Starting /dee2/code/volunteer_pipeline.sh SRR12671662 current disk space = 3051182903296 free memory = 1501096704 SRR12671662 SRAfilesize 096294c5807ce5347c947da3308e42d8 SRR12671662.sra SRR12671662.sra file validated SRR12671662 is paired end SRR12671662 is conventional basespace SRR12671662 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671662_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.448 37.0 37.0 37.0 37.0 37.0 2 36.31 37.0 37.0 37.0 37.0 37.0 3 36.52 37.0 37.0 37.0 37.0 37.0 4 36.516 37.0 37.0 37.0 37.0 37.0 5 36.584 37.0 37.0 37.0 37.0 37.0 6 36.5915 37.0 37.0 37.0 37.0 37.0 7 36.498 37.0 37.0 37.0 37.0 37.0 8 36.549 37.0 37.0 37.0 37.0 37.0 9 36.496 37.0 37.0 37.0 37.0 37.0 10-14 36.5247 37.0 37.0 37.0 37.0 37.0 15-19 36.496 37.0 37.0 37.0 37.0 37.0 20-24 36.47610000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.4514 37.0 37.0 37.0 37.0 37.0 30-34 36.419799999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4125 37.0 37.0 37.0 37.0 37.0 40-44 36.432900000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.39 37.0 37.0 37.0 37.0 37.0 50-54 36.3574 37.0 37.0 37.0 37.0 37.0 55-59 36.37370000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.33 37.0 37.0 37.0 37.0 37.0 65-69 36.3136 37.0 37.0 37.0 37.0 37.0 70-74 36.3202 37.0 37.0 37.0 37.0 37.0 75-79 36.2489 37.0 37.0 37.0 37.0 37.0 80-84 36.2861 37.0 37.0 37.0 37.0 37.0 85-89 36.2781 37.0 37.0 37.0 37.0 37.0 90-94 36.2186 37.0 37.0 37.0 37.0 37.0 95-99 36.144999999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2309 37.0 37.0 37.0 37.0 37.0 105-109 36.1168 37.0 37.0 37.0 37.0 37.0 110-114 36.1985 37.0 37.0 37.0 37.0 37.0 115-119 36.1631 37.0 37.0 37.0 37.0 37.0 120-124 36.0475 37.0 37.0 37.0 37.0 37.0 125-129 36.028499999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.98069999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.9339 37.0 37.0 37.0 37.0 37.0 140-144 35.8726 37.0 37.0 37.0 37.0 37.0 145-149 35.8202 37.0 37.0 37.0 37.0 37.0 150-151 35.42475 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 1.0 25 3.0 26 4.0 27 9.0 28 13.0 29 20.0 30 23.0 31 43.0 32 41.0 33 77.0 34 103.0 35 307.0 36 3001.0 37 354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.625 14.05 10.174999999999999 46.150000000000006 2 17.81062124248497 20.465931863727455 40.556112224448896 21.16733466933868 3 17.325 25.650000000000002 27.3 29.725 4 22.425 33.025 21.825 22.725 5 21.975 36.375 23.150000000000002 18.5 6 17.7 36.675000000000004 25.5 20.125 7 14.95 21.099999999999998 44.875 19.075 8 18.05 22.125 30.9 28.925 9 17.150000000000002 23.150000000000002 32.65 27.05 10-14 20.04 29.555 26.490000000000002 23.915 15-19 20.485 28.17 27.47 23.875 20-24 20.125 28.205000000000002 27.839999999999996 23.830000000000002 25-29 19.955000000000002 28.71 27.245 24.09 30-34 19.63 28.139999999999997 27.24 24.990000000000002 35-39 20.59 28.804999999999996 27.389999999999997 23.215 40-44 20.185 28.999999999999996 27.43 23.385 45-49 20.0 28.205000000000002 27.750000000000004 24.044999999999998 50-54 20.5 28.494999999999997 27.345000000000002 23.66 55-59 20.5 28.804999999999996 27.29 23.405 60-64 20.74 27.71 27.215 24.335 65-69 20.085 28.610000000000003 27.575 23.73 70-74 20.45 28.455000000000002 27.060000000000002 24.035 75-79 20.01 28.244999999999997 27.625 24.12 80-84 20.945 28.125 27.325 23.605 85-89 20.89 27.91 27.455000000000002 23.745 90-94 20.355 27.495000000000005 28.355000000000004 23.794999999999998 95-99 20.595 27.97 27.245 24.19 100-104 21.08 27.755000000000003 27.595 23.57 105-109 21.18 27.46 27.265 24.095 110-114 20.78 28.04 27.13 24.05 115-119 20.905 28.68 27.22 23.195 120-124 21.15 27.750000000000004 27.650000000000002 23.45 125-129 21.61 27.295 27.37 23.724999999999998 130-134 21.115000000000002 28.42 26.790000000000003 23.674999999999997 135-139 21.995 28.04 26.82 23.145 140-144 21.035 27.825 26.83 24.310000000000002 145-149 21.455 27.74 26.795 24.01 150-151 21.675 27.8125 26.950000000000003 23.