Starting /dee2/code/volunteer_pipeline.sh SRR12671657 current disk space = 3051232731136 free memory = 1537233344 SRR12671657 SRAfilesize 15091c6fa4cdc88faa9f67cfa5d98db8 SRR12671657.sra SRR12671657.sra file validated SRR12671657 is paired end SRR12671657 is conventional basespace SRR12671657 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671657_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3035 37.0 37.0 37.0 37.0 37.0 2 36.274 37.0 37.0 37.0 37.0 37.0 3 36.517 37.0 37.0 37.0 37.0 37.0 4 36.6175 37.0 37.0 37.0 37.0 37.0 5 36.473 37.0 37.0 37.0 37.0 37.0 6 36.538 37.0 37.0 37.0 37.0 37.0 7 36.4985 37.0 37.0 37.0 37.0 37.0 8 36.551 37.0 37.0 37.0 37.0 37.0 9 36.497 37.0 37.0 37.0 37.0 37.0 10-14 36.54710000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.5205 37.0 37.0 37.0 37.0 37.0 20-24 36.5109 37.0 37.0 37.0 37.0 37.0 25-29 36.51030000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.4559 37.0 37.0 37.0 37.0 37.0 35-39 36.4034 37.0 37.0 37.0 37.0 37.0 40-44 36.4073 37.0 37.0 37.0 37.0 37.0 45-49 36.3719 37.0 37.0 37.0 37.0 37.0 50-54 36.37800000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.32789999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.300799999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.3187 37.0 37.0 37.0 37.0 37.0 70-74 36.25750000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.3184 37.0 37.0 37.0 37.0 37.0 80-84 36.271699999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.304899999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.1974 37.0 37.0 37.0 37.0 37.0 95-99 36.136399999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.1993 37.0 37.0 37.0 37.0 37.0 105-109 36.1212 37.0 37.0 37.0 37.0 37.0 110-114 36.0672 37.0 37.0 37.0 37.0 37.0 115-119 36.0769 37.0 37.0 37.0 37.0 37.0 120-124 36.002300000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.9856 37.0 37.0 37.0 37.0 37.0 130-134 35.9656 37.0 37.0 37.0 37.0 37.0 135-139 35.9043 37.0 37.0 37.0 37.0 37.0 140-144 35.8721 37.0 37.0 37.0 37.0 37.0 145-149 35.8504 37.0 37.0 37.0 37.0 37.0 150-151 35.4345 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 1.0 26 3.0 27 10.0 28 14.0 29 23.0 30 31.0 31 34.0 32 47.0 33 81.0 34 122.0 35 319.0 36 2935.0 37 378.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.275000000000002 12.825000000000001 12.4 45.5 2 19.1921726041144 20.12042147516307 40.466633216256895 20.22077270446563 3 19.3 24.775 26.900000000000002 29.025000000000002 4 23.575 33.0 20.75 22.675 5 20.75 37.95 22.25 19.05 6 16.0 37.275000000000006 24.8 21.925 7 13.05 21.15 46.75 19.05 8 17.45 22.95 32.4 27.200000000000003 9 18.05 21.7 32.15 28.1 10-14 19.305 29.175 27.224999999999998 24.295 15-19 19.78 27.935 27.87 24.415 20-24 19.67 29.080000000000002 27.505000000000003 23.745 25-29 19.54 28.910000000000004 27.639999999999997 23.91 30-34 19.68 28.655 27.884999999999998 23.78 35-39 19.580000000000002 28.744999999999997 27.245 24.43 40-44 19.975 28.65 27.52 23.855 45-49 19.955000000000002 28.845 26.919999999999998 24.279999999999998 50-54 19.885 28.115000000000002 27.73 24.27 55-59 20.4 28.205000000000002 27.655 23.74 60-64 20.435 27.775 27.43 24.36 65-69 19.755 28.62 27.91 23.715 70-74 19.775000000000002 29.085 27.49 23.65 75-79 20.23 28.1 27.284999999999997 24.385 80-84 20.71 28.499999999999996 26.995 23.794999999999998 85-89 20.745 28.665000000000003 27.400000000000002 23.189999999999998 90-94 20.255000000000003 28.744999999999997 27.500000000000004 23.5 95-99 19.865 28.294999999999998 27.85 23.990000000000002 100-104 20.165 28.52 27.41 23.905 105-109 20.200000000000003 28.265 27.67 23.865 110-114 20.985 27.87 27.13 24.015 115-119 20.95 28.515 27.35 23.185 120-124 20.455000000000002 27.725 27.639999999999997 24.18 125-129 20.605 27.435 27.544999999999998 24.415 130-134 20.845 27.755000000000003 27.089999999999996 24.310000000000002 135-139 21.01 28.144999999999996 27.500000000000004 23.345 140-144 21.07 27.500000000000004 27.725 23.705000000000002 145-149 20.979999999999997 28.29 27.33 23.400000000000002 150-151 21.8125 27.725 28.1125 22.