Starting /dee2/code/volunteer_pipeline.sh SRR12671658 current disk space = 3051314864128 free memory = 1469253704 SRR12671658 SRAfilesize 41210d3093554a82cf0d096d3a90eda3 SRR12671658.sra SRR12671658.sra file validated SRR12671658 is paired end SRR12671658 is conventional basespace SRR12671658 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671658_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.439 37.0 37.0 37.0 37.0 37.0 2 36.181 37.0 37.0 37.0 37.0 37.0 3 36.4265 37.0 37.0 37.0 37.0 37.0 4 36.5525 37.0 37.0 37.0 37.0 37.0 5 36.4845 37.0 37.0 37.0 37.0 37.0 6 36.538 37.0 37.0 37.0 37.0 37.0 7 36.4935 37.0 37.0 37.0 37.0 37.0 8 36.5055 37.0 37.0 37.0 37.0 37.0 9 36.409 37.0 37.0 37.0 37.0 37.0 10-14 36.5379 37.0 37.0 37.0 37.0 37.0 15-19 36.5319 37.0 37.0 37.0 37.0 37.0 20-24 36.4581 37.0 37.0 37.0 37.0 37.0 25-29 36.4681 37.0 37.0 37.0 37.0 37.0 30-34 36.44939999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4605 37.0 37.0 37.0 37.0 37.0 40-44 36.445100000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3985 37.0 37.0 37.0 37.0 37.0 50-54 36.3954 37.0 37.0 37.0 37.0 37.0 55-59 36.409099999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.388400000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3313 37.0 37.0 37.0 37.0 37.0 70-74 36.2836 37.0 37.0 37.0 37.0 37.0 75-79 36.233 37.0 37.0 37.0 37.0 37.0 80-84 36.28960000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.25410000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.2736 37.0 37.0 37.0 37.0 37.0 95-99 36.15689999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.2055 37.0 37.0 37.0 37.0 37.0 105-109 36.1446 37.0 37.0 37.0 37.0 37.0 110-114 36.0789 37.0 37.0 37.0 37.0 37.0 115-119 36.1556 37.0 37.0 37.0 37.0 37.0 120-124 36.065 37.0 37.0 37.0 37.0 37.0 125-129 36.0441 37.0 37.0 37.0 37.0 37.0 130-134 35.9488 37.0 37.0 37.0 37.0 37.0 135-139 35.89 37.0 37.0 37.0 37.0 37.0 140-144 35.9095 37.0 37.0 37.0 37.0 37.0 145-149 35.8003 37.0 37.0 37.0 37.0 37.0 150-151 35.286500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 6.0 26 1.0 27 1.0 28 12.0 29 22.0 30 25.0 31 40.0 32 51.0 33 73.0 34 120.0 35 312.0 36 2963.0 37 371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.324999999999996 15.75 8.3 42.625 2 18.386773547094187 21.142284569138276 41.18236472945892 19.288577154308616 3 17.1 26.474999999999998 29.049999999999997 27.375 4 22.075 33.15 22.875 21.9 5 20.200000000000003 36.199999999999996 24.6 19.0 6 17.775 36.05 25.025 21.15 7 15.1 20.775 44.824999999999996 19.3 8 17.075000000000003 22.975 30.175 29.775000000000002 9 16.950000000000003 22.225 33.575 27.250000000000004 10-14 19.77 29.03 26.669999999999998 24.529999999999998 15-19 19.744999999999997 28.43 27.685 24.14 20-24 20.005 28.57 27.54 23.885 25-29 19.98 28.42 27.750000000000004 23.849999999999998 30-34 19.919999999999998 28.705000000000002 27.54 23.835 35-39 19.91 28.98 27.485 23.625 40-44 20.075000000000003 28.975 27.229999999999997 23.72 45-49 19.34 28.749999999999996 27.725 24.185000000000002 50-54 19.735 28.13 28.02 24.115000000000002 55-59 20.43 28.16 27.82 23.59 60-64 19.72 27.935 27.435 24.91 65-69 20.705000000000002 28.165000000000003 27.425 23.705000000000002 70-74 20.47 28.475 27.139999999999997 23.915 75-79 20.495 28.325 27.575 23.605 80-84 20.095 