Starting /dee2/code/volunteer_pipeline.sh SRR12671664 current disk space = 3051127382016 free memory = 1506479240 SRR12671664 SRAfilesize 21bb5fd047df27a7b1cbd21007a9faf1 SRR12671664.sra SRR12671664.sra file validated SRR12671664 is paired end SRR12671664 is conventional basespace SRR12671664 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671664_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.341 37.0 37.0 37.0 37.0 37.0 2 36.0425 37.0 37.0 37.0 37.0 37.0 3 36.4175 37.0 37.0 37.0 37.0 37.0 4 36.4 37.0 37.0 37.0 37.0 37.0 5 36.37 37.0 37.0 37.0 37.0 37.0 6 36.4175 37.0 37.0 37.0 37.0 37.0 7 36.4125 37.0 37.0 37.0 37.0 37.0 8 36.539 37.0 37.0 37.0 37.0 37.0 9 36.542 37.0 37.0 37.0 37.0 37.0 10-14 36.4931 37.0 37.0 37.0 37.0 37.0 15-19 36.4868 37.0 37.0 37.0 37.0 37.0 20-24 36.4512 37.0 37.0 37.0 37.0 37.0 25-29 36.4387 37.0 37.0 37.0 37.0 37.0 30-34 36.3867 37.0 37.0 37.0 37.0 37.0 35-39 36.417 37.0 37.0 37.0 37.0 37.0 40-44 36.3783 37.0 37.0 37.0 37.0 37.0 45-49 36.3275 37.0 37.0 37.0 37.0 37.0 50-54 36.3359 37.0 37.0 37.0 37.0 37.0 55-59 36.323899999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.32090000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.3151 37.0 37.0 37.0 37.0 37.0 70-74 36.2722 37.0 37.0 37.0 37.0 37.0 75-79 36.2571 37.0 37.0 37.0 37.0 37.0 80-84 36.1911 37.0 37.0 37.0 37.0 37.0 85-89 36.162800000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.1711 37.0 37.0 37.0 37.0 37.0 95-99 36.132999999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1866 37.0 37.0 37.0 37.0 37.0 105-109 36.0546 37.0 37.0 37.0 37.0 37.0 110-114 36.0155 37.0 37.0 37.0 37.0 37.0 115-119 36.0929 37.0 37.0 37.0 37.0 37.0 120-124 35.9569 37.0 37.0 37.0 37.0 37.0 125-129 35.9991 37.0 37.0 37.0 37.0 37.0 130-134 35.938100000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.921 37.0 37.0 37.0 37.0 37.0 140-144 35.8332 37.0 37.0 37.0 37.0 37.0 145-149 35.7326 37.0 37.0 37.0 37.0 37.0 150-151 35.256 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 2.0 26 0.0 27 7.0 28 9.0 29 27.0 30 27.0 31 42.0 32 58.0 33 81.0 34 143.0 35 342.0 36 2929.0 37 329.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.675 13.950000000000001 12.225 41.15 2 20.737211634904714 20.762286860581742 38.13941825476429 20.36108324974925 3 17.9 26.400000000000002 27.125 28.575 4 21.099999999999998 35.85 21.4 21.65 5 21.15 37.675 23.599999999999998 17.575 6 17.25 36.125 26.35 20.275000000000002 7 13.625000000000002 21.275 45.475 19.625 8 18.6 22.075 29.599999999999998 29.725 9 17.849999999999998 21.95 32.800000000000004 27.400000000000002 10-14 19.41 28.735 27.045 24.81 15-19 20.32 28.335 27.555000000000003 23.79 20-24 20.169999999999998 28.165000000000003 27.72 23.945 25-29 19.98 28.17 27.725 24.125 30-34 20.105 29.104999999999997 27.134999999999998 23.655 35-39 19.78 28.405 27.779999999999998 24.035 40-44 20.48 27.98 27.88 23.66 45-49 20.16 28.715000000000003 27.529999999999998 23.595 50-54 20.205000000000002 28.375 27.900000000000002 23.52 55-59 20.165 27.839999999999996 27.66 24.335 60-64 20.669999999999998 27.860000000000003 27.779999999999998 23.69 65-69 20.135 28.725 27.075 24.065 70-74 20.435 28.599999999999998 27.310000000000002 23.655 75-79 