Starting /dee2/code/volunteer_pipeline.sh SRR12671661 current disk space = 3051203964928 free memory = 1470462036 SRR12671661 SRAfilesize db261b48757d15bdd7032554ac2803bf SRR12671661.sra SRR12671661.sra file validated SRR12671661 is paired end SRR12671661 is conventional basespace SRR12671661 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671661_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3705 37.0 37.0 37.0 37.0 37.0 2 36.163 37.0 37.0 37.0 37.0 37.0 3 36.5105 37.0 37.0 37.0 37.0 37.0 4 36.461 37.0 37.0 37.0 37.0 37.0 5 36.5155 37.0 37.0 37.0 37.0 37.0 6 36.5755 37.0 37.0 37.0 37.0 37.0 7 36.421 37.0 37.0 37.0 37.0 37.0 8 36.538 37.0 37.0 37.0 37.0 37.0 9 36.493 37.0 37.0 37.0 37.0 37.0 10-14 36.4875 37.0 37.0 37.0 37.0 37.0 15-19 36.5255 37.0 37.0 37.0 37.0 37.0 20-24 36.4863 37.0 37.0 37.0 37.0 37.0 25-29 36.416000000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4411 37.0 37.0 37.0 37.0 37.0 35-39 36.4496 37.0 37.0 37.0 37.0 37.0 40-44 36.4021 37.0 37.0 37.0 37.0 37.0 45-49 36.3546 37.0 37.0 37.0 37.0 37.0 50-54 36.35850000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.3351 37.0 37.0 37.0 37.0 37.0 60-64 36.362199999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.2963 37.0 37.0 37.0 37.0 37.0 70-74 36.2421 37.0 37.0 37.0 37.0 37.0 75-79 36.2419 37.0 37.0 37.0 37.0 37.0 80-84 36.243700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.285700000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.2299 37.0 37.0 37.0 37.0 37.0 95-99 36.1387 37.0 37.0 37.0 37.0 37.0 100-104 36.1981 37.0 37.0 37.0 37.0 37.0 105-109 36.0657 37.0 37.0 37.0 37.0 37.0 110-114 36.1132 37.0 37.0 37.0 37.0 37.0 115-119 36.1222 37.0 37.0 37.0 37.0 37.0 120-124 35.9763 37.0 37.0 37.0 37.0 37.0 125-129 36.0572 37.0 37.0 37.0 37.0 37.0 130-134 35.9535 37.0 37.0 37.0 37.0 37.0 135-139 35.9255 37.0 37.0 37.0 37.0 37.0 140-144 35.8042 37.0 37.0 37.0 37.0 37.0 145-149 35.79109999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.3515 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 0.0 25 0.0 26 2.0 27 10.0 28 19.0 29 16.0 30 37.0 31 40.0 32 58.0 33 72.0 34 128.0 35 308.0 36 2910.0 37 398.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.575 17.275 8.225 38.925 2 19.298245614035086 21.578947368421055 40.250626566416045 18.87218045112782 3 17.775 27.025 29.65 25.55 4 22.400000000000002 34.625 21.925 21.05 5 21.175 38.15 23.075000000000003 17.599999999999998 6 16.85 37.45 24.625 21.075 7 13.8 20.275000000000002 46.6 19.325 8 16.075 22.025 31.175000000000004 30.725 9 18.25 21.3 32.824999999999996 27.625 10-14 19.23 29.17 26.525 25.074999999999996 15-19 20.19 28.51 27.345000000000002 23.955000000000002 20-24 19.785 28.425 27.675 24.115000000000002 25-29 20.13 28.895 27.495000000000005 23.48 30-34 20.0 28.405 27.389999999999997 24.205 35-39 20.165 28.78 27.595 23.46 40-44 20.560000000000002 28.52 27.500000000000004 23.419999999999998 45-49 20.255000000000003 28.389999999999997 26.805 24.55 50-54 20.59 28.655 27.450000000000003 23.305 55-59 19.869999999999997 28.994999999999997 27.13 24.005000000000003 60-64 20.035 27.97 27.63 24.365000000000002 65-69 20.13 28.575 27.544999999999998 23.75 70-74 20.595 28.610000000000003 27.265 23.53 75-79 20.52 28.9 27.529999999999998 23.05 80-84 20.62 27.96 27.735 23.685000000000002 85-89 20.47 28.810000000000002 