27.839999999999996 27.584999999999997 24.48 85-89 20.119999999999997 28.470000000000002 27.515 23.895 90-94 20.915 27.735 27.495000000000005 23.855 95-99 20.44 28.34 27.775 23.445 100-104 20.200000000000003 28.555000000000003 27.6 23.645 105-109 20.82 28.225 27.575 23.380000000000003 110-114 20.39 28.13 27.725 23.755000000000003 115-119 20.794999999999998 28.815 27.075 23.315 120-124 20.79 28.18 27.455000000000002 23.575 125-129 21.33 27.48 27.415 23.775 130-134 20.244999999999997 28.105000000000004 27.250000000000004 24.4 135-139 21.65 28.155 27.045 23.150000000000002 140-144 21.515 27.725 27.084999999999997 23.674999999999997 145-149 20.78 27.785 27.815 23.62 150-151 20.2625 27.925 26.825 24.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 2.5 19 2.0 20 1.0 21 0.5 22 0.5 23 1.5 24 3.0 25 5.5 26 6.0 27 5.0 28 7.0 29 12.0 30 19.5 31 31.5 32 36.0 33 41.0 34 60.0 35 76.5 36 89.0 37 104.0 38 122.0 39 160.5 40 187.5 41 201.5 42 243.5 43 266.5 44 270.0 45 258.0 46 254.5 47 258.0 48 236.5 49 190.0 50 155.0 51 142.0 52 114.0 53 97.5 54 85.0 55 67.0 56 54.0 57 37.0 58 24.5 59 21.5 60 13.5 61 6.5 62 7.5 63 8.0 64 3.0 65 2.5 66 2.5 67 1.0 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.3 #Duplication Level Percentage of deduplicated Percentage of total 1 94.35312831389183 88.97500000000001 2 5.302226935312832 10.0 3 0.3181336161187699 0.8999999999999999 4 0.0 0.0 5 0.02651113467656416 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7749999999999999 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.5875 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 2.025 0.0 0.0 0.0 0.0 120-121 2.2249999999999996 0.0 0.0 0.0 0.0 122-123 2.35 0.0 0.0 0.0 0.0 124-125 2.525 0.0 0.0 0.0 0.0 126-127 2.75 0.0 0.0 0.0 0.0 128-129 3.025 0.0 0.0 0.0 0.0 130-131 3.5125 0.0 0.0 0.0 0.0 132-133 3.8375 0.0 0.0 0.0 0.0 134-135 4.225 0.0 0.0 0.0 0.0 136-137 4.6375 0.0 0.0 0.0 0.0 138-139 5.012499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671658 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671658_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.268 37.0 37.0 37.0 37.0 37.0 2 36.1585 37.0 37.0 37.0 37.0 37.0 3 36.3025 37.0 37.0 37.0 37.0 37.0 4 36.2655 37.0 37.0 37.0 37.0 37.0 5 36.231 37.0 37.0 37.0 37.0 37.0 6 36.155 37.0 37.0 37.0 37.0 37.0 7 36.309 37.0 37.0 37.0 37.0 37.0 8 36.319 37.0 37.0 37.0 37.0 37.0 9 36.3375 37.0 37.0 37.0 37.0 37.0 10-14 36.284800000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.2771 37.0 37.0 37.0 37.0 37.0 20-24 36.25939999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.19879999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.123000000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.1413 37.0 37.0 37.0 37.0 37.0 40-44 36.1025 37.0 37.0 37.0 37.0 37.0 45-49 36.1682 37.0 37.0 37.0 37.0 37.0 50-54 36.0943 37.0 37.0 37.0 37.0 37.0 55-59 36.104699999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.982400000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.974599999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.947199999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.910399999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.9131 37.0 37.0 37.0 37.0 37.0 85-89 35.8885 37.0 37.0 37.0 37.0 37.0 90-94 