Starting /dee2/code/volunteer_pipeline.sh SRR12671656 current disk space = 3051398828032 free memory = 1536841132 SRR12671656 SRAfilesize e42fa16f92baf7d28a5bbfec476a1e2c SRR12671656.sra SRR12671656.sra file validated SRR12671656 is paired end SRR12671656 is conventional basespace SRR12671656 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671656_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4325 37.0 37.0 37.0 37.0 37.0 2 36.22325 37.0 37.0 37.0 37.0 37.0 3 36.4045 37.0 37.0 37.0 37.0 37.0 4 36.5035 37.0 37.0 37.0 37.0 37.0 5 36.55 37.0 37.0 37.0 37.0 37.0 6 36.5135 37.0 37.0 37.0 37.0 37.0 7 36.411 37.0 37.0 37.0 37.0 37.0 8 36.5125 37.0 37.0 37.0 37.0 37.0 9 36.5795 37.0 37.0 37.0 37.0 37.0 10-14 36.5372 37.0 37.0 37.0 37.0 37.0 15-19 36.527499999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.537400000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.483000000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4896 37.0 37.0 37.0 37.0 37.0 35-39 36.4437 37.0 37.0 37.0 37.0 37.0 40-44 36.46040000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.4221 37.0 37.0 37.0 37.0 37.0 50-54 36.4219 37.0 37.0 37.0 37.0 37.0 55-59 36.408300000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.4223 37.0 37.0 37.0 37.0 37.0 65-69 36.3857 37.0 37.0 37.0 37.0 37.0 70-74 36.347699999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.286699999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.279999999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.2295 37.0 37.0 37.0 37.0 37.0 90-94 36.1945 37.0 37.0 37.0 37.0 37.0 95-99 36.1894 37.0 37.0 37.0 37.0 37.0 100-104 36.2379 37.0 37.0 37.0 37.0 37.0 105-109 36.201800000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.15839999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.1711 37.0 37.0 37.0 37.0 37.0 120-124 36.0988 37.0 37.0 37.0 37.0 37.0 125-129 36.0655 37.0 37.0 37.0 37.0 37.0 130-134 35.982299999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.966 37.0 37.0 37.0 37.0 37.0 140-144 35.873000000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.8737 37.0 37.0 37.0 37.0 37.0 150-151 35.3405 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 4.0 26 2.0 27 6.0 28 9.0 29 15.0 30 25.0 31 32.0 32 56.0 33 62.0 34 107.0 35 337.0 36 2968.0 37 374.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.85 13.575000000000001 12.4 43.175000000000004 2 19.563581640331076 20.993227990970656 39.10208176573865 20.34110860295962 3 17.675 26.25 27.825 28.249999999999996 4 20.724999999999998 33.575 22.35 23.35 5 20.575 38.875 23.175 17.375 6 18.2 35.5 25.5 20.8 7 13.075000000000001 22.0 44.95 19.975 8 17.8 21.825 31.874999999999996 28.499999999999996 9 18.4 21.375 32.175 28.050000000000004 10-14 19.325 29.165000000000003 27.3 24.21 15-19 19.395 28.735 28.189999999999998 23.68 20-24 19.23 28.64 27.689999999999998 24.44 25-29 19.74 28.07 28.075 24.115000000000002 30-34 18.94 28.799999999999997 28.255000000000003 24.005000000000003 35-39 19.79 28.49 27.894999999999996 23.825 40-44 19.875 28.560000000000002 27.889999999999997 23.674999999999997 45-49 19.74 28.499999999999996 27.465 24.295 50-54 19.865 29.065 27.47 23.599999999999998 55-59 20.315 28.54 27.665 23.48 60-64 20.355 28.910000000000004 26.905 23.830000000000002 65-69 20.244999999999997 28.715000000000003 27.584999999999997 