Starting /dee2/code/volunteer_pipeline.sh SRR12671665 current disk space = 2823786233856 free memory = 1571370328 SRR12671665 SRAfilesize 098fdab9b3110f60f4cd38c94a6e43e0 SRR12671665.sra SRR12671665.sra file validated SRR12671665 is paired end SRR12671665 is conventional basespace SRR12671665 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671665_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.433 37.0 37.0 37.0 37.0 37.0 2 36.276 37.0 37.0 37.0 37.0 37.0 3 36.5295 37.0 37.0 37.0 37.0 37.0 4 36.4875 37.0 37.0 37.0 37.0 37.0 5 36.633 37.0 37.0 37.0 37.0 37.0 6 36.532 37.0 37.0 37.0 37.0 37.0 7 36.5665 37.0 37.0 37.0 37.0 37.0 8 36.509 37.0 37.0 37.0 37.0 37.0 9 36.523 37.0 37.0 37.0 37.0 37.0 10-14 36.585300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5433 37.0 37.0 37.0 37.0 37.0 20-24 36.541000000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4602 37.0 37.0 37.0 37.0 37.0 30-34 36.4929 37.0 37.0 37.0 37.0 37.0 35-39 36.4723 37.0 37.0 37.0 37.0 37.0 40-44 36.412499999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.4074 37.0 37.0 37.0 37.0 37.0 50-54 36.383900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.4068 37.0 37.0 37.0 37.0 37.0 60-64 36.368700000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.373599999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3378 37.0 37.0 37.0 37.0 37.0 75-79 36.2663 37.0 37.0 37.0 37.0 37.0 80-84 36.3406 37.0 37.0 37.0 37.0 37.0 85-89 36.3116 37.0 37.0 37.0 37.0 37.0 90-94 36.245400000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2309 37.0 37.0 37.0 37.0 37.0 100-104 36.3022 37.0 37.0 37.0 37.0 37.0 105-109 36.1873 37.0 37.0 37.0 37.0 37.0 110-114 36.1936 37.0 37.0 37.0 37.0 37.0 115-119 36.178000000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.168899999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.07040000000001 37.0 37.0 37.0 37.0 37.0 130-134 36.021 37.0 37.0 37.0 37.0 37.0 135-139 36.0377 37.0 37.0 37.0 37.0 37.0 140-144 35.9158 37.0 37.0 37.0 37.0 37.0 145-149 35.9104 37.0 37.0 37.0 37.0 37.0 150-151 35.4775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 0.0 25 2.0 26 3.0 27 8.0 28 11.0 29 12.0 30 20.0 31 38.0 32 45.0 33 72.0 34 117.0 35 305.0 36 2967.0 37 398.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.925 12.875 13.625000000000002 44.574999999999996 2 19.423558897243108 20.125313283208023 38.34586466165413 22.105263157894736 3 18.7 25.35 26.8 29.15 4 21.224999999999998 34.1 21.85 22.825 5 21.825 34.675 24.4 19.1 6 17.424999999999997 37.225 25.224999999999998 20.125 7 13.200000000000001 22.225 45.675 18.9 8 19.3 21.875 30.5 28.325 9 18.224999999999998 22.45 32.925 26.400000000000002 10-14 20.005 29.549999999999997 26.950000000000003 23.494999999999997 15-19 19.759999999999998 28.77 27.139999999999997 24.33 20-24 19.665 28.415000000000003 28.105000000000004 23.815 25-29 19.975 28.435 27.72 23.87 30-34 20.365 28.58 27.49 23.565 35-39 20.49 28.27 27.224999999999998 24.015 40-44 19.945 28.765 27.744999999999997 23.544999999999998 45-49 20.385 28.349999999999998 27.575 23.69 50-54 20.31 28.244999999999997 27.889999999999997 23.555 55-59 19.985 28.265 28.139999999999997 23.61 60-64 20.119999999999997 28.84 27.05 