35.841499999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.842200000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8024 37.0 37.0 37.0 37.0 37.0 105-109 35.7481 37.0 37.0 37.0 37.0 37.0 110-114 35.684400000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.6371 37.0 37.0 37.0 37.0 37.0 120-124 35.7091 37.0 37.0 37.0 37.0 37.0 125-129 35.62519999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.5692 37.0 37.0 37.0 37.0 37.0 135-139 35.58489999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.293600000000005 37.0 37.0 37.0 34.6 37.0 145-149 35.425200000000004 37.0 37.0 37.0 34.6 37.0 150-151 34.92425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 1.0 15 3.0 16 0.0 17 1.0 18 1.0 19 2.0 20 1.0 21 3.0 22 4.0 23 6.0 24 0.0 25 10.0 26 5.0 27 12.0 28 18.0 29 10.0 30 31.0 31 55.0 32 77.0 33 86.0 34 195.0 35 489.0 36 2720.0 37 267.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.225 19.6 11.75 33.425 2 22.925 24.875 37.35 14.85 3 21.0 27.35 31.125000000000004 20.525 4 21.825 36.4 22.6 19.175 5 23.35 37.675 21.825 17.150000000000002 6 18.575 37.7 24.45 19.275000000000002 7 18.099999999999998 17.849999999999998 41.775 22.275 8 20.150000000000002 22.55 29.425 27.875 9 20.8 24.275 30.349999999999998 24.575 10-14 22.1 28.515 27.229999999999997 22.155 15-19 22.125 28.575 27.51 21.790000000000003 20-24 22.835 28.58 27.455000000000002 21.13 25-29 22.195 27.85 28.15 21.805 30-34 22.384999999999998 27.575 28.610000000000003 21.43 35-39 22.41 27.805000000000003 28.425 21.36 40-44 22.855 27.52 28.37 21.255 45-49 22.805 27.439999999999998 28.095 21.66 50-54 22.439999999999998 29.185 27.065 21.310000000000002 55-59 23.34 27.655 28.115000000000002 20.89 60-64 22.79 28.285 27.605 21.32 65-69 22.95 27.51 28.349999999999998 21.19 70-74 24.095 27.57 27.450000000000003 20.885 75-79 22.825 28.54 27.54 21.095 80-84 23.400000000000002 28.09 27.474999999999998 21.035 85-89 23.65 27.884999999999998 27.35 21.115000000000002 90-94 23.599999999999998 28.33 27.125 20.945 95-99 23.61 27.755000000000003 27.21 21.425 100-104 23.49 27.939999999999998 27.455000000000002 21.115000000000002 105-109 23.375 27.534999999999997 28.01 21.08 110-114 23.335 28.1 27.295 21.27 115-119 24.224999999999998 26.895000000000003 28.265 20.615 120-124 23.830000000000002 27.99 27.534999999999997 20.645 125-129 23.825 27.505000000000003 27.685 20.985 130-134 24.025 27.435 27.485 21.055 135-139 24.349999999999998 27.76 27.87 20.02 140-144 24.705 28.275 26.784999999999997 20.235 145-149 24.154999999999998 27.915 27.43 20.5 150-151 25.687500000000004 27.3125 26.35 20.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.5 17 1.0 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 2.5 24 3.0 25 2.5 26 5.0 27 6.0 28 7.0 29 8.5 30 14.5 31 19.5 32 22.0 33 38.0 34 54.0 35 68.5 36 92.5 37 123.0 38 143.5 39 158.5 40 187.0 41 222.0 42 240.0 43 257.0 44 268.0 45 260.5 46 255.0 47 251.0 48 227.5 49 194.0 50 171.0 51 141.0 52 114.0 53 86.5 54 75.5 55 72.0 56 58.0 57 43.0 58 27.0 59 17.5 60 14.0 61 10.5 62 6.5 63 5.5 64 3.0 65 3.0 66 2.5 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.475 #Duplication Level Percentage of deduplicated Percentage of total 1 94.49589838581636 89.275 2 5.1865572902884365 9.8 3 0.2910822969039428 0.8250000000000001 4 0.02646202699126753 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5249999999999999 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.2375 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.7374999999999998 0.0 0.0 0.0 0.0 118-119 1.9749999999999999 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.475 0.0 0.0 0.0 0.0 126-127 2.7 0.0 0.0 0.0 0.0 128-129 3.0 0.0 0.0 0.0 0.0 130-131 3.4875 0.0 0.0 0.0 0.0 132-133 3.8125 0.0 0.0 0.0 0.0 134-135 4.2 0.0 0.0 0.0 0.0 136-137 4.6125 0.0 0.0 0.0 0.0 138-139 4.