26.919999999999998 23.799999999999997 90-94 20.44 28.32 27.35 23.89 95-99 19.705000000000002 28.595 27.98 23.72 100-104 21.385 28.494999999999997 26.775 23.345 105-109 21.195 28.77 27.060000000000002 22.975 110-114 20.91 27.99 27.32 23.78 115-119 21.365000000000002 28.194999999999997 26.815 23.625 120-124 21.044999999999998 28.915000000000003 26.650000000000002 23.39 125-129 21.095 29.505 26.035000000000004 23.365 130-134 21.615000000000002 28.050000000000004 26.619999999999997 23.715 135-139 21.675 28.599999999999998 26.11 23.615 140-144 20.885 28.275 26.790000000000003 24.05 145-149 20.87 28.515 26.565 24.05 150-151 20.875 28.875 26.75 23.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.5 22 2.0 23 3.0 24 2.5 25 3.5 26 6.0 27 7.5 28 10.0 29 12.5 30 20.0 31 32.0 32 36.5 33 38.5 34 51.0 35 69.5 36 92.0 37 116.5 38 135.0 39 154.5 40 182.0 41 202.5 42 228.0 43 247.5 44 247.0 45 257.5 46 269.5 47 275.0 48 243.5 49 213.5 50 184.0 51 138.0 52 118.0 53 102.0 54 83.5 55 64.0 56 43.5 57 29.0 58 22.0 59 18.5 60 13.0 61 6.5 62 7.0 63 5.0 64 2.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.7 #Duplication Level Percentage of deduplicated Percentage of total 1 93.7299893276414 87.825 2 5.923159018143009 11.1 3 0.2934898612593383 0.8250000000000001 4 0.026680896478121666 0.1 5 0.0 0.0 6 0.026680896478121666 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0125 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.025 0.025 0.0 0.0 0.0 78-79 0.037500000000000006 0.025 0.0 0.0 0.0 80-81 0.05 0.025 0.0 0.0 0.0 82-83 0.0875 0.025 0.0 0.0 0.0 84-85 0.16249999999999998 0.025 0.0 0.0 0.0 86-87 0.2 0.025 0.0 0.0 0.0 88-89 0.225 0.025 0.0 0.0 0.0 90-91 0.2375 0.025 0.0 0.0 0.0 92-93 0.2625 0.025 0.0 0.0 0.0 94-95 0.4375 0.025 0.0 0.0 0.0 96-97 0.575 0.025 0.0 0.0 0.0 98-99 0.7625 0.025 0.0 0.0 0.0 100-101 0.85 0.025 0.0 0.0 0.0 102-103 1.05 0.025 0.0 0.0 0.0 104-105 1.2625000000000002 0.025 0.0 0.0 0.0 106-107 1.6124999999999998 0.025 0.0 0.0 0.0 108-109 1.8375 0.025 0.0 0.0 0.0 110-111 2.125 0.025 0.0 0.0 0.0 112-113 2.3875 0.025 0.0 0.0 0.0 114-115 2.7625 0.025 0.0 0.0 0.0 116-117 3.1625 0.025 0.0 0.0 0.0 118-119 3.5625 0.025 0.0 0.0 0.0 120-121 3.9375 0.025 0.0 0.0 0.0 122-123 4.3625 0.025 0.0 0.0 0.0 124-125 5.025 0.025 0.0 0.0 0.0 126-127 5.5125 0.025 0.0 0.0 0.0 128-129 6.2375 0.025 0.0 0.0 0.0 130-131 6.7375 0.025 0.0 0.0 0.0 132-133 7.375 0.025 0.0 0.0 0.0 134-135 7.8875 0.025 0.0 0.0 0.0 136-137 8.375 0.025 0.0 0.0 0.0 138-139 8.95 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCAAT 10 0.006830828 145.0 6 CAAACTA 10 0.006830828 145.0 8 TAAAGCT 10 0.006830828 145.0 7 >>END_MODULE SRR12671661 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671661_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8175 37.0 37.0 37.0 37.0 37.0 2 35.513 37.0 37.0 37.0 37.0 37.0 3 35.798 37.0 37.0 37.0 37.0 37.0 4 35.962 37.0 37.0 37.0 37.0 37.0 5 35.9395 37.0 37.0 37.0 37.0 37.0 6 36.138 37.0 37.0 37.0 37.0 37.0 7 36.0 37.0 37.0 37.0 37.0 37.0 8 35.9925 37.0 37.0 37.0 37.0 37.0 9 36.011 37.0 37.0 37.0 37.0 37.0 10-14 36.03269999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.0425 37.0 37.0 37.0 37.0 37.0 20-24 36.0835 37.0 37.0 37.0 37.0 37.0 25-29 36.0036 37.0 37.0 37.0 37.0 37.0 30-34 35.9423 37.0 37.0 37.0 37.0 37.0 35-39 35.9114 37.0 37.0 37.0 37.0 