23.455000000000002 70-74 20.16 28.48 27.935 23.425 75-79 20.06 28.075 27.860000000000003 24.005000000000003 80-84 20.445 28.18 27.589999999999996 23.785 85-89 20.485 27.97 28.07 23.474999999999998 90-94 20.615 28.665000000000003 27.26 23.46 95-99 20.325 28.535 27.37 23.77 100-104 20.235 28.449999999999996 27.375 23.94 105-109 20.265 28.384999999999998 27.655 23.695 110-114 20.645 27.794999999999998 28.125 23.435 115-119 20.305 28.925 27.425 23.345 120-124 20.49 28.560000000000002 27.445000000000004 23.505000000000003 125-129 21.215 27.775 27.345000000000002 23.665 130-134 21.195 28.52 26.915 23.369999999999997 135-139 20.990000000000002 27.915 27.215 23.880000000000003 140-144 21.18 27.435 27.505000000000003 23.880000000000003 145-149 20.560000000000002 28.285 27.71 23.445 150-151 21.425 27.950000000000003 27.250000000000004 23.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.5 22 1.0 23 2.5 24 2.5 25 2.5 26 5.5 27 8.5 28 13.5 29 20.0 30 24.5 31 28.5 32 35.5 33 48.0 34 60.0 35 72.0 36 90.5 37 114.5 38 142.0 39 161.5 40 176.0 41 210.5 42 251.0 43 265.0 44 261.0 45 266.0 46 262.0 47 240.0 48 232.0 49 203.0 50 169.0 51 141.0 52 113.0 53 90.0 54 73.0 55 56.0 56 35.0 57 31.5 58 26.5 59 22.5 60 16.0 61 8.5 62 5.5 63 3.5 64 1.5 65 0.5 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.6239406779661 89.325 2 4.978813559322034 9.4 3 0.31779661016949157 0.8999999999999999 4 0.05296610169491525 0.2 5 0.0 0.0 6 0.0 0.0 7 0.026483050847457626 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.2000000000000002 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.6375 0.0 0.0 0.0 0.0 118-119 1.825 0.0 0.0 0.0 0.0 120-121 2.0125 0.0 0.0 0.0 0.0 122-123 2.1500000000000004 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.5999999999999996 0.0 0.0 0.0 0.0 128-129 2.8 0.0 0.0 0.0 0.0 130-131 2.9625000000000004 0.0 0.0 0.0 0.0 132-133 3.275 0.0 0.0 0.0 0.0 134-135 3.5999999999999996 0.0 0.0 0.0 0.0 136-137 3.8125 0.0 0.0 0.0 0.0 138-139 4.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCCTT 10 0.006830828 145.0 1 CACGAGA 10 0.006830828 145.0 9 TCACCAC 10 0.006830828 145.0 8 CAAAAGT 10 0.006830828 145.0 3 >>END_MODULE SRR12671656 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671656_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2845 37.0 37.0 37.0 37.0 37.0 2 36.051 37.0 37.0 37.0 37.0 37.0 3 36.2955 37.0 37.0 37.0 37.0 37.0 4 36.273 37.0 37.0 37.0 37.0 37.0 5 36.293 37.0 37.0 37.0 37.0 37.0 6 36.227 37.0 37.0 37.0 37.0 37.0 7 36.234 37.0 37.0 37.0 37.0 37.0 8 36.279 37.0 37.0 37.0 37.0 37.0 9 36.4395 37.0 37.0 37.0 37.0 37.0 10-14 36.3683 37.0 37.0 37.0 37.0 37.0 15-19 36.26089999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.256 37.0 37.0 37.0 37.0 37.0 25-29 36.199299999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.2125 37.0 37.0 37.0 37.0 37.0 35-39 36.1737 37.0 37.0 37.0 37.0 37.0 40-44 36.1796 37.0 37.0 37.0 37.0 37.0 45-49 36.1416 37.0 37.0 37.0 37.0 37.0 50-54 36.1488 37.0 37.0 37.0 37.0 37.0 55-59 36.0569 37.0 37.0 37.0 37.0 37.0 60-64 36.0497 37.0 37.0 37.0 37.0 37.0 65-69 35.967099999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.980399999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.9812 37.0 37.0 37.0 37.0 37.0 80-84 35.9475 37.0 37.0 37.0 37.0 37.0 85-89 35.8934 37.0 37.0 37.0 37.0 37.0 90-94 35.8832 