23.990000000000002 65-69 20.169999999999998 28.07 27.500000000000004 24.26 70-74 20.369999999999997 28.494999999999997 27.515 23.62 75-79 20.84 27.700000000000003 27.794999999999998 23.665 80-84 20.74 27.915 27.705000000000002 23.64 85-89 20.3 27.939999999999998 28.345 23.415 90-94 20.54 28.17 27.150000000000002 24.14 95-99 20.93 28.000000000000004 27.205000000000002 23.865 100-104 20.84 27.82 27.775 23.565 105-109 19.93 27.73 27.785 24.555 110-114 21.09 27.925 27.54 23.445 115-119 20.43 28.285 27.055 24.23 120-124 20.915 28.055000000000003 27.555000000000003 23.474999999999998 125-129 20.485 27.55 27.500000000000004 24.465 130-134 20.885 27.455000000000002 27.625 24.035 135-139 21.22 27.87 27.150000000000002 23.76 140-144 21.175 27.584999999999997 27.47 23.77 145-149 20.82 27.365000000000002 27.16 24.654999999999998 150-151 21.5 27.5625 26.825 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 1.5 25 4.0 26 5.5 27 6.5 28 10.5 29 14.5 30 18.5 31 26.0 32 34.5 33 48.0 34 57.5 35 76.0 36 96.5 37 103.5 38 136.5 39 161.0 40 169.0 41 205.5 42 231.0 43 253.0 44 262.5 45 263.5 46 261.0 47 245.5 48 233.0 49 193.0 50 168.0 51 149.5 52 119.0 53 103.5 54 89.5 55 67.0 56 52.0 57 42.0 58 27.5 59 18.0 60 13.0 61 9.5 62 6.5 63 4.5 64 1.5 65 2.0 66 2.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.075 #Duplication Level Percentage of deduplicated Percentage of total 1 94.25989901674197 88.675 2 5.28833377624236 9.950000000000001 3 0.34546904065904865 0.975 4 0.10629816635663034 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.1375 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.3 0.0 0.0 0.0 0.0 122-123 1.4375 0.0 0.0 0.0 0.0 124-125 1.675 0.0 0.0 0.0 0.0 126-127 1.8375 0.0 0.0 0.0 0.0 128-129 1.9874999999999998 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.3 0.0 0.0 0.0 0.0 134-135 2.4875 0.0 0.0 0.0 0.0 136-137 2.6500000000000004 0.0 0.0 0.0 0.0 138-139 2.8375000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671665 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671665_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.175 37.0 37.0 37.0 37.0 37.0 2 36.0185 37.0 37.0 37.0 37.0 37.0 3 36.135 37.0 37.0 37.0 37.0 37.0 4 36.0695 37.0 37.0 37.0 37.0 37.0 5 36.2355 37.0 37.0 37.0 37.0 37.0 6 36.208 37.0 37.0 37.0 37.0 37.0 7 36.2465 37.0 37.0 37.0 37.0 37.0 8 36.1525 37.0 37.0 37.0 37.0 37.0 9 36.2335 37.0 37.0 37.0 37.0 37.0 10-14 36.224000000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.196799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.197700000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1663 37.0 37.0 37.0 37.0 37.0 30-34 36.1043 37.0 37.0 37.0 37.0 37.0 35-39 36.0891 37.0 37.0 37.0 37.0 37.0 40-44 36.1013 37.0 37.0 37.0 37.0 37.0 45-49 36.0563 37.0 37.0 37.0 37.0 37.0 50-54 36.0672 37.0 37.0 37.0 37.0 37.0 55-59 35.960499999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.00170000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.9051 37.0 37.0 37.0 37.0 37.0 70-74 35.9574 37.0 37.0 37.0 37.0 37.0 75-79 35.856 37.0 37.0 37.0 37.0 37.0 80-84 35.8757 37.0 37.0 37.0 37.0 37.0 85-89 35.8374 37.0 37.0 37.0 37.0 37.0 90-94 