Starting /dee2/code/volunteer_pipeline.sh SRR12671666 current disk space = 3050562809856 free memory = 1574461048 SRR12671666 SRAfilesize 3bd809ab16ac4890f93918df99a0b6e2 SRR12671666.sra SRR12671666.sra file validated SRR12671666 is paired end SRR12671666 is conventional basespace SRR12671666 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671666_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4565 37.0 37.0 37.0 37.0 37.0 2 36.16325 37.0 37.0 37.0 37.0 37.0 3 36.597 37.0 37.0 37.0 37.0 37.0 4 36.4805 37.0 37.0 37.0 37.0 37.0 5 36.5465 37.0 37.0 37.0 37.0 37.0 6 36.5085 37.0 37.0 37.0 37.0 37.0 7 36.479 37.0 37.0 37.0 37.0 37.0 8 36.564 37.0 37.0 37.0 37.0 37.0 9 36.5305 37.0 37.0 37.0 37.0 37.0 10-14 36.5695 37.0 37.0 37.0 37.0 37.0 15-19 36.527 37.0 37.0 37.0 37.0 37.0 20-24 36.541 37.0 37.0 37.0 37.0 37.0 25-29 36.4831 37.0 37.0 37.0 37.0 37.0 30-34 36.5052 37.0 37.0 37.0 37.0 37.0 35-39 36.4579 37.0 37.0 37.0 37.0 37.0 40-44 36.4464 37.0 37.0 37.0 37.0 37.0 45-49 36.4018 37.0 37.0 37.0 37.0 37.0 50-54 36.4468 37.0 37.0 37.0 37.0 37.0 55-59 36.3957 37.0 37.0 37.0 37.0 37.0 60-64 36.3638 37.0 37.0 37.0 37.0 37.0 65-69 36.356899999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3326 37.0 37.0 37.0 37.0 37.0 75-79 36.3328 37.0 37.0 37.0 37.0 37.0 80-84 36.333 37.0 37.0 37.0 37.0 37.0 85-89 36.289699999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.23870000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1942 37.0 37.0 37.0 37.0 37.0 100-104 36.266400000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.16459999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.18150000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.2102 37.0 37.0 37.0 37.0 37.0 120-124 36.1037 37.0 37.0 37.0 37.0 37.0 125-129 36.0542 37.0 37.0 37.0 37.0 37.0 130-134 36.011199999999995 37.0 37.0 37.0 37.0 37.0 135-139 36.0176 37.0 37.0 37.0 37.0 37.0 140-144 36.0002 37.0 37.0 37.0 37.0 37.0 145-149 35.856700000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.447500000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 0.0 26 4.0 27 5.0 28 9.0 29 19.0 30 32.0 31 34.0 32 47.0 33 75.0 34 113.0 35 302.0 36 2915.0 37 443.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.900000000000002 13.100000000000001 11.175 43.824999999999996 2 19.467470484802814 19.794021602612407 39.76387842250691 20.97462949007787 3 17.575 25.650000000000002 27.075 29.7 4 22.325 32.875 22.325 22.475 5 20.925 36.825 23.849999999999998 18.4 6 17.849999999999998 35.775 26.400000000000002 19.975 7 14.149999999999999 21.725 45.074999999999996 19.05 8 17.25 23.05 30.599999999999998 29.099999999999998 9 17.5 23.25 31.574999999999996 27.675 10-14 19.900000000000002 28.9 27.075 24.125 15-19 19.895 28.565 27.41 24.13 20-24 19.895 29.005 27.025 24.075 25-29 20.150000000000002 28.585 27.3 23.965 30-34 19.89 28.285 27.62 24.205 35-39 20.02 28.655 27.125 24.2 40-44 19.99 28.860000000000003 27.250000000000004 23.9 45-49 20.200000000000003 28.15 27.36 24.29 50-54 19.905 28.794999999999998 26.889999999999997 24.41 55-59 20.47 27.935 27.58 24.015 60-64 20.474999999999998 28.205000000000002 27.275 24.044999999999998 65-69 20.355 27.655 27.439999999999998 24.55 70-74 21.154999999999998 28.13 