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 2.0 25 1.0 26 5.5 27 9.5 28 9.5 29 11.5 30 16.0 31 20.5 32 28.5 33 38.0 34 55.5 35 75.5 36 91.5 37 117.5 38 127.0 39 160.0 40 193.0 41 195.0 42 235.5 43 247.5 44 244.5 45 261.0 46 251.5 47 235.0 48 234.5 49 215.5 50 187.5 51 164.5 52 128.5 53 100.5 54 77.5 55 68.5 56 58.0 57 39.5 58 24.0 59 19.0 60 18.0 61 9.5 62 9.0 63 8.0 64 1.5 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.75 #Duplication Level Percentage of deduplicated Percentage of total 1 94.10666666666667 88.225 2 5.28 9.9 3 0.48 1.35 4 0.10666666666666667 0.4 5 0.02666666666666667 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.4500000000000002 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 1.8 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.2 0.0 0.0 0.0 0.0 126-127 2.5999999999999996 0.0 0.0 0.0 0.0 128-129 2.8625 0.0 0.0 0.0 0.0 130-131 3.1625 0.0 0.0 0.0 0.0 132-133 3.3875 0.0 0.0 0.0 0.0 134-135 3.675 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138-139 4.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACCACC 10 0.006830828 145.0 145 >>END_MODULE SRR12671662 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671662_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.297 37.0 37.0 37.0 37.0 37.0 2 36.1505 37.0 37.0 37.0 37.0 37.0 3 36.324 37.0 37.0 37.0 37.0 37.0 4 36.306 37.0 37.0 37.0 37.0 37.0 5 36.3185 37.0 37.0 37.0 37.0 37.0 6 36.2695 37.0 37.0 37.0 37.0 37.0 7 36.279 37.0 37.0 37.0 37.0 37.0 8 36.417 37.0 37.0 37.0 37.0 37.0 9 36.325 37.0 37.0 37.0 37.0 37.0 10-14 36.40749999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.335499999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.314 37.0 37.0 37.0 37.0 37.0 25-29 36.3028 37.0 37.0 37.0 37.0 37.0 30-34 36.308899999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.2536 37.0 37.0 37.0 37.0 37.0 40-44 36.2569 37.0 37.0 37.0 37.0 37.0 45-49 36.2622 37.0 37.0 37.0 37.0 37.0 50-54 36.1998 37.0 37.0 37.0 37.0 37.0 55-59 36.163500000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.123200000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.1387 37.0 37.0 37.0 37.0 37.0 70-74 36.091899999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.0538 37.0 37.0 37.0 37.0 37.0 80-84 36.0739 37.0 37.0 37.0 37.0 37.0 85-89 36.0403 37.0 37.0 37.0 37.0 37.0 90-94 35.9546 37.0 37.0 37.0 37.0 37.0 95-99 36.0606 37.0 37.0 37.0 37.0 37.0 100-104 35.9562 37.0 37.0 37.0 37.0 37.0 105-109 35.8865 37.0 37.0 37.0 37.0 37.0 110-114 35.896300000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.9208 37.0 37.0 37.0 37.0 37.0 120-124 35.8255 37.0 37.0 37.0 37.0 37.0 125-129 35.7847 37.0 37.0 37.0 37.0 37.0 130-134 35.793899999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.77720000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.536300000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.6502 37.0 37.0 37.0 37.0 37.0 150-151 35.172250000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 2.0 22 2.0 23 3.0 24 4.0 25 5.0 26 10.0 27 9.0 28 7.0 29 10.0 30 18.0 31 49.0 32 55.0 33 88.0 34 158.0 35 474.0 36 2846.0 37 256.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.375 18.475 14.075 34.075 2 22.725 24.325 37.125 15.825 3 21.0 26.85 30.375000000000004 21.775 4 22.900000000000002 35.699999999999996 21.9 19.5 5 24.575 36.775000000000006 21.349999999999998 17.299999999999997 6 18.05 38.475 24.224999999999998 19.25 7 18.15 18.05 42.075 21.725 8 19.75 22.400000000000002 29.625 28.225 9 20.575 24.85 29.549999999999997 25.025 10-14 22.46 28.77 26.405 22.365 15-19 22.78 27.47 27.389999999999997 22.36 20-24 22.49 28.465 27.71 21.335 25-29 22.395 28.185 27.67 21.75 30-34 22.555 27.96 27.85 21.634999999999998 35-39 22.29 27.935 27.655 22.12 40-44 22.81 27.735 27.37 22.085 45-49 22.655 28.21 27.694999999999997 21.44 50-54 22.45 28.265 27.139999999999997 22.145 55-59 22.945 27.12 28.005000000000003 21.93 60-64 22.735 27.815 27.195000000000004 