20.200000000000003 28.235 27.675 23.89 80-84 21.195 27.565 27.625 23.615 85-89 20.61 28.199999999999996 27.785 23.405 90-94 20.674999999999997 27.584999999999997 28.115000000000002 23.625 95-99 20.105 27.584999999999997 28.075 24.235 100-104 20.18 28.95 27.265 23.605 105-109 20.630000000000003 28.310000000000002 27.644999999999996 23.415 110-114 21.099999999999998 27.915 27.095000000000002 23.89 115-119 20.630000000000003 28.035 27.66 23.674999999999997 120-124 20.815 27.935 27.805000000000003 23.445 125-129 21.32 27.950000000000003 27.034999999999997 23.695 130-134 21.085 27.584999999999997 27.565 23.765 135-139 20.919999999999998 28.27 27.195000000000004 23.615 140-144 20.965 28.044999999999998 27.075 23.915 145-149 21.21 28.125 27.37 23.294999999999998 150-151 21.837500000000002 28.175 26.437500000000004 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 1.5 23 2.5 24 3.5 25 2.0 26 4.0 27 6.5 28 10.5 29 17.5 30 20.5 31 25.5 32 29.0 33 43.0 34 61.0 35 68.5 36 74.0 37 101.5 38 132.0 39 156.5 40 185.0 41 211.0 42 247.0 43 265.0 44 258.0 45 257.0 46 244.0 47 229.5 48 243.5 49 225.0 50 182.0 51 152.0 52 123.0 53 101.5 54 78.0 55 56.5 56 42.5 57 34.5 58 29.0 59 23.0 60 16.0 61 11.0 62 7.5 63 3.0 64 3.5 65 3.0 66 1.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.61986118526428 87.675 2 6.006406833956221 11.25 3 0.34703683929524826 0.975 4 0.026695141484249865 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.9125000000000001 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.6375 0.0 0.0 0.0 0.0 122-123 1.8624999999999998 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.5625 0.0 0.0 0.0 0.0 130-131 2.7249999999999996 0.0 0.0 0.0 0.0 132-133 3.0125 0.0 0.0 0.0 0.0 134-135 3.3 0.0 0.0 0.0 0.0 136-137 3.75 0.0 0.0 0.0 0.0 138-139 4.175 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGCAT 10 0.006830828 145.0 7 ATCTGCA 20 3.5877043E-4 108.75 6 >>END_MODULE SRR12671664 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671664_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.0445 37.0 37.0 37.0 25.0 37.0 2 34.1625 37.0 37.0 37.0 25.0 37.0 3 34.5975 37.0 37.0 37.0 25.0 37.0 4 34.6545 37.0 37.0 37.0 25.0 37.0 5 34.878 37.0 37.0 37.0 25.0 37.0 6 34.9225 37.0 37.0 37.0 25.0 37.0 7 35.1535 37.0 37.0 37.0 25.0 37.0 8 35.0045 37.0 37.0 37.0 25.0 37.0 9 35.211 37.0 37.0 37.0 25.0 37.0 10-14 35.2133 37.0 37.0 37.0 32.2 37.0 15-19 35.227700000000006 37.0 37.0 37.0 27.4 37.0 20-24 35.23610000000001 37.0 37.0 37.0 32.2 37.0 25-29 35.1428 37.0 37.0 37.0 25.0 37.0 30-34 35.050399999999996 37.0 37.0 37.0 25.0 37.0 35-39 34.9679 37.0 37.0 37.0 25.0 37.0 40-44 34.9758 37.0 37.0 37.0 25.0 37.0 45-49 35.0216 37.0 37.0 37.0 25.0 37.0 50-54 34.8803 37.0 37.0 37.0 25.0 37.0 55-59 34.8232 37.0 37.0 37.0 25.0 37.0 60-64 34.823 37.0 37.0 37.0 25.0 37.0 65-69 34.708600000000004 37.0 37.0 37.0 25.0 37.0 70-74 34.7755 37.0 37.0 37.0 25.0 37.0 75-79 34.6602 37.0 37.0 37.0 25.0 37.0 80-84 34.7093 37.0 37.0 37.0 25.0 37.0 85-89 34.6105 37.0 37.0 37.0 25.0 37.0 90-94 34.54709999999999 37.0 37.0 37.0 25.0 37.0 95-99 34.513299999999994 37.0 37.0 37.0 25.0 37.0 100-104 34.536500000000004 37.0 37.0 37.0 25.0 37.0 105-109 34.447500000000005 37.0 37.0 