Starting /dee2/code/volunteer_pipeline.sh SRR12671663 current disk space = 3050859425792 free memory = 1579765368 SRR12671663 SRAfilesize f35e708fff849199dbe053d2e0bb98aa SRR12671663.sra SRR12671663.sra file validated SRR12671663 is paired end SRR12671663 is conventional basespace SRR12671663 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671663_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3175 37.0 37.0 37.0 37.0 37.0 2 36.2895 37.0 37.0 37.0 37.0 37.0 3 36.5445 37.0 37.0 37.0 37.0 37.0 4 36.562 37.0 37.0 37.0 37.0 37.0 5 36.4495 37.0 37.0 37.0 37.0 37.0 6 36.4785 37.0 37.0 37.0 37.0 37.0 7 36.4885 37.0 37.0 37.0 37.0 37.0 8 36.4845 37.0 37.0 37.0 37.0 37.0 9 36.535 37.0 37.0 37.0 37.0 37.0 10-14 36.5811 37.0 37.0 37.0 37.0 37.0 15-19 36.5266 37.0 37.0 37.0 37.0 37.0 20-24 36.495099999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.5236 37.0 37.0 37.0 37.0 37.0 30-34 36.4821 37.0 37.0 37.0 37.0 37.0 35-39 36.4293 37.0 37.0 37.0 37.0 37.0 40-44 36.396699999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.38629999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.438900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.36749999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.375800000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3656 37.0 37.0 37.0 37.0 37.0 70-74 36.3267 37.0 37.0 37.0 37.0 37.0 75-79 36.3388 37.0 37.0 37.0 37.0 37.0 80-84 36.304899999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.2581 37.0 37.0 37.0 37.0 37.0 90-94 36.2779 37.0 37.0 37.0 37.0 37.0 95-99 36.16369999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.269 37.0 37.0 37.0 37.0 37.0 105-109 36.141999999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1161 37.0 37.0 37.0 37.0 37.0 115-119 36.108799999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.0271 37.0 37.0 37.0 37.0 37.0 125-129 36.0457 37.0 37.0 37.0 37.0 37.0 130-134 35.9559 37.0 37.0 37.0 37.0 37.0 135-139 35.948 37.0 37.0 37.0 37.0 37.0 140-144 35.88 37.0 37.0 37.0 37.0 37.0 145-149 35.827400000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.49075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 3.0 26 4.0 27 5.0 28 14.0 29 16.0 30 15.0 31 34.0 32 51.0 33 70.0 34 141.0 35 317.0 36 2974.0 37 355.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.1 16.5 12.950000000000001 38.45 2 21.36409227683049 21.99097291875627 35.95787362086259 20.68706118355065 3 17.775 27.525 28.799999999999997 25.900000000000002 4 22.175 33.900000000000006 23.3 20.625 5 20.625 37.125 24.2 18.05 6 18.15 36.1 25.224999999999998 20.525 7 13.15 22.0 44.925 19.925 8 18.575 23.75 28.549999999999997 29.125 9 17.05 22.7 32.725 27.525 10-14 20.36 28.854999999999997 26.655 24.13 15-19 19.855 28.505000000000003 27.345000000000002 24.295 20-24 19.77 29.110000000000003 27.715 23.405 25-29 19.89 28.425 27.725 23.96 30-34 19.91 28.854999999999997 27.525 23.71 35-39 20.51 28.09 27.195000000000004 24.205 40-44 20.01 28.575 27.439999999999998 23.974999999999998 45-49 20.294999999999998 28.48 26.935 24.29 50-54 20.810000000000002 27.77 27.500000000000004 23.919999999999998 55-59 20.39 27.67 27.900000000000002 24.04 60-64 20.64 28.04 27.250000000000004 24.07 65-69 20.105 28.305000000000003 27.560000000000002 24.03 70-74 20.580000000000002 28.285 27.55 23.585 75-79 20.365 27.955000000000002 27.1 24.58 80-84 20.599999999999998 28.035 27.544999999999998 23.82 85-89 21.065 28.27 26.88 23.785 90-94 20.54 28.299999999999997 27.084999999999997 24.075 95-99 20.974999999999998 27.445000000000004 27.375 24.205 100-104 20.635 28.000000000000004 27.3 24.065 105-109 20.135 28.244999999999997 27.229999999999997 24.39 110-114 21.145 27.584999999999997 27.24 24.03 115-119 20.810000000000002 28.375 27.41 23.405 120-124 21.235 28.32 26.695 23.75 125-129 21.61 27.47 27.22 23.7 130-134 21.09 27.175 27.35 24.385 135-139 21.060000000000002 27.01 27.675 24.255 140-144 21.295 27.500000000000004 27.065 24.14 145-149 20.735 28.325 26.91 24.03 150-151 21.175 27.3125 26.737499999999997 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 2.0 24 5.5 25 6.5 26 6.0 27 5.5 28 5.0 29 8.5 30 13.5 31 22.5 32 32.5 33 41.5 34 49.0 35 66.0 36 86.0 37 99.0 38 125.0 39 147.0 40 182.0 41 222.0 42 251.5 43 265.0 44 257.0 45 244.0 46 247.0 47 257.0 48 245.5 49 212.0 50 182.0 51 156.0 52 123.5 53 101.0 54 78.0 55 60.5 56 53.0 57 44.0 58 30.5 59 22.0 60 13.0 61 8.0 62 7.0 63 5.5 64 2.5 65 0.0 66 0.0 67 0.