Starting /dee2/code/volunteer_pipeline.sh SRR12671659 current disk space = 3051321577472 free memory = 1464344172 SRR12671659 SRAfilesize d0a4b11e016cfa5afc53053746ec452c SRR12671659.sra SRR12671659.sra file validated SRR12671659 is paired end SRR12671659 is conventional basespace SRR12671659 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671659_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.262 37.0 37.0 37.0 37.0 37.0 2 36.2425 37.0 37.0 37.0 37.0 37.0 3 36.503 37.0 37.0 37.0 37.0 37.0 4 36.553 37.0 37.0 37.0 37.0 37.0 5 36.5785 37.0 37.0 37.0 37.0 37.0 6 36.5685 37.0 37.0 37.0 37.0 37.0 7 36.5465 37.0 37.0 37.0 37.0 37.0 8 36.513 37.0 37.0 37.0 37.0 37.0 9 36.5325 37.0 37.0 37.0 37.0 37.0 10-14 36.5448 37.0 37.0 37.0 37.0 37.0 15-19 36.4905 37.0 37.0 37.0 37.0 37.0 20-24 36.543699999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.473600000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.473299999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4302 37.0 37.0 37.0 37.0 37.0 40-44 36.462 37.0 37.0 37.0 37.0 37.0 45-49 36.436099999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.378 37.0 37.0 37.0 37.0 37.0 55-59 36.381600000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.322199999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.4074 37.0 37.0 37.0 37.0 37.0 70-74 36.3337 37.0 37.0 37.0 37.0 37.0 75-79 36.2709 37.0 37.0 37.0 37.0 37.0 80-84 36.2996 37.0 37.0 37.0 37.0 37.0 85-89 36.333000000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.241200000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.17790000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.253 37.0 37.0 37.0 37.0 37.0 105-109 36.2013 37.0 37.0 37.0 37.0 37.0 110-114 36.209500000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.131299999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.083600000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.0283 37.0 37.0 37.0 37.0 37.0 130-134 36.006499999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.0102 37.0 37.0 37.0 37.0 37.0 140-144 35.911100000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.8537 37.0 37.0 37.0 37.0 37.0 150-151 35.423 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 6.0 27 3.0 28 14.0 29 13.0 30 21.0 31 34.0 32 47.0 33 73.0 34 114.0 35 337.0 36 2976.0 37 360.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.275000000000002 14.499999999999998 13.600000000000001 42.625 2 20.37593984962406 21.17794486215539 39.523809523809526 18.922305764411025 3 18.45 26.275 26.400000000000002 28.875 4 22.125 34.2 21.95 21.725 5 20.75 38.35 23.225 17.675 6 16.75 36.449999999999996 26.55 20.25 7 13.450000000000001 20.549999999999997 45.625 20.375 8 18.05 22.075 30.85 29.025000000000002 9 18.5 21.0 33.575 26.924999999999997 10-14 19.68 29.04 26.840000000000003 24.44 15-19 19.575 28.68 28.084999999999997 23.66 20-24 19.63 28.325 28.299999999999997 23.745 25-29 19.845 28.044999999999998 27.675 24.435000000000002 30-34 19.61 28.994999999999997 27.735 23.66 35-39 19.62 28.37 28.15 23.86 40-44 19.64 28.655 27.939999999999998 23.765 45-49 20.135 28.744999999999997 27.389999999999997 23.73 50-54 19.735 28.355000000000004 27.875 24.035 55-59 19.744999999999997 28.375 28.13 23.75 60-64 20.405 27.33 28.095 24.169999999999998 65-69 20.48 28.15 27.495000000000005 23.875 70-74 20.535 27.965 27.839999999999996 23.66 75-79 20.28 28.215 27.495000000000005 24.01 80-84 20.355 27.79 27.560000000000002 24.295 85-89 20.605 28.78 27.279999999999998 23.335 90-94 20.76 28.395 27.565 23.28 95-99 19.91 28.27 28.01 23.810000000000002 100-104 21.09 27.72 27.425 23.765 105-109 20.11 28.084999999999997 27.32 24.485 110-114 20.465 28.82 26.619999999999997 24.095 115-119 20.599999999999998 28.694999999999997 27.634999999999998 23.07 120-124 20.665 28.225 27.400000000000002 23.71 125-129 20.845 28.075 27.735 23.345 130-134 20.705000000000002 28.110000000000003 27.605 23.580000000000002 135-139 20.95 27.515 27.560000000000002 23.974999999999998 140-144 20.41 27.245 28.225 24.12 145-149 19.869999999999997 27.87 27.685 24.575 150-151 20.6125 27.187499999999996 28.1875 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 2.0 23 2.5 24 4.5 25 5.0 26 5.0 27 7.0 28 9.0 29 13.0 30 20.0 31 27.0 32 37.0 33 49.0 34 58.5 35 73.0 36 88.5 37 102.5 38 140.0 39 189.0 40 199.0 41 203.5 42 227.5 43 240.0 44 251.0 45 259.0 46 267.5 47 265.0 48 229.0 49 197.5 50 176.0 51 141.5 52 116.5 53 102.0 54 76.5 55 55.5 56 44.5 57 32.5 58 21.0 59 16.0 60 12.5 61 8.0 62 7.0 63 4.0 64 2.5 65 3.0 66 1.5 67 2.0 68 2.