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 2.0 24 5.0 25 6.0 26 5.5 27 7.0 28 8.0 29 14.5 30 23.0 31 26.0 32 29.5 33 40.5 34 51.0 35 65.0 36 93.5 37 120.0 38 140.5 39 160.0 40 185.0 41 221.0 42 234.0 43 228.5 44 261.0 45 281.5 46 259.5 47 252.5 48 239.5 49 208.5 50 184.5 51 144.0 52 110.5 53 95.0 54 67.0 55 57.0 56 51.0 57 33.5 58 24.5 59 18.5 60 13.5 61 8.5 62 7.0 63 7.0 64 3.0 65 0.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.55 #Duplication Level Percentage of deduplicated Percentage of total 1 93.58631747728488 87.55 2 5.986103687867451 11.200000000000001 3 0.3741314804917157 1.05 4 0.053447354355959376 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.2000000000000002 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.5125000000000002 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 1.8875 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.125 0.0 0.0 0.0 0.0 130-131 2.3125 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.825 0.0 0.0 0.0 0.0 138-139 3.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGGAT 10 0.006830828 145.0 8 AACTTCC 10 0.006830828 145.0 6 ATTGCTT 10 0.006830828 145.0 8 TTGATGG 10 0.006830828 145.0 145 GAATATT 10 0.006830828 145.0 4 AAAAAAA 20 0.00593511 29.0 20-24 >>END_MODULE SRR12671657 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671657_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2385 37.0 37.0 37.0 37.0 37.0 2 36.0635 37.0 37.0 37.0 37.0 37.0 3 36.128 37.0 37.0 37.0 37.0 37.0 4 36.129 37.0 37.0 37.0 37.0 37.0 5 36.195 37.0 37.0 37.0 37.0 37.0 6 36.256 37.0 37.0 37.0 37.0 37.0 7 36.2465 37.0 37.0 37.0 37.0 37.0 8 36.1825 37.0 37.0 37.0 37.0 37.0 9 36.1915 37.0 37.0 37.0 37.0 37.0 10-14 36.2341 37.0 37.0 37.0 37.0 37.0 15-19 36.21489999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.158 37.0 37.0 37.0 37.0 37.0 25-29 36.0889 37.0 37.0 37.0 37.0 37.0 30-34 36.0624 37.0 37.0 37.0 37.0 37.0 35-39 36.123900000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.075700000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.08579999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.0434 37.0 37.0 37.0 37.0 37.0 55-59 35.9382 37.0 37.0 37.0 37.0 37.0 60-64 35.9202 37.0 37.0 37.0 37.0 37.0 65-69 35.8346 37.0 37.0 37.0 37.0 37.0 70-74 35.9171 37.0 37.0 37.0 37.0 37.0 75-79 35.834900000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.8354 37.0 37.0 37.0 37.0 37.0 85-89 35.820100000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.76199999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.7361 37.0 37.0 37.0 37.0 37.0 100-104 35.755399999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.6223 37.0 37.0 37.0 37.0 37.0 110-114 35.6533 37.0 37.0 37.0 37.0 37.0 115-119 35.6442 37.0 37.0 37.0 37.0 37.0 120-124 35.547 37.0 37.0 37.0 37.0 37.0 125-129 35.452000000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.5006 37.0 37.0 37.0 37.0 37.0 135-139 35.490199999999994 37.0 37.0 37.0 34.6 37.0 140-144 35.2022 37.0 37.0 37.0 29.8 37.0 145-149 35.3008 37.0 37.0 37.0 34.6 37.0 150-151 34.9315 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 1.0 15 0.0 16 1.0 17 1.0 18 1.0 19 2.0 20 3.0 21 2.0 22 5.0 23 2.0 24 8.0 25 8.0 26 11.0 27 14.0 28 20.0 29 27.0 30 28.0 31 45.0 32 62.0 33 101.0 34 192.0 35 556.0 36 2711.0 37 193.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.875 16.525000000000002 15.65 33.95 2 25.624999999999996 22.675 36.199999999999996 15.5 3 19.525000000000002 27.224999999999998 31.525 21.725 4 22.625 33.550000000000004 22.45 21.375 5 23.849999999999998 36.375 22.575 17.2 6 19.325 36.975 23.825 19.875 7 17.849999999999998 16.875 42.775 22.5 8 19.675 22.5 29.325000000000003 28.499999999999996 9 21.525 24.875 29.325000000000003 24.275 10-14 22.435 28.415000000000003 26.715 22.435 15-19 22.025 28.005000000000003 28.110000000000003 21.86 20-24 22.009999999999998 28.21 28.060000000000002 21.72 25-29 22.38 28.095 27.694999999999997 21.83 30-34 22.175 27.650000000000002 28.455000000000002 21.72 