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.23485653560041 88.675 2 5.340063761955367 10.05 3 0.34537725823591925 0.975 4 0.07970244420828905 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.1124999999999998 0.0 0.0 0.0 0.0 118-119 1.2625 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.4375 0.0 0.0 0.0 0.0 130-131 2.7125 0.0 0.0 0.0 0.0 132-133 2.8625 0.0 0.0 0.0 0.0 134-135 3.0125 0.0 0.0 0.0 0.0 136-137 3.3625 0.0 0.0 0.0 0.0 138-139 3.7875 0.0125 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671663 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671663_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.23 37.0 37.0 37.0 37.0 37.0 2 36.0925 37.0 37.0 37.0 37.0 37.0 3 36.129 37.0 37.0 37.0 37.0 37.0 4 36.0965 37.0 37.0 37.0 37.0 37.0 5 36.2265 37.0 37.0 37.0 37.0 37.0 6 36.24 37.0 37.0 37.0 37.0 37.0 7 36.1635 37.0 37.0 37.0 37.0 37.0 8 36.2325 37.0 37.0 37.0 37.0 37.0 9 36.293 37.0 37.0 37.0 37.0 37.0 10-14 36.275999999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2581 37.0 37.0 37.0 37.0 37.0 20-24 36.2488 37.0 37.0 37.0 37.0 37.0 25-29 36.1512 37.0 37.0 37.0 37.0 37.0 30-34 36.156400000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.1657 37.0 37.0 37.0 37.0 37.0 40-44 36.0856 37.0 37.0 37.0 37.0 37.0 45-49 36.1237 37.0 37.0 37.0 37.0 37.0 50-54 36.0676 37.0 37.0 37.0 37.0 37.0 55-59 36.0753 37.0 37.0 37.0 37.0 37.0 60-64 36.004200000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.951100000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.9584 37.0 37.0 37.0 37.0 37.0 75-79 35.868 37.0 37.0 37.0 37.0 37.0 80-84 35.931400000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.8613 37.0 37.0 37.0 37.0 37.0 90-94 35.8635 37.0 37.0 37.0 37.0 37.0 95-99 35.8763 37.0 37.0 37.0 37.0 37.0 100-104 35.779 37.0 37.0 37.0 37.0 37.0 105-109 35.7516 37.0 37.0 37.0 37.0 37.0 110-114 35.7128 37.0 37.0 37.0 37.0 37.0 115-119 35.6854 37.0 37.0 37.0 37.0 37.0 120-124 35.6809 37.0 37.0 37.0 37.0 37.0 125-129 35.6052 37.0 37.0 37.0 37.0 37.0 130-134 35.6102 37.0 37.0 37.0 37.0 37.0 135-139 35.545500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.4086 37.0 37.0 37.0 34.6 37.0 145-149 35.435300000000005 37.0 37.0 37.0 34.6 37.0 150-151 35.039249999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 3.0 16 0.0 17 1.0 18 0.0 19 0.0 20 3.0 21 0.0 22 2.0 23 4.0 24 6.0 25 9.0 26 10.0 27 11.0 28 14.0 29 27.0 30 30.0 31 39.0 32 52.0 33 92.0 34 178.0 35 582.0 36 2695.0 37 237.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.199999999999996 18.3 15.8 30.7 2 25.8 23.525 32.725 17.95 3 19.45 28.749999999999996 33.275 18.525 4 21.6 36.55 22.1 19.75 5 23.95 37.25 20.575 18.224999999999998 6 21.099999999999998 36.725 23.025000000000002 19.15 7 17.549999999999997 18.275 41.75 22.425 8 21.575 24.175 26.0 28.249999999999996 9 20.925 25.650000000000002 27.675 25.75 10-14 22.195 28.849999999999998 26.3 22.655 15-19 22.66 27.775 27.384999999999998 22.18 20-24 22.575 27.839999999999996 27.625 21.959999999999997 25-29 22.175 28.075 27.76 21.990000000000002 30-34 22.93 27.389999999999997 27.88 21.8 35-39 22.755 27.43 27.71 22.105 40-44 22.86 28.18 27.55 21.41 45-49 23.23 28.305000000000003 26.724999999999998 21.740000000000002 50-54 22.81 27.355 27.955000000000002 21.88 55-59 23.369999999999997 27.465 27.235 21.93 60-64 22.845 27.584999999999997 27.735 21.834999999999997 65-69 23.61 27.395000000000003 27.015 21.98 70-74 23.335 28.095 26.325 22.245 75-79 23.27 27.115000000000002 27.68 