35.814499999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.79260000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.790800000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.7667 37.0 37.0 37.0 37.0 37.0 110-114 35.680699999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.714 37.0 37.0 37.0 37.0 37.0 120-124 35.66330000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.6438 37.0 37.0 37.0 37.0 37.0 130-134 35.6336 37.0 37.0 37.0 37.0 37.0 135-139 35.523700000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.335899999999995 37.0 37.0 37.0 29.8 37.0 145-149 35.3738 37.0 37.0 37.0 34.6 37.0 150-151 35.07725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 0.0 15 1.0 16 0.0 17 3.0 18 1.0 19 1.0 20 1.0 21 1.0 22 4.0 23 2.0 24 7.0 25 7.0 26 11.0 27 8.0 28 20.0 29 12.0 30 42.0 31 34.0 32 58.0 33 106.0 34 207.0 35 593.0 36 2692.0 37 185.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.175 16.7 16.425 32.7 2 24.9 24.2 35.05 15.85 3 19.675 26.075 32.2 22.05 4 22.6 35.8 22.25 19.35 5 24.125 36.925000000000004 20.974999999999998 17.974999999999998 6 18.875 37.075 24.425 19.625 7 18.525 16.125 43.5 21.85 8 21.725 23.7 25.95 28.625 9 21.975 24.3 28.249999999999996 25.474999999999998 10-14 23.005 28.51 26.13 22.355 15-19 22.325 27.950000000000003 27.77 21.955 20-24 22.505 28.125 27.500000000000004 21.87 25-29 23.09 28.62 26.565 21.725 30-34 22.57 27.615000000000002 27.87 21.945 35-39 22.585 27.98 28.050000000000004 21.385 40-44 22.82 28.29 27.405 21.485000000000003 45-49 23.325000000000003 27.785 27.779999999999998 21.11 50-54 22.74 28.095 26.915 22.25 55-59 22.97 27.785 27.205000000000002 22.040000000000003 60-64 23.36 27.445000000000004 27.55 21.645 65-69 23.0 27.295 27.63 22.075 70-74 23.645 27.560000000000002 27.3 21.495 75-79 23.24 28.065 27.700000000000003 20.995 80-84 22.82 27.92 27.11 22.15 85-89 23.98 27.884999999999998 26.91 21.224999999999998 90-94 23.3 27.565 27.875 21.26 95-99 24.03 27.74 27.015 21.215 100-104 24.035 27.639999999999997 27.125 21.2 105-109 23.825 27.71 27.689999999999998 20.775 110-114 23.945 27.915 27.115000000000002 21.025 115-119 23.86 27.29 27.644999999999996 21.205 120-124 23.78 27.91 27.26 21.05 125-129 24.240000000000002 27.42 27.455000000000002 20.885 130-134 23.974999999999998 27.79 27.279999999999998 20.955 135-139 24.15 28.255000000000003 26.945000000000004 20.65 140-144 24.485 28.03 26.3 21.185000000000002 145-149 24.27 27.625 27.089999999999996 21.015 150-151 24.587500000000002 28.1 26.9125 20.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 1.5 24 3.0 25 5.0 26 6.0 27 7.5 28 8.0 29 8.0 30 8.0 31 13.5 32 21.5 33 33.0 34 47.5 35 57.0 36 67.5 37 96.0 38 137.0 39 155.0 40 164.5 41 203.0 42 233.5 43 243.0 44 269.0 45 277.5 46 252.5 47 253.0 48 255.5 49 218.0 50 167.0 51 139.5 52 133.5 53 118.5 54 96.5 55 69.0 56 52.5 57 47.5 58 36.5 59 30.0 60 25.0 61 15.0 62 8.5 63 5.0 64 2.5 65 1.0 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.14270500532481 88.4 2 5.324813631522897 10.0 3 0.42598509052183176 1.2 4 0.10649627263045794 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0125 0.0 0.0 106-107 0.6 0.0 0.025 0.0 0.0 108-109 0.675 0.0 0.025 0.0 0.0 110-111 0.6875 0.0 0.025 0.0 0.0 112-113 0.7875 0.0 0.025 0.0 0.0 114-115 