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCTA 10 0.006830828 145.0 4 AACCTAT 10 0.006830828 145.0 5 GGAAACC 10 0.006830828 145.0 1 >>END_MODULE Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977058 spots for SRR12671658.sra Written 977058 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra Read 977040 spots for SRR12671658.sra Written 977040 spots for SRR12671658.sra SRR ids: ['SRR12671658.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bit41ep9 SRR12671658.sra spots: 19540818 blocks: [[1, 977040], [977041, 1954080], [1954081, 2931120], [2931121, 3908160], [3908161, 4885200], [4885201, 5862240], [5862241, 6839280], [6839281, 7816320], [7816321, 8793360], [8793361, 9770400], [9770401, 10747440], [10747441, 11724480], [11724481, 12701520], [12701521, 13678560], [13678561, 14655600], [14655601, 15632640], [15632641, 16609680], [16609681, 17586720], [17586721, 18563760], [18563761, 19540818]] SRR12671658 file size 6619124 SRR12671658 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671658 SRR12671658_1.fastq SRR12671658_2.fastq Input file: SRR12671658_1.fastq Paired file: SRR12671658_2.fastq trimmed: SRR12671658-trimmed-pair1.fastq, SRR12671658-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:47:04 2025 >> started Wed Feb 12 00:47:37 2025 >> done (32.987s) 19540818 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 1206 ( 0.01%) empty read pairs filtered out after trimming by size control 19539594 (99.99%) read pairs available; of these: 1347521 ( 6.90%) trimmed read pairs available after processing 18192073 (93.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 2 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 4 0.00% 25 2 0.00% 26 3 0.00% 27 4 0.00% 28 6 0.00% 29 3 0.00% 30 3 0.00% 31 6 0.00% 32 10 0.00% 33 11 0.00% 34 8 0.00% 35 12 0.00% 36 10 0.00% 37 26 0.00% 38 15 0.00% 39 22 0.00% 40 24 0.00% 41 25 0.00% 42 29 0.00% 43 30 0.00% 44 32 0.00% 45 39 0.00% 46 33 0.00% 47 34 0.00% 48 42 0.00% 49 52 0.00% 50 59 0.00% 51 54 0.00% 52 57 0.00% 53 85 0.00% 54 73 0.00% 55 62 0.00% 56 87 0.00% 57 78 0.00% 58 99 0.00% 59 133 0.00% 60 169 0.00% 61 167 0.00% 62 219 0.00% 63 244 0.00% 64 212 0.00% 65 274 0.00% 66 297 0.00% 67 298 0.00% 68 356 0.00% 69 417 0.00% 70 471 0.00% 71 556 0.00% 72 603 0.00% 73 700 0.00% 74 782 0.00% 75 897 0.00% 76 1076 0.01% 77 1054 0.01% 78 1169 0.01% 79 1311 0.01% 80 1475 0.01% 81 1617 0.01% 82 1962 0.01% 83 2192 0.01% 84 2435 0.01% 85 2729 0.01% 86 2838 0.01% 87 3040 0.02% 88 3194 0.02% 89 3533 0.02% 90 3882 0.02% 91 4157 0.02% 92 4722 0.02% 93 5313 0.03% 94 5571 0.03% 95 6080 0.03% 96 6370 0.03% 97 6533 0.03% 98 6907 0.04% 99 7123 0.04% 100 7775 0.04% 101 8076 0.04% 102 8892 0.05% 103 9527 0.05% 104 10124 0.05% 105 10702 0.05% 106 11238 0.06% 107 11581 0.06% 108 11791 0.06% 109 