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.025 #Duplication Level Percentage of deduplicated Percentage of total 1 94.12390321722947 88.5 2 5.4240893379420365 10.2 3 0.42541877160329705 1.2 4 0.026588673225206066 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.2625 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.3875 0.0 0.0 0.0 0.0 126-127 1.5750000000000002 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.9625 0.0 0.0 0.0 0.0 132-133 2.2750000000000004 0.0 0.0 0.0 0.0 134-135 2.4 0.0 0.0 0.0 0.0 136-137 2.5625 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671659 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671659_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2615 37.0 37.0 37.0 37.0 37.0 2 36.122 37.0 37.0 37.0 37.0 37.0 3 36.3205 37.0 37.0 37.0 37.0 37.0 4 36.059 37.0 37.0 37.0 37.0 37.0 5 36.367 37.0 37.0 37.0 37.0 37.0 6 36.2455 37.0 37.0 37.0 37.0 37.0 7 36.2015 37.0 37.0 37.0 37.0 37.0 8 36.2535 37.0 37.0 37.0 37.0 37.0 9 36.2915 37.0 37.0 37.0 37.0 37.0 10-14 36.336499999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.26279999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.262699999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.2146 37.0 37.0 37.0 37.0 37.0 30-34 36.2164 37.0 37.0 37.0 37.0 37.0 35-39 36.133500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.1339 37.0 37.0 37.0 37.0 37.0 45-49 36.1063 37.0 37.0 37.0 37.0 37.0 50-54 36.0796 37.0 37.0 37.0 37.0 37.0 55-59 36.0366 37.0 37.0 37.0 37.0 37.0 60-64 35.975 37.0 37.0 37.0 37.0 37.0 65-69 35.994899999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.998000000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.894000000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.948299999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.887800000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.75940000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.7964 37.0 37.0 37.0 37.0 37.0 100-104 35.776399999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.732800000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.6691 37.0 37.0 37.0 37.0 37.0 115-119 35.699799999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.696600000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.6524 37.0 37.0 37.0 37.0 37.0 130-134 35.6105 37.0 37.0 37.0 37.0 37.0 135-139 35.581399999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.3224 37.0 37.0 37.0 32.2 37.0 145-149 35.497 37.0 37.0 37.0 37.0 37.0 150-151 35.046499999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 3.0 17 1.0 18 1.0 19 1.0 20 1.0 21 0.0 22 1.0 23 2.0 24 3.0 25 10.0 26 8.0 27 10.0 28 17.0 29 23.0 30 34.0 31 44.0 32 67.0 33 111.0 34 197.0 35 522.0 36 2695.0 37 246.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.725 16.25 16.85 33.175 2 26.375 23.974999999999998 34.449999999999996 15.2 3 19.15 26.575 32.775 21.5 4 22.625 34.4 22.225 20.75 5 23.5 36.8 22.15 17.549999999999997 6 17.45 36.449999999999996 25.25 20.849999999999998 7 17.175 16.5 44.75 21.575 8 20.65 23.200000000000003 28.675 27.474999999999998 9 21.099999999999998 23.5 30.099999999999998 25.3 10-14 22.45 28.835 26.14 22.575 15-19 22.03 27.345000000000002 28.585 22.040000000000003 20-24 22.465 28.249999999999996 27.779999999999998 21.505 25-29 22.545 28.425 27.389999999999997 21.64 30-34 21.845 28.165000000000003 28.105000000000004 21.884999999999998 35-39 22.845 27.505000000000003 27.91 21.740000000000002 40-44 22.8 27.42 28.08 21.7 45-49 22.25 28.095 27.800000000000004 21.855 50-54 22.45 28.46 27.305 21.785 55-59 23.07 27.439999999999998 27.900000000000002 21.59 60-64 22.925 26.955000000000002 