Starting /dee2/code/volunteer_pipeline.sh SRR12671660 current disk space = 3051247493120 free memory = 1512083900 SRR12671660 SRAfilesize 3364c97aa74fc4899f89a2a6590ef699 SRR12671660.sra SRR12671660.sra file validated SRR12671660 is paired end SRR12671660 is conventional basespace SRR12671660 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671660_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3995 37.0 37.0 37.0 37.0 37.0 2 36.1985 37.0 37.0 37.0 37.0 37.0 3 36.4715 37.0 37.0 37.0 37.0 37.0 4 36.52 37.0 37.0 37.0 37.0 37.0 5 36.5495 37.0 37.0 37.0 37.0 37.0 6 36.5365 37.0 37.0 37.0 37.0 37.0 7 36.413 37.0 37.0 37.0 37.0 37.0 8 36.5735 37.0 37.0 37.0 37.0 37.0 9 36.55 37.0 37.0 37.0 37.0 37.0 10-14 36.512299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5082 37.0 37.0 37.0 37.0 37.0 20-24 36.5178 37.0 37.0 37.0 37.0 37.0 25-29 36.4757 37.0 37.0 37.0 37.0 37.0 30-34 36.4511 37.0 37.0 37.0 37.0 37.0 35-39 36.421899999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.3842 37.0 37.0 37.0 37.0 37.0 45-49 36.321000000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.3635 37.0 37.0 37.0 37.0 37.0 55-59 36.349000000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.334 37.0 37.0 37.0 37.0 37.0 65-69 36.2864 37.0 37.0 37.0 37.0 37.0 70-74 36.2207 37.0 37.0 37.0 37.0 37.0 75-79 36.2251 37.0 37.0 37.0 37.0 37.0 80-84 36.2267 37.0 37.0 37.0 37.0 37.0 85-89 36.2355 37.0 37.0 37.0 37.0 37.0 90-94 36.195100000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.1224 37.0 37.0 37.0 37.0 37.0 100-104 36.17530000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.124 37.0 37.0 37.0 37.0 37.0 110-114 36.123900000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.06869999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.009499999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.982600000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.902300000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.9037 37.0 37.0 37.0 37.0 37.0 140-144 35.880399999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.799099999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.2535 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 2.0 26 3.0 27 8.0 28 24.0 29 21.0 30 30.0 31 34.0 32 56.0 33 76.0 34 111.0 35 305.0 36 2949.0 37 380.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.125 16.325 10.8 40.75 2 18.966382338183642 21.77621675865529 39.33768188660311 19.919719016557952 3 16.400000000000002 27.525 29.575000000000003 26.5 4 21.775 34.4 23.45 20.375 5 21.0 36.3 24.675 18.025 6 17.299999999999997 35.125 25.324999999999996 22.25 7 12.55 21.375 46.050000000000004 20.025000000000002 8 16.85 21.099999999999998 31.974999999999998 30.075000000000003 9 17.525 22.5 32.2 27.775 10-14 19.485 28.76 27.439999999999998 24.315 15-19 19.75 28.395 28.185 23.669999999999998 20-24 19.46 28.875 27.744999999999997 23.919999999999998 25-29 20.119999999999997 28.375 27.395000000000003 24.11 30-34 19.875 29.015 27.884999999999998 23.225 35-39 20.055 28.494999999999997 27.82 23.630000000000003 40-44 20.435 28.4 27.744999999999997 23.419999999999998 45-49 20.064999999999998 28.23 28.105000000000004 23.599999999999998 50-54 19.45 28.76 28.075 23.715 55-59 19.615 28.51 27.800000000000004 24.075 60-64 20.405 28.515 27.88 23.200000000000003 