37.0 37.0 37.0 37.0 37.0 95-99 35.883399999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.8356 37.0 37.0 37.0 37.0 37.0 105-109 35.8184 37.0 37.0 37.0 37.0 37.0 110-114 35.7671 37.0 37.0 37.0 37.0 37.0 115-119 35.7853 37.0 37.0 37.0 37.0 37.0 120-124 35.71509999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.6222 37.0 37.0 37.0 37.0 37.0 130-134 35.618900000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.636199999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.3417 37.0 37.0 37.0 34.6 37.0 145-149 35.4235 37.0 37.0 37.0 37.0 37.0 150-151 35.06575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 1.0 16 3.0 17 0.0 18 2.0 19 1.0 20 3.0 21 1.0 22 4.0 23 2.0 24 4.0 25 3.0 26 9.0 27 14.0 28 11.0 29 15.0 30 21.0 31 52.0 32 57.0 33 98.0 34 207.0 35 529.0 36 2724.0 37 236.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.55 16.3 16.400000000000002 31.75 2 24.8 24.525 35.8 14.875 3 21.725 26.875 31.7 19.7 4 22.1 35.275 24.275 18.35 5 23.875 38.3 20.925 16.900000000000002 6 18.675 37.95 22.85 20.525 7 17.7 17.974999999999998 43.15 21.175 8 20.325 23.150000000000002 28.575 27.950000000000003 9 22.125 23.65 29.225 25.0 10-14 22.470000000000002 28.925 26.865 21.740000000000002 15-19 22.805 27.785 28.17 21.240000000000002 20-24 22.325 28.575 28.299999999999997 20.8 25-29 22.645 27.955000000000002 28.33 21.07 30-34 22.185 28.110000000000003 28.349999999999998 21.355 35-39 22.745 27.785 28.060000000000002 21.41 40-44 22.685 28.050000000000004 27.58 21.685 45-49 22.919999999999998 27.860000000000003 28.185 21.035 50-54 23.27 27.815 27.779999999999998 21.135 55-59 22.735 27.529999999999998 28.384999999999998 21.349999999999998 60-64 22.900000000000002 27.785 27.82 21.495 65-69 22.795 27.755000000000003 28.15 21.3 70-74 22.895 27.650000000000002 28.275 21.18 75-79 23.455000000000002 27.555000000000003 27.68 21.310000000000002 80-84 23.405 28.17 27.13 21.295 85-89 23.055 28.305000000000003 27.74 20.9 90-94 23.155 27.46 28.005000000000003 21.38 95-99 23.494999999999997 27.54 27.785 21.18 100-104 24.099999999999998 27.66 27.6 20.64 105-109 22.915 27.205000000000002 28.165000000000003 21.715 110-114 23.935000000000002 27.889999999999997 27.485 20.69 115-119 24.275 27.74 27.265 20.72 120-124 23.68 27.694999999999997 28.050000000000004 20.575 125-129 23.075000000000003 28.199999999999996 28.02 20.705000000000002 130-134 24.04 27.705000000000002 27.43 20.825 135-139 24.345 27.689999999999998 27.650000000000002 20.315 140-144 24.83 27.61 27.455000000000002 20.105 145-149 24.990000000000002 27.74 27.565 19.705000000000002 150-151 26.2875 27.0125 26.5625 20.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 1.0 16 1.0 17 1.0 18 1.5 19 1.0 20 0.5 21 0.5 22 0.5 23 1.5 24 2.0 25 3.0 26 3.5 27 5.5 28 9.5 29 10.0 30 12.5 31 19.0 32 27.5 33 37.5 34 47.0 35 66.0 36 94.5 37 119.5 38 144.0 39 169.0 40 187.0 41 200.0 42 240.5 43 276.0 44 281.0 45 278.5 46 262.5 47 232.0 48 210.5 49 198.0 50 181.5 51 153.0 52 117.5 53 84.5 54 66.0 55 59.0 56 46.5 57 38.0 58 26.0 59 23.0 60 19.5 61 15.5 62 10.5 63 2.0 64 0.5 65 1.0 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.3 #Duplication Level Percentage of deduplicated Percentage of total 1 94.3796394485684 89.0 2 5.222693531283139 9.85 3 0.3711558854718982 1.05 4 0.02651113467656416 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 1.825 0.0 0.0 0.0 0.0 120-121 2.0125 0.0 0.0 0.0 0.0 122-123 2.1500000000000004 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.575 0.0 0.0 0.0 0.0 128-129 2.7750000000000004 0.0 0.0 0.0 0.0 130-131 2.925 0.0 0.0 0.0 0.0 132-133 3.225 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.7625 0.0 0.0 0.0 0.0 138-139 4.