0.925 0.0 0.025 0.0 0.0 116-117 1.1125 0.0 0.025 0.0 0.0 118-119 1.2 0.0 0.025 0.0 0.0 120-121 1.275 0.0 0.025 0.0 0.0 122-123 1.4125 0.0 0.025 0.0 0.0 124-125 1.65 0.0 0.025 0.0 0.0 126-127 1.8125 0.0 0.025 0.0 0.0 128-129 1.9625 0.0 0.025 0.0 0.0 130-131 2.15 0.0 0.025 0.0 0.0 132-133 2.2750000000000004 0.0 0.025 0.0 0.0 134-135 2.4625 0.0 0.025 0.0 0.0 136-137 2.6500000000000004 0.0 0.025 0.0 0.0 138-139 2.8375000000000004 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAATTC 10 0.006830828 145.0 3 >>END_MODULE Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974205 spots for SRR12671665.sra Written 974205 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra Read 974197 spots for SRR12671665.sra Written 974197 spots for SRR12671665.sra SRR ids: ['SRR12671665.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xd0w6d6x SRR12671665.sra spots: 19483948 blocks: [[1, 974197], [974198, 1948394], [1948395, 2922591], [2922592, 3896788], [3896789, 4870985], [4870986, 5845182], [5845183, 6819379], [6819380, 7793576], [7793577, 8767773], [8767774, 9741970], [9741971, 10716167], [10716168, 11690364], [11690365, 12664561], [12664562, 13638758], [13638759, 14612955], [14612956, 15587152], [15587153, 16561349], [16561350, 17535546], [17535547, 18509743], [18509744, 19483948]] SRR12671665 file size 6599797 SRR12671665 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671665 SRR12671665_1.fastq SRR12671665_2.fastq Input file: SRR12671665_1.fastq Paired file: SRR12671665_2.fastq trimmed: SRR12671665-trimmed-pair1.fastq, SRR12671665-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 13:03:42 2025 >> started Thu Apr 10 13:04:03 2025 >> done (20.749s) 19483948 read pairs processed; of these: 12 ( 0.00%) short read pairs filtered out after trimming by size control 2014 ( 0.01%) empty read pairs filtered out after trimming by size control 19481922 (99.99%) read pairs available; of these: 858367 ( 4.41%) trimmed read pairs available after processing 18623555 (95.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 2 0.00% 24 4 0.00% 25 4 0.00% 26 5 0.00% 27 6 0.00% 28 8 0.00% 29 4 0.00% 30 13 0.00% 31 8 0.00% 32 10 0.00% 33 12 0.00% 34 11 0.00% 35 15 0.00% 36 11 0.00% 37 24 0.00% 38 22 0.00% 39 13 0.00% 40 23 0.00% 41 22 0.00% 42 33 0.00% 43 24 0.00% 44 27 0.00% 45 25 0.00% 46 47 0.00% 47 39 0.00% 48 25 0.00% 49 37 0.00% 50 41 0.00% 51 47 0.00% 52 59 0.00% 53 60 0.00% 54 73 0.00% 55 62 0.00% 56 61 0.00% 57 63 0.00% 58 88 0.00% 59 100 0.00% 60 80 0.00% 61 126 0.00% 62 126 0.00% 63 118 0.00% 64 148 0.00% 65 178 0.00% 66 166 0.00% 67 198 0.00% 68 195 0.00% 69 187 0.00% 70 256 0.00% 71 287 0.00% 72 325 0.00% 73 380 0.00% 74 411 0.00% 75 408 0.00% 76 529 0.00% 77 581 0.00% 78 564 0.00% 79 629 0.00% 80 705 0.00% 81 781 0.00% 82 920 0.00% 83 1037 0.01% 84 1106 0.01% 85 1294 0.01% 86 1400 0.01% 87 1519 0.01% 88 1617 0.01% 89 1806 0.01% 90 1858 0.01% 91 2140 0.01% 92 2258 0.01% 93 2721 0.01% 94 2910 0.01% 95 3065 0.02% 96 3296 0.02% 97 3533 0.02% 98 3665 0.02% 99 3926 0.02% 100 4176 0.02% 101 4358 0.02% 102 4799 0.02% 103 5223 0.03% 104 5552 0.03% 105 5853 0.03% 106 6132 0.03% 107 6534 0.03% 108 7021 0.04% 109 7254 0.04% 110 7438 0.04% 111 