65-69 20.255000000000003 28.57 27.655 23.52 70-74 19.900000000000002 28.535 27.655 23.91 75-79 20.22 28.79 27.305 23.685000000000002 80-84 20.09 28.825 27.534999999999997 23.549999999999997 85-89 20.39 28.98 27.250000000000004 23.380000000000003 90-94 20.549999999999997 28.51 27.450000000000003 23.49 95-99 20.87 28.16 27.515 23.455000000000002 100-104 21.14 28.24 27.62 23.0 105-109 20.735 28.285 27.255000000000003 23.724999999999998 110-114 20.794999999999998 28.65 27.555000000000003 23.0 115-119 20.965 28.945 26.669999999999998 23.419999999999998 120-124 20.485 28.665000000000003 27.27 23.580000000000002 125-129 21.295 28.384999999999998 26.85 23.47 130-134 21.08 28.835 26.575 23.51 135-139 21.63 27.975 26.8 23.595 140-144 21.255 28.29 26.705000000000002 23.75 145-149 21.15 28.244999999999997 26.72 23.885 150-151 20.724999999999998 28.6625 26.437500000000004 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 1.5 25 3.5 26 5.0 27 6.5 28 12.0 29 19.5 30 22.0 31 25.0 32 32.5 33 49.0 34 65.5 35 81.5 36 103.5 37 128.0 38 144.5 39 155.5 40 181.5 41 219.0 42 233.5 43 249.0 44 271.0 45 272.5 46 264.5 47 234.5 48 215.5 49 211.5 50 182.0 51 140.0 52 112.5 53 87.5 54 66.0 55 50.0 56 39.0 57 32.0 58 24.5 59 19.5 60 12.0 61 6.0 62 4.5 63 3.0 64 0.5 65 0.5 66 0.5 67 0.5 68 1.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.7715870081859 89.725 2 4.858727224716134 9.2 3 0.3432796408766834 0.975 4 0.026406126221283337 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.175 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.2375 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.4375 0.0 0.0 0.0 0.0 118-119 3.825 0.0 0.0 0.0 0.0 120-121 4.225 0.0 0.0 0.0 0.0 122-123 4.6375 0.0 0.0 0.0 0.0 124-125 5.15 0.0 0.0 0.0 0.0 126-127 5.675000000000001 0.0 0.0 0.0 0.0 128-129 6.125 0.0 0.0 0.0 0.0 130-131 6.5 0.0 0.0 0.0 0.0 132-133 6.987500000000001 0.0 0.0 0.0 0.0 134-135 7.2625 0.0 0.0 0.0 0.0 136-137 7.725 0.0 0.0 0.0 0.0 138-139 8.162500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTGCC 10 0.006830828 145.0 145 AACTTCA 10 0.006830828 145.0 4 ATCAGAT 10 0.006830828 145.0 1 >>END_MODULE SRR12671660 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671660_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.215 37.0 37.0 37.0 37.0 37.0 2 36.0835 37.0 37.0 37.0 37.0 37.0 3 36.083 37.0 37.0 37.0 37.0 37.0 4 36.138 37.0 37.0 37.0 37.0 37.0 5 36.2795 37.0 37.0 37.0 37.0 37.0 6 36.183 37.0 37.0 37.0 37.0 37.0 7 36.2955 37.0 37.0 37.0 37.0 37.0 8 36.2825 37.0 37.0 37.0 37.0 37.0 9 36.2445 37.0 37.0 37.0 37.0 37.0 10-14 36.299 37.0 37.0 37.0 37.0 37.0 15-19 36.276300000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.23780000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.192899999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.1301 37.0 37.0 37.0 37.0 37.0 35-39 36.1839 37.0 37.0 37.0 37.0 37.0 40-44 36.153999999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.085 37.0 37.0 37.0 37.0 37.0 50-54 36.1108 37.0 37.0 37.0 37.0 37.0 55-59 36.0496 37.0 37.0 37.0 37.0 37.0 60-64 35.9595 37.0 37.0 37.0 37.0 37.0 65-69 36.003 37.0 37.0 37.0 37.0 37.0 70-74 35.941 37.0 37.0 37.0 37.0 37.0 75-79 35.892 37.0 37.0 37.0 37.0 37.0 80-84 35.9547 37.0 37.0 37.0 37.0 37.0 85-89 