37.0 25.0 37.0 110-114 34.3084 37.0 37.0 37.0 25.0 37.0 115-119 34.3411 37.0 37.0 37.0 25.0 37.0 120-124 34.261900000000004 37.0 37.0 37.0 25.0 37.0 125-129 34.292899999999996 37.0 37.0 37.0 25.0 37.0 130-134 34.2391 37.0 37.0 37.0 25.0 37.0 135-139 34.177200000000006 37.0 37.0 37.0 25.0 37.0 140-144 33.8769 37.0 37.0 37.0 25.0 37.0 145-149 34.055 37.0 37.0 37.0 25.0 37.0 150-151 33.48825 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 1.0 14 1.0 15 2.0 16 2.0 17 3.0 18 2.0 19 5.0 20 12.0 21 9.0 22 11.0 23 12.0 24 27.0 25 18.0 26 34.0 27 39.0 28 58.0 29 54.0 30 85.0 31 134.0 32 154.0 33 280.0 34 394.0 35 969.0 36 1647.0 37 44.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.975 17.775 15.775 32.475 2 24.8 22.575 35.449999999999996 17.175 3 20.1 26.974999999999998 31.125000000000004 21.8 4 24.099999999999998 33.5 21.55 20.849999999999998 5 24.175 35.949999999999996 22.1 17.775 6 18.875 37.025000000000006 23.45 20.65 7 18.475 16.325 43.75 21.45 8 20.125 22.75 27.6 29.525000000000002 9 21.4 24.125 29.925 24.55 10-14 22.975 28.389999999999997 26.68 21.955 15-19 22.335 28.084999999999997 27.565 22.015 20-24 22.56 28.74 27.525 21.175 25-29 22.485 27.889999999999997 27.839999999999996 21.785 30-34 22.775000000000002 28.15 27.24 21.834999999999997 35-39 22.23 27.944999999999997 27.735 22.09 40-44 22.645 27.805000000000003 27.565 21.985 45-49 22.68 27.500000000000004 27.13 22.689999999999998 50-54 22.37 27.900000000000002 27.245 22.485 55-59 23.285 27.58 27.49 21.645 60-64 22.845 27.12 27.675 22.36 65-69 23.365 27.355 27.389999999999997 21.89 70-74 22.595000000000002 27.700000000000003 27.334999999999997 22.37 75-79 23.419999999999998 27.435 27.43 21.715 80-84 23.189999999999998 27.534999999999997 27.01 22.264999999999997 85-89 23.895 27.35 27.200000000000003 21.555 90-94 23.080000000000002 27.345000000000002 27.384999999999998 22.189999999999998 95-99 23.515 27.534999999999997 27.38 21.57 100-104 23.705000000000002 27.77 26.865 21.66 105-109 23.665 26.905 28.01 21.42 110-114 23.630000000000003 27.91 27.815 20.645 115-119 24.265 27.245 27.139999999999997 21.349999999999998 120-124 24.104999999999997 27.07 27.51 21.315 125-129 24.43 27.944999999999997 26.63 20.995 130-134 24.665 27.32 26.365 21.65 135-139 24.42 27.794999999999998 26.86 20.925 140-144 24.66 28.285 26.16 20.895 145-149 25.345000000000002 27.675 26.529999999999998 20.45 150-151 25.2 27.537499999999998 26.400000000000002 20.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 2.0 26 5.0 27 7.5 28 8.0 29 12.5 30 18.0 31 20.0 32 29.5 33 36.0 34 43.0 35 57.5 36 80.5 37 106.0 38 121.5 39 147.0 40 179.5 41 199.5 42 228.0 43 245.0 44 257.5 45 261.5 46 239.5 47 237.0 48 233.5 49 205.5 50 180.0 51 157.0 52 124.0 53 107.0 54 94.0 55 74.5 56 67.0 57 49.5 58 33.0 59 31.0 60 23.5 61 15.5 62 12.0 63 8.0 64 5.0 65 4.5 66 3.5 67 3.0 68 1.0 69 0.5 70 2.0 71 2.5 72 1.0 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.5 80 1.0 81 1.0 82 0.5 83 1.0 84 1.