 SRR12671655.se.tsv 87100 total ==> SRR12671655.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1719.78 657 19.4377 Potri.005G024800.1.v4.1 1035 736.783 199 13.7425 Potri.004G059700.1.v4.1 961 663.207 11 0.843911 Potri.007G009000.2.v4.1 1416 1117.78 0 0 Potri.003G141000.2.v4.1 2943 2644.78 1306 25.125 Potri.016G087400.1.v4.1 270 72.8867 690 481.675 Potri.015G069301.1.v4.1 564 291.374 0 0 Potri.010G195200.1.v4.1 1773 1474.78 69 2.38053 Potri.012G127500.1.v4.1 977 679.028 183 13.7125 ==> SRR12671655.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 433 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 230 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR12671655 completed mapping pipeline successfully