27.005000000000003 23.71 75-79 19.96 28.935 27.52 23.585 80-84 20.349999999999998 28.43 27.265 23.955000000000002 85-89 20.625 27.950000000000003 27.800000000000004 23.625 90-94 20.305 27.435 28.225 24.035 95-99 21.02 27.700000000000003 27.925 23.355 100-104 20.84 27.88 27.0 24.279999999999998 105-109 20.23 27.935 27.529999999999998 24.305 110-114 20.599999999999998 27.975 27.715 23.71 115-119 20.9 27.560000000000002 27.715 23.825 120-124 21.044999999999998 27.994999999999997 26.889999999999997 24.07 125-129 21.13 27.57 27.495000000000005 23.805 130-134 21.195 27.875 27.029999999999998 23.9 135-139 21.43 27.37 27.54 23.66 140-144 21.15 27.650000000000002 26.955000000000002 24.245 145-149 20.97 27.455000000000002 26.939999999999998 24.635 150-151 21.675 27.375 26.924999999999997 24.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 3.0 26 4.5 27 4.0 28 6.0 29 8.5 30 19.5 31 29.0 32 33.0 33 37.5 34 44.5 35 68.5 36 96.0 37 111.5 38 119.5 39 145.5 40 180.5 41 216.5 42 242.0 43 260.0 44 276.0 45 269.0 46 246.5 47 246.0 48 249.5 49 209.0 50 173.5 51 152.5 52 116.5 53 95.5 54 80.0 55 58.0 56 51.0 57 37.5 58 23.0 59 24.5 60 18.0 61 12.0 62 14.5 63 7.0 64 2.0 65 2.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.975 #Duplication Level Percentage of deduplicated Percentage of total 1 93.17020704490454 86.625 2 6.184458187684862 11.5 3 0.5915568701263781 1.6500000000000001 4 0.026888948642108095 0.1 5 0.026888948642108095 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.3624999999999998 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.275 0.0 0.0 0.0 0.0 124-125 2.35 0.0 0.0 0.0 0.0 126-127 2.5375 0.0 0.0 0.0 0.0 128-129 2.8 0.0 0.0 0.0 0.0 130-131 3.075 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.6875 0.0 0.0 0.0 0.0 136-137 4.0 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGGGGT 10 0.006830828 145.0 3 ACATAAC 10 0.006830828 145.0 6 TTTGTCA 10 0.006830828 145.0 7 >>END_MODULE SRR12671666 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671666_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2885 37.0 37.0 37.0 37.0 37.0 2 36.2025 37.0 37.0 37.0 37.0 37.0 3 36.169 37.0 37.0 37.0 37.0 37.0 4 36.1735 37.0 37.0 37.0 37.0 37.0 5 36.3825 37.0 37.0 37.0 37.0 37.0 6 36.3295 37.0 37.0 37.0 37.0 37.0 7 36.3175 37.0 37.0 37.0 37.0 37.0 8 36.4175 37.0 37.0 37.0 37.0 37.0 9 36.28 37.0 37.0 37.0 37.0 37.0 10-14 36.31 37.0 37.0 37.0 37.0 37.0 15-19 36.2839 37.0 37.0 37.0 37.0 37.0 20-24 36.297 37.0 37.0 37.0 37.0 37.0 25-29 36.2583 37.0 37.0 37.0 37.0 37.0 30-34 36.245000000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.2067 37.0 37.0 37.0 37.0 37.0 40-44 36.1758 37.0 37.0 37.0 37.0 37.0 45-49 36.1593 37.0 37.0 37.0 37.0 37.0 50-54 36.1464 37.0 37.0 37.0 37.0 37.0 55-59 36.1065 37.0 37.0 37.0 37.0 37.0 60-64 36.0831 37.0 37.0 37.0 37.0 37.0 65-69 36.0261 37.0 37.0 37.0 37.0 37.0 70-74 36.0381 37.0 37.0 37.0 37.0 37.0 75-79 35.93560000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.0098 37.0 37.0 37.0 37.0 37.0 85-89 35.9482 37.0 37.0 37.0 37.0 37.0 90-94 35.934400000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.9569 37.0 37.0 37.0 37.0 37.0 100-104 35.896800000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.815099999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.7984 37.0 37.0 37.0 37.0 37.0 115-119 35.7806 37.0 37.0 37.0 37.0 37.0 120-124 35.728899999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.6449 37.0 37.0 37.0 37.0 37.0 130-134 35.6464 37.0 37.0 37.0 37.0 37.0 135-139 35.6477 37.0 37.0 37.0 37.0 37.0 140-144 35.3918 37.0 37.0 37.0 37.0 37.0 145-149 35.4606 37.0 37.0 37.0 34.6 37.0 150-151 35.02175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 5.