7870 0.04% 112 8314 0.04% 113 8957 0.05% 114 9313 0.05% 115 10084 0.05% 116 10304 0.05% 117 10662 0.05% 118 11319 0.06% 119 11585 0.06% 120 12239 0.06% 121 12749 0.07% 122 13122 0.07% 123 13746 0.07% 124 14592 0.07% 125 14812 0.08% 126 15369 0.08% 127 16199 0.08% 128 16633 0.09% 129 16776 0.09% 130 17433 0.09% 131 17781 0.09% 132 18840 0.10% 133 19581 0.10% 134 20225 0.10% 135 21152 0.11% 136 21541 0.11% 137 22186 0.11% 138 23228 0.12% 139 23662 0.12% 140 23729 0.12% 141 24416 0.13% 142 25577 0.13% 143 26026 0.13% 144 27313 0.14% 145 28287 0.15% 146 28898 0.15% 147 29574 0.15% 148 29972 0.15% 149 30464 0.16% 150 30914 0.16% 151 18623555 95.59% 19481922 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=14 prefix-density=0.49 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=19.80 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.2 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=27 prefix-density=0.56 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=26.98 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.4 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTT SRR12671665 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 13:04:46 Started mapping on | Apr 10 13:04:47 Finished on | Apr 10 13:07:06 Mapping speed, Million of reads per hour | 504.57 Number of input reads | 19481922 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 18268077 Uniquely mapped reads % | 93.77% Average mapped length | 298.98 Number of splices: Total | 18545341 Number of splices: Annotated (sjdb) | 18209429 Number of splices: GT/AG | 18187782 Number of splices: GC/AG | 295050 Number of splices: AT/AC | 11827 Number of splices: Non-canonical | 50682 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 443210 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 102627 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 770635 770635 770635 N_multimapping 443210 443210 443210 N_noFeature 525746 17978857 608436 N_ambiguous 327335 1373 120276 UnstrandedReadsAssigned:17414996 PositiveStrandReadsAssigned:287847 NegativeStrandReadsAssigned:17539365 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671665 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671665-trimmed-pair1.fastq SRR12671665-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,481,922 reads, 17,528,866 reads pseudoaligned [quant] estimated average fragment length: 301.011 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR12671665.ke.tsv 34699 SRR12671665.se.tsv 87100 total ==> SRR12671665.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1717.99 957 27.7725 Potri.005G024800.1.v4.1 1035 734.989 640 43.4133 Potri.004G059700.1.v4.1 961 661.329 2 0.150777 Potri.007G009000.2.v4.1 1416 1115.99 0 0 Potri.003G141000.2.v4.1 2943 2642.99 935 17.6376 Potri.016G087400.1.v4.1 270 70.3511 1226 868.845 Potri.015G069301.1.v4.1 564 287.175 0 0 Potri.010G195200.1.v4.1 1773 1472.99 282 9.54493 Potri.012G127500.1.v4.1 977 677.203 599 44.0992 ==> SRR12671665.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 248 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 340 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR12671665 completed mapping pipeline successfully