Starting /dee2/code/volunteer_pipeline.sh SRR12671667 current disk space = 3050852073472 free memory = 1501033216 SRR12671667 SRAfilesize 935cfab69cf81504cc3e3f1aca517bbd SRR12671667.sra SRR12671667.sra file validated SRR12671667 is paired end SRR12671667 is conventional basespace SRR12671667 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671667_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4055 37.0 37.0 37.0 37.0 37.0 2 36.25 37.0 37.0 37.0 37.0 37.0 3 36.567 37.0 37.0 37.0 37.0 37.0 4 36.519 37.0 37.0 37.0 37.0 37.0 5 36.49 37.0 37.0 37.0 37.0 37.0 6 36.4915 37.0 37.0 37.0 37.0 37.0 7 36.391 37.0 37.0 37.0 37.0 37.0 8 36.561 37.0 37.0 37.0 37.0 37.0 9 36.6055 37.0 37.0 37.0 37.0 37.0 10-14 36.5325 37.0 37.0 37.0 37.0 37.0 15-19 36.532300000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.529 37.0 37.0 37.0 37.0 37.0 25-29 36.5149 37.0 37.0 37.0 37.0 37.0 30-34 36.4731 37.0 37.0 37.0 37.0 37.0 35-39 36.475300000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4357 37.0 37.0 37.0 37.0 37.0 45-49 36.4148 37.0 37.0 37.0 37.0 37.0 50-54 36.425 37.0 37.0 37.0 37.0 37.0 55-59 36.39 37.0 37.0 37.0 37.0 37.0 60-64 36.4097 37.0 37.0 37.0 37.0 37.0 65-69 36.3688 37.0 37.0 37.0 37.0 37.0 70-74 36.3164 37.0 37.0 37.0 37.0 37.0 75-79 36.3443 37.0 37.0 37.0 37.0 37.0 80-84 36.2773 37.0 37.0 37.0 37.0 37.0 85-89 36.271100000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.2392 37.0 37.0 37.0 37.0 37.0 95-99 36.2192 37.0 37.0 37.0 37.0 37.0 100-104 36.232299999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.158699999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1783 37.0 37.0 37.0 37.0 37.0 115-119 36.1443 37.0 37.0 37.0 37.0 37.0 120-124 36.1132 37.0 37.0 37.0 37.0 37.0 125-129 36.0526 37.0 37.0 37.0 37.0 37.0 130-134 36.0376 37.0 37.0 37.0 37.0 37.0 135-139 35.9487 37.0 37.0 37.0 37.0 37.0 140-144 35.927800000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.9221 37.0 37.0 37.0 37.0 37.0 150-151 35.420500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 1.0 26 6.0 27 4.0 28 11.0 29 22.0 30 18.0 31 41.0 32 44.0 33 69.0 34 107.0 35 313.0 36 2991.0 37 371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.5 15.125 11.525 39.85 2 20.697441043652784 20.14550928248871 37.55644756648269 21.600602107375817 3 17.299999999999997 27.925 28.675 26.1 4 22.225 33.95 22.6 21.224999999999998 5 20.7 38.0 24.0 17.299999999999997 6 18.2 35.8 26.200000000000003 19.8 7 14.05 22.375 44.3 19.275000000000002 8 18.224999999999998 23.525 29.15 29.099999999999998 9 18.2 22.75 32.75 26.3 10-14 19.86 29.054999999999996 27.05 24.035 15-19 19.994999999999997 28.084999999999997 28.060000000000002 23.86 20-24 20.06 28.15 28.275 23.515 25-29 19.79 28.449999999999996 27.605 24.154999999999998 30-34 19.950000000000003 28.01 28.13 23.91 35-39 20.349999999999998 28.425 27.515 23.71 40-44 20.325 28.244999999999997 27.834999999999997 23.595 45-49 20.645 28.315 27.555000000000003 23.485 50-54 20.18 28.055000000000003 27.765 24.0 55-59 19.994999999999997 28.18 27.700000000000003 24.125 60-64 20.57 28.139999999999997 27.675 23.615 65-69 20.424999999999997 28.185 27.555000000000003 23.835 70-74 19.97 28.499999999999996 27.48 24.05 75-79 19.905 28.255000000000003 27.46 24.38 80-84 20.62 27.92 27.794999999999998 23.665 85-89 20.24 28.685 27.279999999999998 23.794999999999998 90-94 20.59 27.3 27.265 24.845 95-99 20.395 27.855 27.735 24.015 100-104 20.905 28.165000000000003 27.084999999999997 23.845 105-109 20.97 28.01 27.169999999999998 23.849999999999998 110-114 20.68 28.095 27.77 23.455000000000002 115-119 21.13 28.065 27.115000000000002 23.69 120-124 21.14 27.694999999999997 27.589999999999996 23.575 125-129 20.94 26.939999999999998 27.800000000000004 24.32 130-134 21.135 27.21 27.26 24.395 135-139 21.035 27.575 27.79 23.599999999999998 140-144 20.89 27.500000000000004 27.04 24.57 145-149 21.34 27.955000000000002 27.395000000000003 23.31 150-151 21.7 27.487499999999997 27.450000000000003 23.