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 1.0 22 1.0 23 5.0 24 2.0 25 6.0 26 9.0 27 14.0 28 14.0 29 17.0 30 31.0 31 39.0 32 50.0 33 102.0 34 170.0 35 536.0 36 2767.0 37 227.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.75 17.775 15.4 32.074999999999996 2 25.324999999999996 24.25 33.975 16.45 3 19.05 27.575 33.125 20.25 4 23.05 34.949999999999996 21.475 20.525 5 24.825 36.425000000000004 21.5 17.25 6 17.95 38.475 23.425 20.150000000000002 7 18.45 17.125 42.475 21.95 8 20.075000000000003 23.35 27.200000000000003 29.375 9 22.075 24.099999999999998 28.975 24.85 10-14 22.965 28.660000000000004 26.41 21.965 15-19 22.994999999999997 27.35 27.445000000000004 22.21 20-24 23.07 28.144999999999996 27.705000000000002 21.08 25-29 22.855 27.965 27.965 21.215 30-34 22.775000000000002 27.63 28.24 21.355 35-39 23.015 28.27 27.37 21.345 40-44 23.06 28.09 27.584999999999997 21.265 45-49 22.86 27.589999999999996 28.060000000000002 21.490000000000002 50-54 23.445 28.09 26.740000000000002 21.725 55-59 22.855 27.68 27.455000000000002 22.009999999999998 60-64 22.84 27.92 27.900000000000002 21.34 65-69 23.665 27.334999999999997 27.685 21.315 70-74 23.635 27.46 27.58 21.325 75-79 24.015 27.060000000000002 27.04 21.884999999999998 80-84 23.36 27.944999999999997 26.985 21.709999999999997 85-89 24.02 27.605 27.189999999999998 21.185000000000002 90-94 23.73 28.155 27.02 21.095 95-99 23.855 28.265 26.305 21.575 100-104 23.815 27.705000000000002 26.745 21.735 105-109 24.065 28.095 27.415 20.424999999999997 110-114 23.59 28.08 27.405 20.925 115-119 24.265 27.265 27.439999999999998 21.029999999999998 120-124 24.345 27.36 27.694999999999997 20.599999999999998 125-129 24.529999999999998 27.450000000000003 26.945000000000004 21.075 130-134 24.21 27.339999999999996 27.435 21.015 135-139 25.080000000000002 27.215 26.905 20.8 140-144 25.019999999999996 27.125 27.08 20.775 145-149 24.25 27.375 27.49 20.885 150-151 25.9875 27.3375 26.887499999999996 19.787499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 2.0 26 1.0 27 3.5 28 8.0 29 9.5 30 10.5 31 13.0 32 22.0 33 32.5 34 40.0 35 56.0 36 71.5 37 84.5 38 114.5 39 154.5 40 188.5 41 215.0 42 231.0 43 249.5 44 271.0 45 283.5 46 274.0 47 256.5 48 246.5 49 220.5 50 182.0 51 151.0 52 127.5 53 101.5 54 87.5 55 72.0 56 48.0 57 37.0 58 33.0 59 31.5 60 19.5 61 10.0 62 8.5 63 5.0 64 4.5 65 4.0 66 3.