37.0 40-44 35.933 37.0 37.0 37.0 37.0 37.0 45-49 35.8382 37.0 37.0 37.0 37.0 37.0 50-54 35.8605 37.0 37.0 37.0 37.0 37.0 55-59 35.8094 37.0 37.0 37.0 37.0 37.0 60-64 35.7994 37.0 37.0 37.0 37.0 37.0 65-69 35.7519 37.0 37.0 37.0 37.0 37.0 70-74 35.7346 37.0 37.0 37.0 37.0 37.0 75-79 35.6261 37.0 37.0 37.0 37.0 37.0 80-84 35.6592 37.0 37.0 37.0 37.0 37.0 85-89 35.5918 37.0 37.0 37.0 37.0 37.0 90-94 35.5599 37.0 37.0 37.0 37.0 37.0 95-99 35.577299999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.5198 37.0 37.0 37.0 37.0 37.0 105-109 35.4613 37.0 37.0 37.0 37.0 37.0 110-114 35.3741 37.0 37.0 37.0 37.0 37.0 115-119 35.392700000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.409499999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.305400000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.2574 37.0 37.0 37.0 32.2 37.0 135-139 35.2843 37.0 37.0 37.0 34.6 37.0 140-144 34.972300000000004 37.0 37.0 37.0 25.0 37.0 145-149 35.0751 37.0 37.0 37.0 27.4 37.0 150-151 34.644000000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 3.0 22 7.0 23 7.0 24 10.0 25 11.0 26 12.0 27 10.0 28 29.0 29 48.0 30 41.0 31 50.0 32 97.0 33 137.0 34 243.0 35 675.0 36 2450.0 37 167.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.3 18.775 10.925 32.0 2 22.45 24.15 36.25 17.150000000000002 3 19.075 27.650000000000002 32.025 21.25 4 22.375 36.225 22.8 18.6 5 23.95 37.925 21.6 16.525000000000002 6 18.275 39.300000000000004 22.35 20.075000000000003 7 16.675 17.575 43.675000000000004 22.075 8 19.55 22.225 29.275000000000002 28.95 9 20.775 22.525000000000002 30.175 26.525 10-14 23.175 28.22 26.71 21.895 15-19 22.18 27.584999999999997 28.26 21.975 20-24 22.475 28.084999999999997 28.13 21.310000000000002 25-29 22.285 28.1 28.22 21.395 30-34 22.509999999999998 27.495000000000005 28.32 21.675 35-39 22.41 28.144999999999996 28.17 21.275 40-44 22.1 28.37 27.99 21.54 45-49 22.14 28.244999999999997 28.28 21.335 50-54 22.41 28.055000000000003 28.025 21.51 55-59 22.295 27.415 28.565 21.725 60-64 22.67 27.224999999999998 28.139999999999997 21.965 65-69 22.6 27.91 27.525 21.965 70-74 22.93 27.93 27.57 21.57 75-79 22.725 28.27 27.400000000000002 21.605 80-84 22.75 27.855 27.35 22.045 85-89 23.375 27.625 27.685 21.315 90-94 22.925 28.205000000000002 27.47 21.4 95-99 22.86 27.084999999999997 28.439999999999998 21.615000000000002 100-104 23.75 27.295 27.36 21.595 105-109 23.085 27.57 28.215 21.13 110-114 23.89 27.415 27.495000000000005 21.2 115-119 24.04 27.584999999999997 27.634999999999998 20.74 120-124 23.825 27.21 27.900000000000002 21.065 125-129 24.279999999999998 28.03 27.615000000000002 20.075000000000003 130-134 24.19 27.315 27.560000000000002 20.935000000000002 135-139 24.884999999999998 27.63 27.27 20.215 140-144 25.14 27.47 27.245 20.145 145-149 25.105 28.225 26.735 19.935 150-151 26.3125 27.4125 26.2875 19.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 2.5 22 3.0 23 2.0 24 2.5 25 2.5 26 2.5 27 6.0 28 8.0 29 10.0 30 21.0 31 26.5 32 32.0 33 36.0 34 44.5 35 70.5 36 86.5 37 96.5 38 125.5 39 171.0 40 197.0 41 208.0 42 232.0 43 256.5 44 277.5 45 281.5 46 261.0 47 243.5 48 217.0 49 193.0 50 170.5 51 153.5 52 123.0 53 93.5 54 88.0 55 67.0 56 42.5 57 28.5 58 26.0 59 21.0 60 18.0 61 13.0 62 10.0 63 8.5 64 3.5 65 1.5 66 1.5 67 1.0 68 2.5 69 2.