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.29102496016995 88.775 2 5.337227827934147 10.05 3 0.3186404673393521 0.8999999999999999 4 0.02655337227827934 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02655337227827934 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.9125000000000001 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.8875000000000002 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.5875 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 3.0375 0.0 0.0 0.0 0.0 134-135 3.325 0.0 0.0 0.0 0.0 136-137 3.8 0.0 0.0 0.0 0.0 138-139 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAACTC 10 0.006830828 145.0 3 >>END_MODULE Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra Read 1065147 spots for SRR12671664.sra Written 1065147 spots for SRR12671664.sra Read 1065135 spots for SRR12671664.sra Written 1065135 spots for SRR12671664.sra SRR ids: ['SRR12671664.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2m57zz5q SRR12671664.sra spots: 21302712 blocks: [[1, 1065135], [1065136, 2130270], [2130271, 3195405], [3195406, 4260540], [4260541, 5325675], [5325676, 6390810], [6390811, 7455945], [7455946, 8521080], [8521081, 9586215], [9586216, 10651350], [10651351, 11716485], [11716486, 12781620], [12781621, 13846755], [13846756, 14911890], [14911891, 15977025], [15977026, 17042160], [17042161, 18107295], [18107296, 19172430], [19172431, 20237565], [20237566, 21302712]] SRR12671664 file size 7217893 SRR12671664 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671664 SRR12671664_1.fastq SRR12671664_2.fastq Input file: SRR12671664_1.fastq Paired file: SRR12671664_2.fastq trimmed: SRR12671664-trimmed-pair1.fastq, SRR12671664-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:20:49 2025 >> started Wed Feb 12 01:21:22 2025 >> done (32.359s) 21302712 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 9948 ( 0.05%) empty read pairs filtered out after trimming by size control 21292748 (99.95%) read pairs available; of these: 1346336 ( 6.32%) trimmed read pairs available after processing 19946412 (93.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 2 0.00% 24 5 0.00% 25 0 0.00% 26 7 0.00% 27 5 0.00% 28 5 0.00% 29 6 0.00% 30 8 0.00% 31 7 0.00% 32 10 0.00% 33 13 0.00% 34 11 0.00% 35 15 0.00% 36 22 0.00% 37 14 0.00% 38 29 0.00% 39 27 0.00% 40 29 0.00% 41 23 0.00% 42 36 0.00% 43 34 0.00% 44 36 0.00% 45 28 0.00% 46 41 0.00% 47 29 0.00% 48 44 0.00% 49 58 0.00% 50 52 0.00% 51 59 0.00% 52 56 0.00% 53 74 0.00% 54 74 0.00% 55 63 0.00% 56 72 0.00% 57 96 0.00% 58 124 0.00% 59 119 0.00% 60 142 0.00% 61 167 0.00% 62 184 0.00% 63 220 0.00% 64 247 0.00% 65 262 0.00% 66 251 0.00% 67 285 0.00% 68 313 0.00% 69 347 0.00% 70 421 0.00% 71 455 0.00% 72 506 0.00% 73 651 0.00% 74 680 0.00% 75 751 0.00% 76 856 0.00% 77 949 0.00% 78 981 0.00% 79 1117 0.01% 80 1282 0.01% 81 1457 0.01% 82 1616 0.01% 83 1827 0.01% 84 2048 0.01% 85 2281 0.01% 86 2498 0.01% 87 2719 0.01% 88 2827 0.01% 89 3117 0.01% 90 3533 0.02% 91 3867 0.02% 92 4172 0.02% 93 4706 0.02% 94 5099 0.02% 95 5537 0.03% 96 6060 0.03% 97 6134 0.03% 98 6622 0.03% 99 6897 0.03% 100 7605 0.04% 101 8131 0.04% 102 8565 0.04% 103 9153 0.04% 104 9995 0.05% 105 10299 0.05% 106 11041 0.05% 107 11472 0.05% 108 11735 0.06% 109 12239 0.06% 110 12943 0.06% 111 13342 0.06% 112 14288 0.07% 113 14984 0.07% 114 16382 0.08% 115 16903 0.08% 116 17584 0.08% 117 17963 0.08% 118 18823 0.09% 119 19125 0.09% 120 19640 0.09% 121 