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.025 #Duplication Level Percentage of deduplicated Percentage of total 1 93.1470034936845 86.65 2 6.288632088148348 11.700000000000001 3 0.5374899220639613 1.5 4 0.0 0.0 5 0.0 0.0 6 0.026874496103198062 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 0.9625 0.0 0.0 0.0 0.0 112-113 1.1375000000000002 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.8624999999999998 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.225 0.0 0.0 0.0 0.0 124-125 2.3 0.0 0.0 0.0 0.0 126-127 2.4749999999999996 0.0 0.0 0.0 0.0 128-129 2.75 0.0 0.0 0.0 0.0 130-131 3.05 0.0 0.0 0.0 0.0 132-133 3.3875 0.0 0.0 0.0 0.0 134-135 3.6375 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.199999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCACAC 10 0.006830828 145.0 1 GTTCAAT 10 0.006830828 145.0 5 TCACACT 10 0.006830828 145.0 2 >>END_MODULE Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110516 spots for SRR12671666.sra Written 1110516 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra Read 1110497 spots for SRR12671666.sra Written 1110497 spots for SRR12671666.sra SRR ids: ['SRR12671666.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wlyua5y9 SRR12671666.sra spots: 22209959 blocks: [[1, 1110497], [1110498, 2220994], [2220995, 3331491], [3331492, 4441988], [4441989, 5552485], [5552486, 6662982], [6662983, 7773479], [7773480, 8883976], [8883977, 9994473], [9994474, 11104970], [11104971, 12215467], [12215468, 13325964], [13325965, 14436461], [14436462, 15546958], [15546959, 16657455], [16657456, 17767952], [17767953, 18878449], [18878450, 19988946], [19988947, 21099443], [21099444, 22209959]] SRR12671666 file size 7526215 SRR12671666 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671666 SRR12671666_1.fastq SRR12671666_2.fastq Input file: SRR12671666_1.fastq Paired file: SRR12671666_2.fastq trimmed: SRR12671666-trimmed-pair1.fastq, SRR12671666-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:57:15 2025 >> started Wed Feb 12 01:57:39 2025 >> done (24.246s) 22209959 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 1216 ( 0.01%) empty read pairs filtered out after trimming by size control 22208726 (99.99%) read pairs available; of these: 1388125 ( 6.25%) trimmed read pairs available after processing 20820601 (93.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 4 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 3 0.00% 25 2 0.00% 26 4 0.00% 27 4 0.00% 28 6 0.00% 29 3 0.00% 30 5 0.00% 31 6 0.00% 32 8 0.00% 33 3 0.00% 34 9 0.00% 35 11 0.00% 36 16 0.00% 37 13 0.00% 38 12 0.00% 39 20 0.00% 40 19 0.00% 41 28 0.00% 42 26 0.00% 43 21 0.00% 44 22 0.00% 45 24 0.00% 46 30 0.00% 47 33 0.00% 48 45 0.00% 49 38 0.00% 50 52 0.00% 51 56 0.00% 52 64 0.00% 53 65 0.00% 54 80 0.00% 55 79 0.00% 56 82 0.00% 57 78 0.00% 58 96 0.00% 59 111 0.00% 60 115 0.00% 61 138 0.00% 62 169 0.00% 63 175 0.00% 64 229 0.00% 65 225 0.00% 66 260 0.00% 67 244 0.00% 68 316 0.00% 69 298 0.00% 70 355 0.00% 71 425 0.00% 72 506 0.00% 73 569 0.00% 74 655 0.00% 75 679 0.00% 76 777 0.00% 77 806 0.00% 78 904 0.00% 79 1041 0.00% 80 1135 0.01% 81 1223 0.01% 82 1435 0.01% 83 1647 0.01% 84 1879 0.01% 85 1979 0.01% 86 2248 0.01% 87 2548 0.01% 88 2741 0.01% 89 2939 0.01% 90 3116 0.01% 91 3473 0.02% 92 4020 0.02% 93 4313 0.02% 94 4746 0.02% 95 5155 0.02% 96 5649 0.03% 97 5882 0.03% 98 6266 0.03% 99 6640 0.03% 100 7282 0.03% 101 7656 0.03% 102 8442 0.04% 103 9089 0.04% 104 9474 0.04% 105 10101 0.05% 106 10837 0.05% 107 11289 0.05% 108 11672 0.05% 109 12341 0.06% 110 12792 0.06% 111 13451 0.06% 112 14373 0.06% 113 14853 0.07% 114 