21.935 80-84 23.72 28.01 26.44 21.83 85-89 23.9 27.595 27.125 21.38 90-94 23.380000000000003 27.139999999999997 27.415 22.065 95-99 23.225 27.175 27.825 21.775 100-104 23.305 27.634999999999998 27.01 22.05 105-109 22.759999999999998 27.589999999999996 27.79 21.86 110-114 23.66 28.249999999999996 26.87 21.22 115-119 23.865 27.965 26.515 21.654999999999998 120-124 23.810000000000002 28.060000000000002 26.474999999999998 21.654999999999998 125-129 24.175 27.74 27.075 21.01 130-134 24.725 27.18 27.38 20.715 135-139 24.235 27.474999999999998 27.084999999999997 21.205 140-144 24.709999999999997 26.93 26.755000000000003 21.605 145-149 24.75 28.34 26.045 20.865000000000002 150-151 24.6125 26.387500000000003 27.462500000000002 21.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 2.0 17 1.5 18 0.5 19 0.5 20 0.5 21 1.0 22 2.0 23 2.0 24 1.0 25 2.0 26 1.5 27 1.0 28 3.0 29 5.5 30 10.0 31 14.5 32 15.5 33 21.5 34 36.5 35 56.0 36 74.0 37 100.0 38 118.0 39 144.0 40 189.0 41 222.5 42 228.5 43 250.0 44 268.0 45 278.0 46 285.5 47 262.5 48 232.0 49 205.0 50 180.0 51 140.5 52 117.0 53 111.0 54 103.5 55 73.5 56 50.5 57 47.5 58 39.0 59 28.0 60 21.0 61 14.5 62 10.5 63 7.0 64 2.5 65 2.0 66 2.0 67 3.5 68 2.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 0.5 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.85 #Duplication Level Percentage of deduplicated Percentage of total 1 94.03303143313798 88.25 2 5.460841768779968 10.25 3 0.45285029302077784 1.275 4 0.02663825253063399 0.1 5 0.02663825253063399 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.1375000000000002 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.45 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 1.95 0.0 0.0 0.0 0.0 126-127 2.175 0.0 0.0 0.0 0.0 128-129 2.4625 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 2.8875 0.0 0.0 0.0 0.0 134-135 3.0375 0.0 0.0 0.0 0.0 136-137 3.3875 0.0 0.0 0.0 0.0 138-139 3.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853729 spots for SRR12671663.sra Written 853729 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra Read 853725 spots for SRR12671663.sra Written 853725 spots for SRR12671663.sra SRR ids: ['SRR12671663.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cx7n2ov6 SRR12671663.sra spots: 17074504 blocks: [[1, 853725], [853726, 1707450], [1707451, 2561175], [2561176, 3414900], [3414901, 4268625], [4268626, 5122350], [5122351, 5976075], [5976076, 6829800], [6829801, 7683525], [7683526, 8537250], [8537251, 9390975], [9390976, 10244700], [10244701, 11098425], [11098426, 11952150], [11952151, 12805875], [12805876, 13659600], [13659601, 14513325], [14513326, 15367050], [15367051, 16220775], [16220776, 17074504]] SRR12671663 file size 5780963 SRR12671663 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671663 SRR12671663_1.fastq SRR12671663_2.fastq Input file: SRR12671663_1.fastq Paired file: SRR12671663_2.fastq trimmed: SRR12671663-trimmed-pair1.fastq, SRR12671663-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:50:48 2025 >> started Wed Feb 12 01:51:07 2025 >> done (19.716s) 17074504 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 5214 ( 0.03%) empty read pairs filtered out after trimming by size control 17069275 (99.97%) read pairs available; of these: 968684 ( 5.68%) trimmed read pairs available after processing 16100591 (94.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 4 0.00% 25 1 0.00% 26 4 0.00% 27 5 0.00% 28 5 0.00% 29 6 0.00% 30 8 0.00% 31 6 0.00% 32 10 0.00% 33 4 0.00% 34 10 0.00% 35 7 0.00% 36 9 0.00% 37 14 0.00% 38 19 0.00% 39 15 0.00% 40 23 0.00% 41 24 0.00% 42 16 0.00% 43 20 0.00% 44 21 0.00% 45 19 0.00% 46 33 0.00% 47 24 0.00% 48 32 0.00% 49 38 0.00% 50 33 0.00% 51 46 0.00% 52 75 0.00% 53 47 0.00% 54 64 0.00% 55 77 0.00% 56 68 0.00% 57 68 0.00% 58 99 0.00% 59 105 0.00% 60 118 0.00% 61 132 0.00% 62 156 0.00% 63 196 0.00% 64 186 0.00% 65 192 0.00% 66 194 0.00% 67 223 0.00% 68 261 0.00% 69 281 0.00% 70 364 0.00% 