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.5 19 2.0 20 0.5 21 0.0 22 0.0 23 1.5 24 2.0 25 2.5 26 5.5 27 6.5 28 8.5 29 15.5 30 18.5 31 22.0 32 32.5 33 43.0 34 62.0 35 77.5 36 84.0 37 103.5 38 125.0 39 150.5 40 185.0 41 211.5 42 240.5 43 255.0 44 257.0 45 268.5 46 266.0 47 247.0 48 234.0 49 206.0 50 183.0 51 155.0 52 117.0 53 96.5 54 79.5 55 62.5 56 46.0 57 38.0 58 27.0 59 22.0 60 15.5 61 8.0 62 5.0 63 3.0 64 2.0 65 0.0 66 1.5 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.35 #Duplication Level Percentage of deduplicated Percentage of total 1 95.4116413214473 90.975 2 4.3261667540639746 8.25 3 0.23597273203985317 0.675 4 0.026219192448872573 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.9625 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.2374999999999998 0.0 0.0 0.0 0.0 126-127 1.325 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.6625 0.0 0.0 0.0 0.0 132-133 1.8125 0.0 0.0 0.0 0.0 134-135 2.0125 0.0 0.0 0.0 0.0 136-137 2.2625 0.0 0.0 0.0 0.0 138-139 2.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCACCG 10 0.006830828 145.0 9 CTTCCTC 10 0.006830828 145.0 145 >>END_MODULE SRR12671667 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671667_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0885 37.0 37.0 37.0 37.0 37.0 2 35.9535 37.0 37.0 37.0 37.0 37.0 3 36.0775 37.0 37.0 37.0 37.0 37.0 4 36.127 37.0 37.0 37.0 37.0 37.0 5 36.109 37.0 37.0 37.0 37.0 37.0 6 36.0715 37.0 37.0 37.0 37.0 37.0 7 36.192 37.0 37.0 37.0 37.0 37.0 8 36.2825 37.0 37.0 37.0 37.0 37.0 9 36.132 37.0 37.0 37.0 37.0 37.0 10-14 36.2444 37.0 37.0 37.0 37.0 37.0 15-19 36.1954 37.0 37.0 37.0 37.0 37.0 20-24 36.159000000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.132600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.088 37.0 37.0 37.0 37.0 37.0 35-39 36.050599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.083000000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.0416 37.0 37.0 37.0 37.0 37.0 50-54 36.0341 37.0 37.0 37.0 37.0 37.0 55-59 36.0229 37.0 37.0 37.0 37.0 37.0 60-64 36.0142 37.0 37.0 37.0 37.0 37.0 65-69 35.995999999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.9399 37.0 37.0 37.0 37.0 37.0 75-79 35.845600000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.8998 37.0 37.0 37.0 37.0 37.0 85-89 35.8606 37.0 37.0 37.0 37.0 37.0 90-94 35.799600000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.8945 37.0 37.0 37.0 37.0 37.0 100-104 35.8167 37.0 37.0 37.0 37.0 37.0 105-109 35.7978 37.0 37.0 37.0 37.0 37.0 110-114 35.6485 37.0 37.0 37.0 37.0 37.0 115-119 35.6923 37.0 37.0 37.0 37.0 37.0 120-124 35.655899999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.5793 37.0 37.0 37.0 37.0 37.0 130-134 35.591300000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.5929 37.0 37.0 37.0 37.0 37.0 140-144 35.3636 37.0 37.0 37.0 37.0 37.0 145-149 35.5005 37.0 37.0 37.0 37.0 37.0 150-151 35.063500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 3.0 24 8.0 25 4.0 26 13.0 27 14.0 28 20.0 29 16.0 30 34.0 31 37.0 32 56.0 33 107.0 34 214.0 35 601.0 36 2663.0 37 199.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.825 19.175 14.249999999999998 29.75 2 27.175 24.474999999999998 33.575 14.774999999999999 3 19.950000000000003 28.575 31.15 20.325 4 22.225 36.025 22.275 19.475 5 23.400000000000002 37.325 21.875 17.4 6 20.45 37.974999999999994 22.525000000000002 19.05 7 18.375 18.4 40.150000000000006 23.075000000000003 8 21.275 25.424999999999997 25.7 27.6 9 20.724999999999998 24.7 29.4 25.174999999999997 10-14 23.075000000000003 28.715000000000003 26.529999999999998 21.68 15-19 22.645 28.03 27.71 21.615000000000002 20-24 23.025000000000002 28.199999999999996 27.439999999999998 21.335 25-29 22.98 27.83 27.515 21.675 30-34 22.535 27.655 27.529999999999998 22.28 35-39 23.165 27.93 27.700000000000003 21.205 40-44 23.200000000000003 27.49 27.689999999999998 21.62 45-49 23.265 27.565 27.815 21.355 50-54 22.82 27.405 28.005000000000003 21.77 55-59 23.135 27.150000000000002 27.775 21.94 60-64 22.945 27.35 27.495000000000005 22.21 65-69 22.97 27.435 27.785 21.81 70-74 23.405 27.91 26.974999999999998 