15713 0.07% 115 16580 0.07% 116 17558 0.08% 117 18001 0.08% 118 18609 0.08% 119 19382 0.09% 120 20047 0.09% 121 20851 0.09% 122 21718 0.10% 123 22794 0.10% 124 23971 0.11% 125 24724 0.11% 126 25413 0.11% 127 26262 0.12% 128 27098 0.12% 129 27078 0.12% 130 28267 0.13% 131 28879 0.13% 132 30141 0.14% 133 31962 0.14% 134 33017 0.15% 135 34211 0.15% 136 34739 0.16% 137 35444 0.16% 138 36289 0.16% 139 37186 0.17% 140 37591 0.17% 141 39245 0.18% 142 40291 0.18% 143 41101 0.19% 144 43336 0.20% 145 44488 0.20% 146 45954 0.21% 147 45638 0.21% 148 46942 0.21% 149 47054 0.21% 150 47798 0.22% 151 20820601 93.75% 22208726 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=11 prefix-density=0.68 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=17.71 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.6 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=15 prefix-density=0.63 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=23.45 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.1 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR12671666 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:58:21 Started mapping on | Feb 12 01:58:22 Finished on | Feb 12 02:00:48 Mapping speed, Million of reads per hour | 547.61 Number of input reads | 22208726 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20866836 Uniquely mapped reads % | 93.96% Average mapped length | 298.19 Number of splices: Total | 21515396 Number of splices: Annotated (sjdb) | 21130872 Number of splices: GT/AG | 21076005 Number of splices: GC/AG | 365759 Number of splices: AT/AC | 11458 Number of splices: Non-canonical | 62174 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 556173 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 136506 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.80% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 785717 785717 785717 N_multimapping 556173 556173 556173 N_noFeature 544073 20499752 647841 N_ambiguous 390820 1517 126713 UnstrandedReadsAssigned:19931943 PositiveStrandReadsAssigned:365567 NegativeStrandReadsAssigned:20092282 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671666 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671666-trimmed-pair1.fastq SRR12671666-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,208,726 reads, 20,100,523 reads pseudoaligned [quant] estimated average fragment length: 282.683 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR12671666.ke.tsv 34699 SRR12671666.se.tsv 87100 total ==> SRR12671666.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.32 1087 25.3463 Potri.005G024800.1.v4.1 1035 753.317 453 24.3464 Potri.004G059700.1.v4.1 961 679.602 5 0.297872 Potri.007G009000.2.v4.1 1416 1134.32 0 0 Potri.003G141000.2.v4.1 2943 2661.32 1177 17.9058 Potri.016G087400.1.v4.1 270 75.4312 1037 556.598 Potri.015G069301.1.v4.1 564 301.835 0 0 Potri.010G195200.1.v4.1 1773 1491.32 245 6.65135 Potri.012G127500.1.v4.1 977 695.436 186 10.8285 ==> SRR12671666.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 403 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 386 Potri.001G212900.v4.1 217 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12671666 completed mapping pipeline successfully