71 390 0.00% 72 476 0.00% 73 525 0.00% 74 603 0.00% 75 624 0.00% 76 653 0.00% 77 754 0.00% 78 823 0.00% 79 877 0.01% 80 1021 0.01% 81 1140 0.01% 82 1310 0.01% 83 1525 0.01% 84 1632 0.01% 85 1834 0.01% 86 2015 0.01% 87 1964 0.01% 88 2139 0.01% 89 2447 0.01% 90 2642 0.02% 91 2893 0.02% 92 3264 0.02% 93 3647 0.02% 94 3862 0.02% 95 4330 0.03% 96 4420 0.03% 97 4645 0.03% 98 4781 0.03% 99 5067 0.03% 100 5637 0.03% 101 6073 0.04% 102 6578 0.04% 103 6937 0.04% 104 7269 0.04% 105 8014 0.05% 106 8175 0.05% 107 8446 0.05% 108 8695 0.05% 109 9017 0.05% 110 9170 0.05% 111 9720 0.06% 112 10254 0.06% 113 11013 0.06% 114 11630 0.07% 115 12430 0.07% 116 12796 0.07% 117 13082 0.08% 118 13536 0.08% 119 13471 0.08% 120 14053 0.08% 121 14713 0.09% 122 15064 0.09% 123 15974 0.09% 124 16730 0.10% 125 17263 0.10% 126 18210 0.11% 127 18556 0.11% 128 18549 0.11% 129 19037 0.11% 130 18976 0.11% 131 19621 0.11% 132 20599 0.12% 133 21817 0.13% 134 22628 0.13% 135 23268 0.14% 136 24037 0.14% 137 24185 0.14% 138 25039 0.15% 139 25289 0.15% 140 24661 0.14% 141 25562 0.15% 142 26089 0.15% 143 27488 0.16% 144 28851 0.17% 145 30041 0.18% 146 30604 0.18% 147 30838 0.18% 148 31303 0.18% 149 30951 0.18% 150 31068 0.18% 151 16100591 94.32% 17069275 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=31 prefix-density=0.73 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCATGTTGGCTTGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=75.85 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=7.2 sequence=TTCATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCC criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=31 prefix-density=0.97 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=32.29 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.9 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12671663 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:52:00 Started mapping on | Feb 12 01:52:01 Finished on | Feb 12 01:53:42 Mapping speed, Million of reads per hour | 608.41 Number of input reads | 17069275 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16013663 Uniquely mapped reads % | 93.82% Average mapped length | 298.32 Number of splices: Total | 16763759 Number of splices: Annotated (sjdb) | 16471052 Number of splices: GT/AG | 16432830 Number of splices: GC/AG | 282263 Number of splices: AT/AC | 9746 Number of splices: Non-canonical | 38920 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416536 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 87140 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.11% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 639076 639076 639076 N_multimapping 416536 416536 416536 N_noFeature 389127 15774716 462128 N_ambiguous 262060 1233 95360 UnstrandedReadsAssigned:15362476 PositiveStrandReadsAssigned:237714 NegativeStrandReadsAssigned:15456175 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671663 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671663-trimmed-pair1.fastq SRR12671663-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,069,275 reads, 15,511,392 reads pseudoaligned [quant] estimated average fragment length: 304.409 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR12671663.ke.tsv 34699 SRR12671663.se.tsv 87100 total ==> SRR12671663.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1714.59 521 17.525 Potri.005G024800.1.v4.1 1035 731.591 274 21.6004 Potri.004G059700.1.v4.1 961 658.103 9 0.788731 Potri.007G009000.2.v4.1 1416 1112.59 0 0 Potri.003G141000.2.v4.1 2943 2639.59 869.8 19.0048 Potri.016G087400.1.v4.1 270 75.5714 724 552.538 Potri.015G069301.1.v4.1 564 288.683 0 0 Potri.010G195200.1.v4.1 1773 1469.59 50 1.96225 Potri.012G127500.1.v4.1 977 673.874 124 10.6126 ==> SRR12671663.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 440 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 260 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR12671663 completed mapping pipeline successfully