12613 0.06% 110 12920 0.07% 111 13620 0.07% 112 14253 0.07% 113 14845 0.08% 114 15993 0.08% 115 17056 0.09% 116 17488 0.09% 117 18096 0.09% 118 18299 0.09% 119 18931 0.10% 120 19417 0.10% 121 20313 0.10% 122 20924 0.11% 123 22155 0.11% 124 23499 0.12% 125 23826 0.12% 126 24733 0.13% 127 25397 0.13% 128 25913 0.13% 129 26367 0.13% 130 27108 0.14% 131 27584 0.14% 132 28571 0.15% 133 30287 0.16% 134 31060 0.16% 135 32483 0.17% 136 33116 0.17% 137 33777 0.17% 138 34613 0.18% 139 35108 0.18% 140 35232 0.18% 141 35943 0.18% 142 37093 0.19% 143 38455 0.20% 144 40461 0.21% 145 41175 0.21% 146 42108 0.22% 147 42823 0.22% 148 43179 0.22% 149 42837 0.22% 150 43913 0.22% 151 18192073 93.10% 19539594 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=22 prefix-density=0.45 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=14.44 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.7 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=26 prefix-density=0.59 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=67.12 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.1 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR12671658 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:48:28 Started mapping on | Feb 12 00:48:28 Finished on | Feb 12 00:53:50 Mapping speed, Million of reads per hour | 218.46 Number of input reads | 19539594 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18228940 Uniquely mapped reads % | 93.29% Average mapped length | 297.57 Number of splices: Total | 18246891 Number of splices: Annotated (sjdb) | 17848389 Number of splices: GT/AG | 17889485 Number of splices: GC/AG | 295003 Number of splices: AT/AC | 10480 Number of splices: Non-canonical | 51923 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 492167 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 126111 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.39% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 818487 818487 818487 N_multimapping 492167 492167 492167 N_noFeature 700548 17951759 795015 N_ambiguous 299382 1373 115869 UnstrandedReadsAssigned:17229010 PositiveStrandReadsAssigned:275808 NegativeStrandReadsAssigned:17318056 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671658 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671658-trimmed-pair1.fastq SRR12671658-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,539,594 reads, 17,343,017 reads pseudoaligned [quant] estimated average fragment length: 286.566 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52401 SRR12671658.ke.tsv 34699 SRR12671658.se.tsv 87100 total ==> SRR12671658.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.43 731 22.5275 Potri.005G024800.1.v4.1 1035 749.434 482 34.3373 Potri.004G059700.1.v4.1 961 675.937 0 0 Potri.007G009000.2.v4.1 1416 1130.43 0 0 Potri.003G141000.2.v4.1 2943 2657.43 1137.43 22.8516 Potri.016G087400.1.v4.1 270 77.6093 772 531.076 Potri.015G069301.1.v4.1 564 301.59 0 0 Potri.010G195200.1.v4.1 1773 1487.43 113.868 4.0871 Potri.012G127500.1.v4.1 977 691.716 133 10.2654 ==> SRR12671658.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 227 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 25 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR12671658 completed mapping pipeline successfully