35-39 22.99 27.595 27.62 21.795 40-44 22.8 27.76 27.98 21.46 45-49 22.25 28.465 27.689999999999998 21.595 50-54 22.825 27.785 27.584999999999997 21.805 55-59 22.509999999999998 28.144999999999996 27.98 21.365000000000002 60-64 22.5 26.93 28.475 22.095000000000002 65-69 23.125 27.125 27.875 21.875 70-74 23.24 27.365000000000002 27.55 21.845 75-79 22.835 27.29 27.21 22.665 80-84 22.755 28.055000000000003 27.985 21.205 85-89 23.14 27.150000000000002 27.779999999999998 21.93 90-94 23.305 27.435 27.495000000000005 21.765 95-99 23.419999999999998 27.605 27.884999999999998 21.09 100-104 22.96 27.91 27.625 21.505 105-109 23.535 27.37 28.025 21.07 110-114 23.715 27.265 27.96 21.060000000000002 115-119 23.69 28.075 27.644999999999996 20.59 120-124 23.815 27.785 27.375 21.025 125-129 24.0 27.200000000000003 27.875 20.925 130-134 24.18 27.665 27.279999999999998 20.875 135-139 24.495 27.42 27.32 20.765 140-144 24.635 27.284999999999997 27.625 20.455000000000002 145-149 24.21 28.349999999999998 26.85 20.59 150-151 25.5125 26.525 27.8625 20.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.5 20 1.0 21 0.5 22 1.0 23 1.0 24 2.0 25 3.0 26 3.0 27 4.5 28 8.0 29 13.0 30 16.0 31 17.5 32 24.0 33 34.0 34 41.5 35 57.5 36 80.5 37 110.5 38 128.0 39 158.5 40 190.5 41 201.0 42 218.5 43 249.5 44 267.5 45 281.5 46 283.0 47 251.0 48 246.0 49 226.0 50 170.5 51 138.5 52 124.5 53 90.5 54 68.0 55 59.5 56 52.0 57 47.5 58 33.5 59 23.5 60 19.5 61 13.5 62 8.0 63 6.5 64 4.0 65 2.5 66 2.5 67 2.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 93.7016279690419 87.775 2 5.871363757672805 11.0 3 0.4003202562049639 1.125 4 0.02668801708033093 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.2000000000000002 0.0 0.0 0.0 0.0 118-119 1.3250000000000002 0.0 0.0 0.0 0.0 120-121 1.4874999999999998 0.0 0.0 0.0 0.0 122-123 1.7000000000000002 0.0 0.0 0.0 0.0 124-125 1.8625 0.0 0.0 0.0 0.0 126-127 1.9874999999999998 0.0 0.0 0.0 0.0 128-129 2.1125 0.0 0.0 0.0 0.0 130-131 2.3125 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.825 0.0 0.0 0.0 0.0 138-139 3.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATAGA 10 0.006830828 145.0 4 CTTAAAC 10 0.006830828 145.0 1 >>END_MODULE Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890445 spots for SRR12671657.sra Written 890445 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra Read 890437 spots for SRR12671657.sra Written 890437 spots for SRR12671657.sra SRR ids: ['SRR12671657.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_07_uv3g9 SRR12671657.sra spots: 17808748 blocks: [[1, 890437], [890438, 1780874], [1780875, 2671311], [2671312, 3561748], [3561749, 4452185], [4452186, 5342622], [5342623, 6233059], [6233060, 7123496], [7123497, 8013933], [8013934, 8904370], [8904371, 9794807], [9794808, 10685244], [10685245, 11575681], [11575682, 12466118], [12466119, 13356555], [13356556, 14246992], [14246993, 15137429], [15137430, 16027866], [16027867, 16918303], [16918304, 17808748]] SRR12671657 file size 6030491 SRR12671657 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671657 SRR12671657_1.fastq SRR12671657_2.fastq Input file: SRR12671657_1.fastq Paired file: SRR12671657_2.fastq trimmed: SRR12671657-trimmed-pair1.fastq, SRR12671657-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:49:45 2025 >> started Wed Feb 12 00:50:03 2025 >> done (18.336s) 17808748 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 923 ( 0.01%) empty read pairs filtered out after trimming by size control 17807809 (99.99%) read pairs available; of these: 865664 ( 4.86%) trimmed read pairs available after processing 16942145 (95.