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 94.09417398244214 88.425 2 5.506783719074222 10.35 3 0.3192338387869114 0.8999999999999999 4 0.053205639797818574 0.2 5 0.026602819898909287 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.2625000000000002 0.0 0.0 0.0 0.0 106-107 1.6124999999999998 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.65 0.0 0.0 0.0 0.0 120-121 4.0375 0.0 0.0 0.0 0.0 122-123 4.4625 0.0 0.0 0.0 0.0 124-125 5.125 0.0 0.0 0.0 0.0 126-127 5.6125 0.0 0.0 0.0 0.0 128-129 6.3375 0.0 0.0 0.0 0.0 130-131 6.8375 0.0 0.0 0.0 0.0 132-133 7.512499999999999 0.0 0.0 0.0 0.0 134-135 8.0125 0.0 0.0 0.0 0.0 136-137 8.525 0.0 0.0 0.0 0.0 138-139 9.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852486 spots for SRR12671661.sra Written 852486 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra Read 852479 spots for SRR12671661.sra Written 852479 spots for SRR12671661.sra SRR ids: ['SRR12671661.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7etw3qc3 SRR12671661.sra spots: 17049587 blocks: [[1, 852479], [852480, 1704958], [1704959, 2557437], [2557438, 3409916], [3409917, 4262395], [4262396, 5114874], [5114875, 5967353], [5967354, 6819832], [6819833, 7672311], [7672312, 8524790], [8524791, 9377269], [9377270, 10229748], [10229749, 11082227], [11082228, 11934706], [11934707, 12787185], [12787186, 13639664], [13639665, 14492143], [14492144, 15344622], [15344623, 16197101], [16197102, 17049587]] SRR12671661 file size 5772495 SRR12671661 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671661 SRR12671661_1.fastq SRR12671661_2.fastq Input file: SRR12671661_1.fastq Paired file: SRR12671661_2.fastq trimmed: SRR12671661-trimmed-pair1.fastq, SRR12671661-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:03:58 2025 >> started Wed Feb 12 01:04:18 2025 >> done (20.164s) 17049587 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 1221 ( 0.01%) empty read pairs filtered out after trimming by size control 17048335 (99.99%) read pairs available; of these: 2298874 (13.48%) trimmed read pairs available after processing 14749461 (86.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 4 0.00% 21 1 0.00% 22 2 0.00% 23 4 0.00% 24 4 0.00% 25 4 0.00% 26 7 0.00% 27 6 0.00% 28 14 0.00% 29 5 0.00% 30 7 0.00% 31 16 0.00% 32 10 0.00% 33 18 0.00% 34 18 0.00% 35 28 0.00% 36 20 0.00% 37 16 0.00% 38 27 0.00% 39 35 0.00% 40 25 0.00% 41 42 0.00% 42 44 0.00% 43 56 0.00% 44 51 0.00% 45 76 0.00% 46 68 0.00% 47 76 0.00% 48 62 0.00% 49 76 0.00% 50 103 0.00% 51 111 0.00% 52 145 0.00% 53 143 0.00% 54 142 0.00% 55 142 0.00% 56 177 0.00% 57 168 0.00% 58 227 0.00% 59 268 0.00% 60 279 0.00% 61 321 0.00% 62 368 0.00% 63 370 0.00% 64 428 0.00% 65 477 0.00% 66 542 0.00% 67 587 0.00% 68 608 0.00% 69 742 0.00% 70 822 0.00% 71 990 0.01% 72 1096 0.01% 73 1360 0.01% 74 1440 0.01% 75 1559 0.01% 76 1846 0.01% 77 1830 0.01% 78 2106 0.01% 79 2417 0.01% 80 2604 0.02% 81 2988 0.02% 82 3378 0.02% 83 3905 0.02% 84 4388 0.03% 85 4854 0.03% 86 5337 0.03% 87 5616 0.03% 88 6197 0.04% 89 6674 0.04% 90 7202 0.04% 91 8236 0.05% 92 9011 0.05% 93 10049 0.06% 94 10769 0.06% 95 11844 0.07% 96 12726 0.07% 97 13397 0.08% 98 14215 0.08% 99 14866 0.09% 100 16245 0.10% 101 17044 0.10% 102 18081 0.11% 103 19400 0.11% 104 20673 0.12% 105 21840 0.13% 106 23009 0.13% 107 23912 0.14% 108 24918 0.15% 109 25641 0.15% 110 