28.360000000000003 21.759999999999998 65-69 22.965 28.01 27.66 21.365000000000002 70-74 23.345 27.650000000000002 27.57 21.435000000000002 75-79 22.439999999999998 28.075 27.73 21.755 80-84 22.64 27.46 27.915 21.985 85-89 23.64 27.884999999999998 27.025 21.45 90-94 23.06 28.285 27.034999999999997 21.62 95-99 23.549999999999997 28.105000000000004 27.045 21.3 100-104 23.36 28.1 26.955000000000002 21.584999999999997 105-109 23.169999999999998 27.765 27.825 21.240000000000002 110-114 22.6 27.655 28.175 21.57 115-119 23.635 27.950000000000003 27.315 21.099999999999998 120-124 23.474999999999998 27.815 27.41 21.3 125-129 23.74 27.715 27.125 21.42 130-134 23.79 27.279999999999998 27.925 21.005 135-139 23.810000000000002 27.41 27.595 21.185000000000002 140-144 24.0 28.4 26.85 20.75 145-149 24.065 27.705000000000002 27.55 20.68 150-151 25.0625 27.212500000000002 27.150000000000002 20.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 3.5 24 3.0 25 3.0 26 5.0 27 9.5 28 12.0 29 13.0 30 15.5 31 17.5 32 27.5 33 38.5 34 45.5 35 59.5 36 75.0 37 99.5 38 136.0 39 175.5 40 192.5 41 205.0 42 236.5 43 250.5 44 258.0 45 262.0 46 254.5 47 239.0 48 232.5 49 214.5 50 171.5 51 148.0 52 128.0 53 103.5 54 85.0 55 69.5 56 55.0 57 36.5 58 28.5 59 25.5 60 15.5 61 8.5 62 7.5 63 6.5 64 3.0 65 1.0 66 1.0 67 0.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.75 #Duplication Level Percentage of deduplicated Percentage of total 1 94.37333333333333 88.47500000000001 2 5.013333333333334 9.4 3 0.37333333333333335 1.05 4 0.16 0.6 5 0.02666666666666667 0.125 6 0.0 0.0 7 0.05333333333333334 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit CATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8374999999999999 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.05 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.3625 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.6 0.0 0.0 0.0 0.0 128-129 1.7374999999999998 0.0 0.0 0.0 0.0 130-131 1.9625 0.0 0.0 0.0 0.0 132-133 2.3 0.0 0.0 0.0 0.0 134-135 2.425 0.0 0.0 0.0 0.0 136-137 2.5625 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACTCT 10 0.006830828 145.0 1 CTGCTTT 10 0.006830828 145.0 8 >>END_MODULE Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916635 spots for SRR12671659.sra Written 916635 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra Read 916626 spots for SRR12671659.sra Written 916626 spots for SRR12671659.sra SRR ids: ['SRR12671659.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m3wcudbc SRR12671659.sra spots: 18332529 blocks: [[1, 916626], [916627, 1833252], [1833253, 2749878], [2749879, 3666504], [3666505, 4583130], [4583131, 5499756], [5499757, 6416382], [6416383, 7333008], [7333009, 8249634], [8249635, 9166260], [9166261, 10082886], [10082887, 10999512], [10999513, 11916138], [11916139, 12832764], [12832765, 13749390], [13749391, 14666016], [14666017, 15582642], [15582643, 16499268], [16499269, 17415894], [17415895, 18332529]] SRR12671659 file size 6208495 SRR12671659 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671659 SRR12671659_1.fastq SRR12671659_2.fastq Input file: SRR12671659_1.fastq Paired file: SRR12671659_2.fastq trimmed: SRR12671659-trimmed-pair1.fastq, SRR12671659-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:43:20 2025 >> started Wed Feb 12 00:43:41 2025 >> done (21.206s) 18332529 read pairs processed; of these: 13 ( 0.00%) short read pairs filtered out after trimming by size control 2614 ( 0.01%) empty read pairs filtered out after trimming by size control 18329902 (99.99%) read pairs available; of these: 935910 ( 5.11%) trimmed read pairs available after processing 17393992 (94.