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 1 0.00% 25 3 0.00% 26 0 0.00% 27 1 0.00% 28 2 0.00% 29 4 0.00% 30 1 0.00% 31 8 0.00% 32 6 0.00% 33 6 0.00% 34 11 0.00% 35 12 0.00% 36 8 0.00% 37 6 0.00% 38 20 0.00% 39 23 0.00% 40 16 0.00% 41 13 0.00% 42 25 0.00% 43 27 0.00% 44 26 0.00% 45 23 0.00% 46 25 0.00% 47 24 0.00% 48 38 0.00% 49 45 0.00% 50 47 0.00% 51 52 0.00% 52 49 0.00% 53 60 0.00% 54 46 0.00% 55 61 0.00% 56 50 0.00% 57 71 0.00% 58 83 0.00% 59 78 0.00% 60 90 0.00% 61 107 0.00% 62 103 0.00% 63 144 0.00% 64 112 0.00% 65 141 0.00% 66 157 0.00% 67 185 0.00% 68 185 0.00% 69 216 0.00% 70 237 0.00% 71 249 0.00% 72 313 0.00% 73 352 0.00% 74 429 0.00% 75 483 0.00% 76 447 0.00% 77 520 0.00% 78 590 0.00% 79 660 0.00% 80 720 0.00% 81 835 0.00% 82 929 0.01% 83 1028 0.01% 84 1117 0.01% 85 1285 0.01% 86 1341 0.01% 87 1508 0.01% 88 1579 0.01% 89 1794 0.01% 90 1937 0.01% 91 2120 0.01% 92 2390 0.01% 93 2697 0.02% 94 2919 0.02% 95 3067 0.02% 96 3338 0.02% 97 3535 0.02% 98 3789 0.02% 99 3811 0.02% 100 4339 0.02% 101 4548 0.03% 102 4872 0.03% 103 5225 0.03% 104 5740 0.03% 105 5920 0.03% 106 6329 0.04% 107 6618 0.04% 108 7074 0.04% 109 7393 0.04% 110 7499 0.04% 111 8076 0.05% 112 8598 0.05% 113 9110 0.05% 114 9605 0.05% 115 10103 0.06% 116 10491 0.06% 117 10833 0.06% 118 11201 0.06% 119 11605 0.07% 120 12010 0.07% 121 13088 0.07% 122 13219 0.07% 123 14054 0.08% 124 14385 0.08% 125 14919 0.08% 126 15698 0.09% 127 16046 0.09% 128 16529 0.09% 129 17224 0.10% 130 17459 0.10% 131 18247 0.10% 132 18620 0.10% 133 19764 0.11% 134 20162 0.11% 135 20923 0.12% 136 21510 0.12% 137 22597 0.13% 138 23080 0.13% 139 24011 0.13% 140 24040 0.13% 141 24986 0.14% 142 25548 0.14% 143 26367 0.15% 144 27903 0.16% 145 28178 0.16% 146 29179 0.16% 147 29690 0.17% 148 30257 0.17% 149 30738 0.17% 150 31618 0.18% 151 16942145 95.14% 17807809 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=24 prefix-density=0.49 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=14.71 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=6.7 sequence=GCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAA criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=26 prefix-density=0.63 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=23.02 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=1.9 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671657 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:50:49 Started mapping on | Feb 12 00:50:50 Finished on | Feb 12 00:52:39 Mapping speed, Million of reads per hour | 588.15 Number of input reads | 17807809 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16717426 Uniquely mapped reads % | 93.88% Average mapped length | 298.78 Number of splices: Total | 16638401 Number of splices: Annotated (sjdb) | 16319866 Number of splices: GT/AG | 16312600 Number of splices: GC/AG | 271887 Number of splices: AT/AC | 9031 Number of splices: Non-canonical | 44883 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 420373 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 115507 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 670010 670010 670010 N_multimapping 420373 420373 420373 N_noFeature 591180 16465457 670774 N_ambiguous 270135 1254 96955 UnstrandedReadsAssigned:15856111 PositiveStrandReadsAssigned:250715 NegativeStrandReadsAssigned:15949697 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671657 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671657-trimmed-pair1.fastq SRR12671657-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,807,809 reads, 15,952,198 reads pseudoaligned [quant] estimated average fragment length: 297.198 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52401 SRR12671657.ke.tsv 34699 SRR12671657.se.tsv 87100 total ==> SRR12671657.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1721.8 556 18.4209 Potri.005G024800.1.v4.1 1035 738.802 279 21.5424 Potri.004G059700.1.v4.1 961 665.27 0 0 Potri.007G009000.2.v4.1 1416 1119.8 0 0 Potri.003G141000.2.v4.1 2943 2646.8 1151 24.8069 Potri.016G087400.1.v4.1 270 71.4854 732.461 584.502 Potri.015G069301.1.v4.1 564 291.959 0 0 Potri.010G195200.1.v4.1 1773 1476.8 88.8302 3.43129 Potri.012G127500.1.v4.1 977 681.018 173 14.4913 ==> SRR12671657.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 362 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 242 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR12671657 completed mapping pipeline successfully