35.897499999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.78670000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.8369 37.0 37.0 37.0 37.0 37.0 100-104 35.7968 37.0 37.0 37.0 37.0 37.0 105-109 35.7691 37.0 37.0 37.0 37.0 37.0 110-114 35.740300000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.7341 37.0 37.0 37.0 37.0 37.0 120-124 35.659499999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.551300000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.56869999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.5344 37.0 37.0 37.0 37.0 37.0 140-144 35.2081 37.0 37.0 37.0 27.4 37.0 145-149 35.2358 37.0 37.0 37.0 32.2 37.0 150-151 34.81075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 2.0 14 2.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 2.0 21 0.0 22 5.0 23 2.0 24 7.0 25 4.0 26 9.0 27 19.0 28 14.0 29 25.0 30 24.0 31 57.0 32 61.0 33 92.0 34 194.0 35 576.0 36 2667.0 37 235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.125 18.45 14.000000000000002 31.424999999999997 2 25.35 23.525 35.725 15.4 3 20.0 27.925 31.424999999999997 20.65 4 23.974999999999998 34.275 22.75 19.0 5 23.025000000000002 35.875 22.25 18.85 6 18.825 37.824999999999996 24.275 19.075 7 17.75 18.0 43.625 20.625 8 19.825 22.525000000000002 28.65 28.999999999999996 9 21.375 22.525000000000002 30.625000000000004 25.474999999999998 10-14 22.14 28.77 26.974999999999998 22.115000000000002 15-19 22.75 27.944999999999997 27.800000000000004 21.505 20-24 22.755 27.775 28.1 21.37 25-29 22.43 27.77 28.685 21.115000000000002 30-34 22.165000000000003 28.84 28.345 20.65 35-39 22.375 28.185 27.875 21.565 40-44 22.564999999999998 27.560000000000002 28.415000000000003 21.46 45-49 22.145 28.285 28.244999999999997 21.325 50-54 22.455 27.689999999999998 28.095 21.759999999999998 55-59 22.2 27.74 28.544999999999998 21.515 60-64 22.405 27.855 28.155 21.584999999999997 65-69 22.485 28.425 27.689999999999998 21.4 70-74 23.064999999999998 28.08 27.615000000000002 21.240000000000002 75-79 22.595000000000002 28.299999999999997 27.779999999999998 21.325 80-84 22.650000000000002 28.33 28.025 20.995 85-89 23.150000000000002 28.255000000000003 27.49 21.105 90-94 23.49 27.625 27.87 21.015 95-99 23.265 28.04 27.605 21.09 100-104 22.925 28.065 27.77 21.240000000000002 105-109 23.419999999999998 27.87 27.700000000000003 21.01 110-114 23.72 27.694999999999997 27.389999999999997 21.195 115-119 24.115000000000002 27.925 27.355 20.605 120-124 24.6 27.744999999999997 27.310000000000002 20.345 125-129 24.465 27.43 27.76 20.345 130-134 24.560000000000002 27.98 27.250000000000004 20.21 135-139 25.005 27.705000000000002 27.32 19.97 140-144 25.22 28.84 26.064999999999998 19.875 145-149 25.619999999999997 27.905 26.69 19.785 150-151 26.337500000000002 27.187499999999996 27.05 19.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.5 22 3.5 23 5.5 24 4.0 25 3.5 26 4.0 27 8.0 28 10.0 29 9.0 30 14.0 31 21.0 32 32.5 33 40.0 34 47.5 35 66.0 36 84.0 37 106.5 38 143.0 39 172.5 40 198.0 41 226.0 42 247.5 43 261.0 44 262.5 45 263.5 46 258.0 47 228.5 48 218.5 49 219.5 50 177.0 51 140.5 52 116.5 53 89.5 54 80.0 55 62.0 56 41.5 57 33.5 58 23.0 59 21.5 60 16.5 61 8.5 62 9.5 63 5.5 64 1.5 65 1.0 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.66560509554141 89.17500000000001 2 4.697452229299364 8.85 3 0.5042462845010616 