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCATTAC 10 0.006830828 145.0 8 >>END_MODULE Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001160 spots for SRR12671656.sra Written 1001160 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra Read 1001151 spots for SRR12671656.sra Written 1001151 spots for SRR12671656.sra SRR ids: ['SRR12671656.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yii5rko2 SRR12671656.sra spots: 20023029 blocks: [[1, 1001151], [1001152, 2002302], [2002303, 3003453], [3003454, 4004604], [4004605, 5005755], [5005756, 6006906], [6006907, 7008057], [7008058, 8009208], [8009209, 9010359], [9010360, 10011510], [10011511, 11012661], [11012662, 12013812], [12013813, 13014963], [13014964, 14016114], [14016115, 15017265], [15017266, 16018416], [16018417, 17019567], [17019568, 18020718], [18020719, 19021869], [19021870, 20023029]] SRR12671656 file size 6783000 SRR12671656 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671656 SRR12671656_1.fastq SRR12671656_2.fastq Input file: SRR12671656_1.fastq Paired file: SRR12671656_2.fastq trimmed: SRR12671656-trimmed-pair1.fastq, SRR12671656-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:39:35 2025 >> started Wed Feb 12 00:39:55 2025 >> done (20.413s) 20023029 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 1919 ( 0.01%) empty read pairs filtered out after trimming by size control 20021093 (99.99%) read pairs available; of these: 1408711 ( 7.04%) trimmed read pairs available after processing 18612382 (92.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 4 0.00% 25 4 0.00% 26 4 0.00% 27 7 0.00% 28 6 0.00% 29 11 0.00% 30 7 0.00% 31 7 0.00% 32 20 0.00% 33 13 0.00% 34 17 0.00% 35 24 0.00% 36 12 0.00% 37 22 0.00% 38 10 0.00% 39 27 0.00% 40 19 0.00% 41 21 0.00% 42 38 0.00% 43 29 0.00% 44 48 0.00% 45 37 0.00% 46 45 0.00% 47 49 0.00% 48 65 0.00% 49 74 0.00% 50 77 0.00% 51 92 0.00% 52 98 0.00% 53 91 0.00% 54 98 0.00% 55 104 0.00% 56 141 0.00% 57 134 0.00% 58 136 0.00% 59 200 0.00% 60 193 0.00% 61 218 0.00% 62 267 0.00% 63 279 0.00% 64 282 0.00% 65 316 0.00% 66 360 0.00% 67 404 0.00% 68 438 0.00% 69 527 0.00% 70 535 0.00% 71 626 0.00% 72 755 0.00% 73 837 0.00% 74 897 0.00% 75 1051 0.01% 76 1137 0.01% 77 1216 0.01% 78 1336 0.01% 79 1434 0.01% 80 1572 0.01% 81 1886 0.01% 82 2169 0.01% 83 2368 0.01% 84 2616 0.01% 85 2910 0.01% 86 3135 0.02% 87 3394 0.02% 88 3575 0.02% 89 3988 0.02% 90 4425 0.02% 91 4825 0.02% 92 5125 0.03% 93 5701 0.03% 94 6150 0.03% 95 6642 0.03% 96 7099 0.04% 97 7463 0.04% 98 7895 0.04% 99 8066 0.04% 100 8863 0.04% 101 9350 0.05% 102 9938 0.05% 103 10557 0.05% 104 11399 0.06% 105 12001 0.06% 106 12633 0.06% 107 12832 0.06% 108 13408 0.07% 109 13973 0.07% 110 14459 0.07% 111 15114 0.08% 112 15853 0.08% 113 16385 0.08% 114 17372 0.09% 115 17984 0.09% 116 18584 0.09% 117 19309 0.10% 118 19896 0.10% 119 20341 0.10% 120 21066 0.11% 121 21709 0.11% 122 22521 0.11% 123 23859 0.12% 124 24446 0.12% 125 25339 0.13% 126 25847 