22.255 65-69 23.189999999999998 27.060000000000002 27.944999999999997 21.805 70-74 23.74 27.575 26.484999999999996 22.2 75-79 23.06 27.889999999999997 27.185 21.865000000000002 80-84 23.64 28.025 26.495 21.84 85-89 23.155 27.595 27.365000000000002 21.884999999999998 90-94 23.135 27.51 27.525 21.83 95-99 23.49 27.339999999999996 27.215 21.955 100-104 23.485 27.295 27.27 21.95 105-109 23.235 27.855 27.450000000000003 21.46 110-114 23.995 27.894999999999996 27.21 20.9 115-119 23.695 27.575 27.51 21.22 120-124 24.13 27.800000000000004 27.165 20.905 125-129 24.099999999999998 27.72 26.87 21.310000000000002 130-134 23.955000000000002 27.51 26.965 21.57 135-139 24.425 27.700000000000003 26.52 21.355 140-144 24.29 27.67 27.32 20.72 145-149 25.064999999999998 27.750000000000004 26.064999999999998 21.12 150-151 24.9125 27.237499999999997 27.150000000000002 20.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 1.0 26 3.0 27 3.5 28 3.0 29 4.5 30 8.0 31 11.5 32 20.5 33 30.0 34 34.0 35 60.5 36 89.0 37 93.0 38 108.0 39 141.5 40 184.0 41 212.5 42 233.0 43 253.5 44 285.5 45 301.0 46 283.0 47 255.0 48 221.0 49 216.5 50 191.5 51 145.5 52 120.5 53 101.0 54 88.0 55 72.0 56 50.0 57 41.5 58 33.0 59 24.5 60 22.0 61 17.5 62 10.0 63 3.0 64 4.5 65 3.5 66 0.5 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 94.01069518716577 87.9 2 5.347593582887701 10.0 3 0.45454545454545453 1.275 4 0.10695187165775401 0.4 5 0.053475935828877004 0.25 6 0.0 0.0 7 0.026737967914438502 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit AACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.4500000000000002 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 1.8 0.0 0.0 0.0 0.0 122-123 2.025 0.0 0.0 0.0 0.0 124-125 2.175 0.0 0.0 0.0 0.0 126-127 2.575 0.0 0.0 0.0 0.0 128-129 2.8625 0.0 0.0 0.0 0.0 130-131 3.1625 0.0 0.0 0.0 0.0 132-133 3.4 0.0 0.0 0.0 0.0 134-135 3.7249999999999996 0.0 0.0 0.0 0.0 136-137 3.9625 0.0 0.0 0.0 0.0 138-139 4.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAATGAC 10 0.006830828 145.0 4 >>END_MODULE Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815520 spots for SRR12671662.sra Written 815520 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra Read 815510 spots for SRR12671662.sra Written 815510 spots for SRR12671662.sra SRR ids: ['SRR12671662.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cylw3cvi SRR12671662.sra spots: 16310210 blocks: [[1, 815510], [815511, 1631020], [1631021, 2446530], [2446531, 3262040], [3262041, 4077550], [4077551, 4893060], [4893061, 5708570], [5708571, 6524080], [6524081, 7339590], [7339591, 8155100], [8155101, 8970610], [8970611, 9786120], [9786121, 10601630], [10601631, 11417140], [11417141, 12232650], [12232651, 13048160], [13048161, 13863670], [13863671, 14679180], [14679181, 15494690], [15494691, 16310210]] SRR12671662 file size 5521222 SRR12671662 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671662 SRR12671662_1.fastq SRR12671662_2.fastq Input file: SRR12671662_1.fastq Paired file: SRR12671662_2.fastq trimmed: SRR12671662-trimmed-pair1.fastq, SRR12671662-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:05:12 2025 >> started Wed Feb 12 01:05:35 2025 >> done (22.271s) 16310210 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 1147 ( 0.01%) empty read pairs filtered out after trimming by size control 16309047 (99.99%) read pairs available; of these: 1065204 ( 6.53%) trimmed read pairs available after processing 15243843 (93.