1.425 4 0.10615711252653928 0.4 5 0.0 0.0 6 0.02653927813163482 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 2.025 0.0 0.0 0.0 0.0 110-111 2.2750000000000004 0.0 0.0 0.0 0.0 112-113 2.6 0.0 0.0 0.0 0.0 114-115 3.025 0.0 0.0 0.0 0.0 116-117 3.4625 0.0 0.0 0.0 0.0 118-119 3.8499999999999996 0.0 0.0 0.0 0.0 120-121 4.25 0.0 0.0 0.0 0.0 122-123 4.65 0.0 0.0 0.0 0.0 124-125 5.15 0.0 0.0 0.0 0.0 126-127 5.675000000000001 0.0 0.0 0.0 0.0 128-129 6.125 0.0 0.0 0.0 0.0 130-131 6.5125 0.0 0.0 0.0 0.0 132-133 7.012499999999999 0.0 0.0 0.0 0.0 134-135 7.2875 0.0 0.0 0.0 0.0 136-137 7.775 0.0 0.0 0.0 0.0 138-139 8.212499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGACCCC 10 0.006830828 145.0 145 >>END_MODULE Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953052 spots for SRR12671660.sra Written 953052 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra Read 953033 spots for SRR12671660.sra Written 953033 spots for SRR12671660.sra SRR ids: ['SRR12671660.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cehmwuet SRR12671660.sra spots: 19060679 blocks: [[1, 953033], [953034, 1906066], [1906067, 2859099], [2859100, 3812132], [3812133, 4765165], [4765166, 5718198], [5718199, 6671231], [6671232, 7624264], [7624265, 8577297], [8577298, 9530330], [9530331, 10483363], [10483364, 11436396], [11436397, 12389429], [12389430, 13342462], [13342463, 14295495], [14295496, 15248528], [15248529, 16201561], [16201562, 17154594], [17154595, 18107627], [18107628, 19060679]] SRR12671660 file size 6455952 SRR12671660 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671660 SRR12671660_1.fastq SRR12671660_2.fastq Input file: SRR12671660_1.fastq Paired file: SRR12671660_2.fastq trimmed: SRR12671660-trimmed-pair1.fastq, SRR12671660-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:00:04 2025 >> started Wed Feb 12 01:00:25 2025 >> done (21.728s) 19060679 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 1580 ( 0.01%) empty read pairs filtered out after trimming by size control 19059073 (99.99%) read pairs available; of these: 2461894 (12.92%) trimmed read pairs available after processing 16597179 (87.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 4 0.00% 24 7 0.00% 25 1 0.00% 26 6 0.00% 27 7 0.00% 28 12 0.00% 29 12 0.00% 30 20 0.00% 31 8 0.00% 32 16 0.00% 33 20 0.00% 34 17 0.00% 35 25 0.00% 36 25 0.00% 37 35 0.00% 38 33 0.00% 39 41 0.00% 40 39 0.00% 41 47 0.00% 42 50 0.00% 43 59 0.00% 44 52 0.00% 45 62 0.00% 46 74 0.00% 47 82 0.00% 48 73 0.00% 49 120 0.00% 50 108 0.00% 51 153 0.00% 52 173 0.00% 53 170 0.00% 54 183 0.00% 55 159 0.00% 56 191 0.00% 57 217 0.00% 58 243 0.00% 59 289 0.00% 60 357 0.00% 61 379 0.00% 62 407 0.00% 63 491 0.00% 64 522 0.00% 65 576 0.00% 66 608 0.00% 67 678 0.00% 68 692 0.00% 69 842 0.00% 70 1049 0.01% 71 1148 0.01% 72 1372 0.01% 73 1592 0.01% 74 1795 0.01% 75 1928 0.01% 76 2078 0.01% 77 2202 0.01% 78 2473 0.01% 79 2708 0.01% 80 2997 0.02% 81 3591 0.02% 82 4022 0.02% 83 4552 0.02% 84 5263 0.03% 85 5690 0.03% 86 6078 0.03% 87 6381 0.03% 88 6915 0.04% 89 7687 0.04% 90 8361 0.04% 91 9431 0.05% 92 10480 0.05% 93 11704 0.06% 94 12846 0.07% 95 13551 0.07% 96 14147 0.07% 97 15215 0.08% 98 15546 0.08% 99 16486 0.09% 100 17681 0.09% 101 18691 0.10% 102 20084 0.11% 103 22030 0.12% 104 23351 0.12% 105 24720 