0.13% 127 26824 0.13% 128 27200 0.14% 129 27723 0.14% 130 28468 0.14% 131 28993 0.14% 132 30020 0.15% 133 31374 0.16% 134 32359 0.16% 135 32971 0.16% 136 33730 0.17% 137 34160 0.17% 138 34558 0.17% 139 35554 0.18% 140 36000 0.18% 141 36580 0.18% 142 37793 0.19% 143 38697 0.19% 144 40601 0.20% 145 41006 0.20% 146 42084 0.21% 147 42014 0.21% 148 42808 0.21% 149 42709 0.21% 150 43531 0.22% 151 18612382 92.96% 20021093 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=29 prefix-density=0.31 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCAT criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=36.92 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=7.6 sequence=GCTCTCCACGAACTTTCTTGCTCCCTTGAACCATCTCTTGTCTCCAGCTTGTGCCTTGCAAATGTAAAGCTTACCATCTTTCACAGTGGCTGTGATAAGTTGGTGCTTGCCACCTTCATCTCCATCAGCAGTCCTTGTCAGCACTGACAAGAAGTAATATTGTTTCCCATCGATCACCGGAGTTGAGGTCTCCAATATGTTAGCCGTTGCTACGGTATTGGTGTCGAAACCACCCTCAGATGAAGTCGCAAACAAGGA criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=32 prefix-density=0.78 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTG criterion=fanout-score sequence-density=0.14 sequence-density-rank=16 fanout-score=34.41 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=12.4 sequence=AAAGAAAAGAAAA SRR12671656 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:40:39 Started mapping on | Feb 12 00:40:39 Finished on | Feb 12 00:42:43 Mapping speed, Million of reads per hour | 581.26 Number of input reads | 20021093 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18857787 Uniquely mapped reads % | 94.19% Average mapped length | 297.48 Number of splices: Total | 19229954 Number of splices: Annotated (sjdb) | 18777479 Number of splices: GT/AG | 18844527 Number of splices: GC/AG | 306988 Number of splices: AT/AC | 13224 Number of splices: Non-canonical | 65215 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 480163 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 64247 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.99% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 683143 683143 683143 N_multimapping 480163 480163 480163 N_noFeature 717720 18559155 813632 N_ambiguous 333482 1285 129970 UnstrandedReadsAssigned:17806585 PositiveStrandReadsAssigned:297347 NegativeStrandReadsAssigned:17914185 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671656 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671656-trimmed-pair1.fastq SRR12671656-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,021,093 reads, 17,874,387 reads pseudoaligned [quant] estimated average fragment length: 294.037 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR12671656.ke.tsv 34699 SRR12671656.se.tsv 87100 total ==> SRR12671656.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1724.96 921 27.9898 Potri.005G024800.1.v4.1 1035 741.963 192 13.5656 Potri.004G059700.1.v4.1 961 668.471 0 0 Potri.007G009000.2.v4.1 1416 1122.96 0 0 Potri.003G141000.2.v4.1 2943 2649.96 884 17.4877 Potri.016G087400.1.v4.1 270 78.4408 809 540.662 Potri.015G069301.1.v4.1 564 298.483 0 0 Potri.010G195200.1.v4.1 1773 1479.96 142 5.02988 Potri.012G127500.1.v4.1 977 684.22 77 5.8995 ==> SRR12671656.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 79 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12671656 completed mapping pipeline successfully