26599 0.16% 111 27833 0.16% 112 29085 0.17% 113 30216 0.18% 114 31159 0.18% 115 32872 0.19% 116 34168 0.20% 117 35289 0.21% 118 36295 0.21% 119 36534 0.21% 120 37724 0.22% 121 38820 0.23% 122 39992 0.23% 123 41439 0.24% 124 42424 0.25% 125 43631 0.26% 126 44614 0.26% 127 45325 0.27% 128 46274 0.27% 129 46644 0.27% 130 47327 0.28% 131 47870 0.28% 132 49445 0.29% 133 50684 0.30% 134 51316 0.30% 135 52486 0.31% 136 53097 0.31% 137 53943 0.32% 138 54454 0.32% 139 55309 0.32% 140 54612 0.32% 141 54874 0.32% 142 56481 0.33% 143 56957 0.33% 144 59198 0.35% 145 59756 0.35% 146 60579 0.36% 147 60248 0.35% 148 60855 0.36% 149 60302 0.35% 150 60482 0.35% 151 14749461 86.52% 17048335 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=30 prefix-density=0.49 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=72.23 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=3.2 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=32 prefix-density=0.57 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=50.52 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=2.3 sequence=TGGCTTCCTCTACGCTCTCCCCTGCCACTCCCTCACAGCTATGCTCTAGCAAGAGTGGCATGTTCTCTCCTACACATGCGGTGTTTGTGAAACCAACAAGGACAAATATGGTG SRR12671661 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:05:12 Started mapping on | Feb 12 01:05:12 Finished on | Feb 12 01:06:55 Mapping speed, Million of reads per hour | 595.86 Number of input reads | 17048335 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15942489 Uniquely mapped reads % | 93.51% Average mapped length | 293.93 Number of splices: Total | 15770727 Number of splices: Annotated (sjdb) | 15441423 Number of splices: GT/AG | 15449313 Number of splices: GC/AG | 263172 Number of splices: AT/AC | 9566 Number of splices: Non-canonical | 48676 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382102 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 99545 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.53% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 723744 723744 723744 N_multimapping 382102 382102 382102 N_noFeature 653318 15706446 746857 N_ambiguous 237587 1070 94464 UnstrandedReadsAssigned:15051584 PositiveStrandReadsAssigned:234973 NegativeStrandReadsAssigned:15101168 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671661 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671661-trimmed-pair1.fastq SRR12671661-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,048,335 reads, 15,166,088 reads pseudoaligned [quant] estimated average fragment length: 259.995 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR12671661.ke.tsv 34699 SRR12671661.se.tsv 87100 total ==> SRR12671661.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759 550 20.7523 Potri.005G024800.1.v4.1 1035 776.005 313 26.7701 Potri.004G059700.1.v4.1 961 702.484 7 0.661351 Potri.007G009000.2.v4.1 1416 1157 0 0 Potri.003G141000.2.v4.1 2943 2684 816.3 20.1854 Potri.016G087400.1.v4.1 270 91.5695 669 484.892 Potri.015G069301.1.v4.1 564 327.59 0 0 Potri.010G195200.1.v4.1 1773 1514 40 1.75349 Potri.012G127500.1.v4.1 977 718.232 66 6.09887 ==> SRR12671661.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 225 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 183 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR12671661 completed mapping pipeline successfully