0.13% 106 25680 0.13% 107 26401 0.14% 108 26901 0.14% 109 27861 0.15% 110 28858 0.15% 111 29880 0.16% 112 31896 0.17% 113 32698 0.17% 114 34783 0.18% 115 36702 0.19% 116 37602 0.20% 117 38470 0.20% 118 39222 0.21% 119 39619 0.21% 120 40162 0.21% 121 41746 0.22% 122 42351 0.22% 123 43884 0.23% 124 45846 0.24% 125 47040 0.25% 126 48482 0.25% 127 49121 0.26% 128 48732 0.26% 129 49675 0.26% 130 49599 0.26% 131 50148 0.26% 132 51623 0.27% 133 53875 0.28% 134 54613 0.29% 135 55684 0.29% 136 56344 0.30% 137 56860 0.30% 138 57240 0.30% 139 57546 0.30% 140 57119 0.30% 141 57306 0.30% 142 58910 0.31% 143 59433 0.31% 144 61429 0.32% 145 62326 0.33% 146 63273 0.33% 147 62989 0.33% 148 63138 0.33% 149 62155 0.33% 150 62434 0.33% 151 16597179 87.08% 19059073 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=21 prefix-density=0.57 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=32.67 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=9.7 sequence=CTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=21 prefix-density=0.77 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=41.53 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAG SRR12671660 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:01:09 Started mapping on | Feb 12 01:01:10 Finished on | Feb 12 01:03:03 Mapping speed, Million of reads per hour | 607.19 Number of input reads | 19059073 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17873701 Uniquely mapped reads % | 93.78% Average mapped length | 294.21 Number of splices: Total | 17947669 Number of splices: Annotated (sjdb) | 17567458 Number of splices: GT/AG | 17583856 Number of splices: GC/AG | 302466 Number of splices: AT/AC | 10183 Number of splices: Non-canonical | 51164 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 411414 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 82038 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.53% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 773958 773958 773958 N_multimapping 411414 411414 411414 N_noFeature 724205 17619602 823868 N_ambiguous 258462 990 103474 UnstrandedReadsAssigned:16891034 PositiveStrandReadsAssigned:253109 NegativeStrandReadsAssigned:16946359 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671660 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671660-trimmed-pair1.fastq SRR12671660-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,059,073 reads, 16,987,722 reads pseudoaligned [quant] estimated average fragment length: 267.993 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR12671660.ke.tsv 34699 SRR12671660.se.tsv 87100 total ==> SRR12671660.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.01 540 19.414 Potri.005G024800.1.v4.1 1035 768.007 241 19.7543 Potri.004G059700.1.v4.1 961 694.514 1 0.0906418 Potri.007G009000.2.v4.1 1416 1149.01 0 0 Potri.003G141000.2.v4.1 2943 2676.01 1326.14 31.1969 Potri.016G087400.1.v4.1 270 91.7296 594 407.649 Potri.015G069301.1.v4.1 564 320.724 0 0 Potri.010G195200.1.v4.1 1773 1506.01 48 2.00643 Potri.012G127500.1.v4.1 977 710.322 40 3.54498 ==> SRR12671660.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 144 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 211 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR12671660 completed mapping pipeline successfully