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 0 0.00% 25 2 0.00% 26 9 0.00% 27 2 0.00% 28 2 0.00% 29 3 0.00% 30 6 0.00% 31 8 0.00% 32 5 0.00% 33 7 0.00% 34 5 0.00% 35 5 0.00% 36 5 0.00% 37 5 0.00% 38 10 0.00% 39 9 0.00% 40 10 0.00% 41 17 0.00% 42 8 0.00% 43 24 0.00% 44 18 0.00% 45 15 0.00% 46 15 0.00% 47 24 0.00% 48 31 0.00% 49 32 0.00% 50 35 0.00% 51 44 0.00% 52 58 0.00% 53 47 0.00% 54 77 0.00% 55 61 0.00% 56 70 0.00% 57 73 0.00% 58 100 0.00% 59 88 0.00% 60 103 0.00% 61 127 0.00% 62 142 0.00% 63 164 0.00% 64 164 0.00% 65 202 0.00% 66 213 0.00% 67 237 0.00% 68 280 0.00% 69 284 0.00% 70 343 0.00% 71 385 0.00% 72 423 0.00% 73 528 0.00% 74 554 0.00% 75 682 0.00% 76 706 0.00% 77 780 0.00% 78 858 0.01% 79 997 0.01% 80 1115 0.01% 81 1227 0.01% 82 1417 0.01% 83 1592 0.01% 84 1812 0.01% 85 1945 0.01% 86 2068 0.01% 87 2205 0.01% 88 2399 0.01% 89 2847 0.02% 90 2992 0.02% 91 3200 0.02% 92 3460 0.02% 93 3800 0.02% 94 4265 0.03% 95 4563 0.03% 96 4653 0.03% 97 5003 0.03% 98 5301 0.03% 99 5494 0.03% 100 5988 0.04% 101 6458 0.04% 102 6669 0.04% 103 7142 0.04% 104 7597 0.05% 105 8186 0.05% 106 8641 0.05% 107 8710 0.05% 108 9176 0.06% 109 9762 0.06% 110 10171 0.06% 111 10773 0.07% 112 11079 0.07% 113 11744 0.07% 114 12325 0.08% 115 12838 0.08% 116 13541 0.08% 117 13788 0.08% 118 14441 0.09% 119 14863 0.09% 120 15477 0.09% 121 15952 0.10% 122 16528 0.10% 123 17424 0.11% 124 18102 0.11% 125 18557 0.11% 126 19166 0.12% 127 19690 0.12% 128 20250 0.12% 129 20800 0.13% 130 21339 0.13% 131 22153 0.14% 132 22814 0.14% 133 24297 0.15% 134 24764 0.15% 135 25608 0.16% 136 25969 0.16% 137 26912 0.17% 138 27238 0.17% 139 28188 0.17% 140 28447 0.17% 141 29140 0.18% 142 30336 0.19% 143 30691 0.19% 144 33570 0.21% 145 33121 0.20% 146 34278 0.21% 147 34153 0.21% 148 35000 0.21% 149 35037 0.21% 150 35845 0.22% 151 15243843 93.47% 16309047 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.86 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=13.21 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.5 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=19 prefix-density=0.83 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=86.97 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.6 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671662 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:06:20 Started mapping on | Feb 12 01:06:20 Finished on | Feb 12 01:08:09 Mapping speed, Million of reads per hour | 538.65 Number of input reads | 16309047 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15336752 Uniquely mapped reads % | 94.04% Average mapped length | 298.06 Number of splices: Total | 15949099 Number of splices: Annotated (sjdb) | 15656400 Number of splices: GT/AG | 15628555 Number of splices: GC/AG | 268067 Number of splices: AT/AC | 9214 Number of splices: Non-canonical | 43263 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414624 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 113535 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.59% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 557671 557671 557671 N_multimapping 414624 414624 414624 N_noFeature 442914 15050991 518315 N_ambiguous 307496 995 96512 UnstrandedReadsAssigned:14586342 PositiveStrandReadsAssigned:284766 NegativeStrandReadsAssigned:14721925 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671662 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671662-trimmed-pair1.fastq SRR12671662-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,309,047 reads, 14,709,475 reads pseudoaligned [quant] estimated average fragment length: 287.369 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR12671662.ke.tsv 34699 SRR12671662.se.tsv 87100 total ==> SRR12671662.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1731.63 633 19.5139 Potri.005G024800.1.v4.1 1035 748.631 224 15.9726 Potri.004G059700.1.v4.1 961 675.053 5 0.395392 Potri.007G009000.2.v4.1 1416 1129.63 0 0 Potri.003G141000.2.v4.1 2943 2656.63 792.486 15.9242 Potri.016G087400.1.v4.1 270 76.3526 754 527.161 Potri.015G069301.1.v4.1 564 298.897 0 0 Potri.010G195200.1.v4.1 1773 1486.63 119 4.27307 Potri.012G127500.1.v4.1 977 690.842 197 15.2224 ==> SRR12671662.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 165 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 301 Potri.001G212900.v4.1 248 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12671662 completed mapping pipeline successfully