20494 0.10% 122 21279 0.10% 123 22649 0.11% 124 23708 0.11% 125 24045 0.11% 126 25098 0.12% 127 25342 0.12% 128 26307 0.12% 129 26791 0.13% 130 27490 0.13% 131 28210 0.13% 132 29373 0.14% 133 30904 0.15% 134 31490 0.15% 135 32376 0.15% 136 33243 0.16% 137 33638 0.16% 138 34808 0.16% 139 35457 0.17% 140 35806 0.17% 141 36300 0.17% 142 37684 0.18% 143 38514 0.18% 144 40264 0.19% 145 41242 0.19% 146 42610 0.20% 147 42602 0.20% 148 43650 0.20% 149 43516 0.20% 150 43811 0.21% 151 19946412 93.68% 21292748 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=30 prefix-density=0.48 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=10.22 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=5.5 sequence=CCATCCACATTAGCACCATATTTGTCGACATATTGGTACAC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=32 prefix-density=0.63 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=33.04 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.9 sequence=TCATCTCTTCAATCGTAAATCACAAATACATACACGTTTACTCATCAGCTCGAAAATGGCAGCAG SRR12671664 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:22:13 Started mapping on | Feb 12 01:22:13 Finished on | Feb 12 01:24:59 Mapping speed, Million of reads per hour | 461.77 Number of input reads | 21292748 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19954307 Uniquely mapped reads % | 93.71% Average mapped length | 297.22 Number of splices: Total | 20473756 Number of splices: Annotated (sjdb) | 20048871 Number of splices: GT/AG | 20071689 Number of splices: GC/AG | 335308 Number of splices: AT/AC | 12605 Number of splices: Non-canonical | 54154 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.03% Deletion average length | 3.05 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 485742 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 76392 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 852699 852699 852699 N_multimapping 485742 485742 485742 N_noFeature 677917 19642223 772442 N_ambiguous 344479 1532 126073 UnstrandedReadsAssigned:18931911 PositiveStrandReadsAssigned:310552 NegativeStrandReadsAssigned:19055792 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671664 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671664-trimmed-pair1.fastq SRR12671664-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,292,748 reads, 19,206,300 reads pseudoaligned [quant] estimated average fragment length: 291.694 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52401 SRR12671664.ke.tsv 34699 SRR12671664.se.tsv 87100 total ==> SRR12671664.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1727.31 928 24.7301 Potri.005G024800.1.v4.1 1035 744.306 271 16.7596 Potri.004G059700.1.v4.1 961 670.445 7 0.480598 Potri.007G009000.2.v4.1 1416 1125.31 0 0 Potri.003G141000.2.v4.1 2943 2652.31 1081.76 18.7738 Potri.016G087400.1.v4.1 270 76.8488 873 522.907 Potri.015G069301.1.v4.1 564 295.699 0 0 Potri.010G195200.1.v4.1 1773 1482.31 57 1.77004 Potri.012G127500.1.v4.1 977 686.364 98 6.57232 ==> SRR12671664.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 227 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 261 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR12671664 completed mapping pipeline successfully