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 5 0.00% 23 3 0.00% 24 3 0.00% 25 4 0.00% 26 7 0.00% 27 7 0.00% 28 4 0.00% 29 7 0.00% 30 9 0.00% 31 9 0.00% 32 9 0.00% 33 8 0.00% 34 12 0.00% 35 11 0.00% 36 12 0.00% 37 15 0.00% 38 21 0.00% 39 25 0.00% 40 19 0.00% 41 23 0.00% 42 34 0.00% 43 23 0.00% 44 31 0.00% 45 41 0.00% 46 30 0.00% 47 37 0.00% 48 46 0.00% 49 50 0.00% 50 56 0.00% 51 45 0.00% 52 67 0.00% 53 81 0.00% 54 67 0.00% 55 86 0.00% 56 64 0.00% 57 74 0.00% 58 103 0.00% 59 142 0.00% 60 113 0.00% 61 166 0.00% 62 164 0.00% 63 173 0.00% 64 170 0.00% 65 210 0.00% 66 213 0.00% 67 260 0.00% 68 289 0.00% 69 307 0.00% 70 325 0.00% 71 387 0.00% 72 430 0.00% 73 468 0.00% 74 547 0.00% 75 609 0.00% 76 652 0.00% 77 663 0.00% 78 736 0.00% 79 815 0.00% 80 1004 0.01% 81 1071 0.01% 82 1263 0.01% 83 1350 0.01% 84 1511 0.01% 85 1694 0.01% 86 1841 0.01% 87 1933 0.01% 88 2179 0.01% 89 2335 0.01% 90 2447 0.01% 91 2685 0.01% 92 2954 0.02% 93 3293 0.02% 94 3508 0.02% 95 3746 0.02% 96 4081 0.02% 97 4386 0.02% 98 4450 0.02% 99 4947 0.03% 100 5089 0.03% 101 5585 0.03% 102 5683 0.03% 103 6307 0.03% 104 6589 0.04% 105 6948 0.04% 106 7455 0.04% 107 7603 0.04% 108 8006 0.04% 109 8490 0.05% 110 8822 0.05% 111 9544 0.05% 112 9646 0.05% 113 10047 0.05% 114 10741 0.06% 115 11225 0.06% 116 11890 0.06% 117 11734 0.06% 118 12482 0.07% 119 12915 0.07% 120 13597 0.07% 121 14086 0.08% 122 14429 0.08% 123 15224 0.08% 124 15722 0.09% 125 16542 0.09% 126 17159 0.09% 127 17270 0.09% 128 18209 0.10% 129 18184 0.10% 130 18967 0.10% 131 19637 0.11% 132 20154 0.11% 133 21443 0.12% 134 21472 0.12% 135 22534 0.12% 136 23110 0.13% 137 23327 0.13% 138 24435 0.13% 139 24647 0.13% 140 25095 0.14% 141 25791 0.14% 142 26887 0.15% 143 27582 0.15% 144 28909 0.16% 145 29205 0.16% 146 29937 0.16% 147 30244 0.16% 148 30815 0.17% 149 31220 0.17% 150 31607 0.17% 151 17393992 94.89% 18329902 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.73 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTT criterion=fanout-score sequence-density=0.24 sequence-density-rank=11 fanout-score=9.99 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=5.5 sequence=TTCTTTCCAATGCT criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=22 prefix-density=0.75 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=16.56 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=1.8 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCT SRR12671659 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:44:25 Started mapping on | Feb 12 00:44:26 Finished on | Feb 12 00:46:19 Mapping speed, Million of reads per hour | 583.96 Number of input reads | 18329902 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17358154 Uniquely mapped reads % | 94.70% Average mapped length | 298.51 Number of splices: Total | 17936523 Number of splices: Annotated (sjdb) | 17586001 Number of splices: GT/AG | 17578091 Number of splices: GC/AG | 295994 Number of splices: AT/AC | 11267 Number of splices: Non-canonical | 51171 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403911 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 104495 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.40% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 567837 567837 567837 N_multimapping 403911 403911 403911 N_noFeature 631032 17046748 723380 N_ambiguous 336565 1264 116684 UnstrandedReadsAssigned:16390557 PositiveStrandReadsAssigned:310142 NegativeStrandReadsAssigned:16518090 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671659 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671659-trimmed-pair1.fastq SRR12671659-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,329,902 reads, 16,485,934 reads pseudoaligned [quant] estimated average fragment length: 311.794 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR12671659.ke.tsv 34699 SRR12671659.se.tsv 87100 total ==> SRR12671659.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1707.21 935 28.4664 Potri.005G024800.1.v4.1 1035 724.206 279 20.0239 Potri.004G059700.1.v4.1 961 650.981 0 0 Potri.007G009000.2.v4.1 1416 1105.21 0 0 Potri.003G141000.2.v4.1 2943 2632.21 1017.07 20.0835 Potri.016G087400.1.v4.1 270 74.3671 648.42 453.193 Potri.015G069301.1.v4.1 564 286.605 0 0 Potri.010G195200.1.v4.1 1773 1462.21 82 2.91483 Potri.012G127500.1.v4.1 977 666.666 55 4.28807 ==> SRR12671659.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 93 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 243 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12671659 completed mapping pipeline successfully