21.709999999999997 75-79 23.315 27.894999999999996 26.565 22.225 80-84 22.41 27.744999999999997 27.435 22.41 85-89 23.189999999999998 27.905 27.195000000000004 21.709999999999997 90-94 23.62 27.42 27.155 21.805 95-99 23.325000000000003 27.779999999999998 27.1 21.795 100-104 23.34 27.685 27.405 21.57 105-109 23.69 27.445000000000004 27.634999999999998 21.23 110-114 23.455000000000002 27.49 27.534999999999997 21.52 115-119 23.78 28.199999999999996 26.740000000000002 21.279999999999998 120-124 23.66 27.725 27.045 21.57 125-129 23.59 27.339999999999996 27.42 21.65 130-134 23.82 27.35 27.500000000000004 21.33 135-139 23.57 27.77 27.29 21.37 140-144 24.044999999999998 27.435 26.87 21.65 145-149 24.505 28.04 26.375 21.08 150-151 24.337500000000002 27.575 26.1 21.987499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 2.0 18 2.0 19 1.0 20 1.0 21 1.0 22 2.0 23 1.5 24 1.5 25 1.5 26 1.0 27 2.0 28 4.0 29 9.0 30 10.5 31 12.0 32 17.5 33 27.0 34 34.5 35 51.5 36 70.0 37 83.5 38 108.5 39 141.5 40 182.5 41 218.5 42 242.0 43 259.5 44 271.5 45 291.0 46 301.0 47 270.5 48 238.5 49 220.5 50 185.5 51 143.0 52 119.5 53 108.5 54 89.5 55 71.5 56 60.0 57 43.5 58 29.0 59 23.0 60 16.5 61 9.0 62 6.0 63 4.5 64 2.5 65 1.0 66 1.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 95.3145564622269 90.525 2 4.2906027902079495 8.15 3 0.315872598052119 0.8999999999999999 4 0.026322716504343247 0.1 5 0.026322716504343247 0.125 6 0.0 0.0 7 0.0 0.0 8 0.026322716504343247 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 8 0.2 No Hit TCTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.7875 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.3 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.6375000000000002 0.0 0.0 0.0 0.0 132-133 1.7875 0.0 0.0 0.0 0.0 134-135 1.9874999999999998 0.0 0.0 0.0 0.0 136-137 2.2375 0.0 0.0 0.0 0.0 138-139 2.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAACAT 10 0.006830828 145.0 1 >>END_MODULE Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871471 spots for SRR12671667.sra Written 871471 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra Read 871457 spots for SRR12671667.sra Written 871457 spots for SRR12671667.sra SRR ids: ['SRR12671667.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4b8g056t SRR12671667.sra spots: 17429154 blocks: [[1, 871457], [871458, 1742914], [1742915, 2614371], [2614372, 3485828], [3485829, 4357285], [4357286, 5228742], [5228743, 6100199], [6100200, 6971656], [6971657, 7843113], [7843114, 8714570], [8714571, 9586027], [9586028, 10457484], [10457485, 11328941], [11328942, 12200398], [12200399, 13071855], [13071856, 13943312], [13943313, 14814769], [14814770, 15686226], [15686227, 16557683], [16557684, 17429154]] SRR12671667 file size 5901488 SRR12671667 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671667 SRR12671667_1.fastq SRR12671667_2.fastq Input file: SRR12671667_1.fastq Paired file: SRR12671667_2.fastq trimmed: SRR12671667-trimmed-pair1.fastq, SRR12671667-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:50:26 2025 >> started Wed Feb 12 01:50:44 2025 >> done (18.200s) 17429154 read pairs processed; of these: 13 ( 0.00%) short read pairs filtered out after trimming by size control 1501 ( 0.01%) empty read pairs filtered out after trimming by size control 17427640 (99.99%) read pairs available; of these: 674159 ( 3.87%) trimmed read pairs available after processing 16753481 (96.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 1 0.00% 25 2 0.00% 26 5 0.00% 27 5 0.00% 28 5 0.00% 29 3 0.00% 30 4 0.00% 31 3 0.00% 32 8 0.00% 33 11 0.00% 34 9 0.00% 35 12 0.00% 36 17 0.00% 37 8 0.00% 38 11 0.00% 39 15 0.00% 40 14 0.00% 41 16 0.00% 42 13 0.00% 43 10 0.00% 44 14 0.00% 45 22 0.00% 46 22 0.00% 47 14 0.00% 48 26 0.00% 49 34 0.00% 50 25 0.00% 51 33 0.00% 52 33 0.00% 53 28 0.00% 54 38 0.00% 55 52 0.00% 56 41 0.00% 57 47 0.00% 58 54 0.00% 59 61 0.00% 60 66 0.00% 61 73 0.00% 62 77 0.00% 63 97 0.00% 64 108 0.00% 65 111 0.00% 66 105 0.00% 67 132 0.00% 68 143 0.00% 69 161 0.00% 70 154 0.00% 71 206 0.00% 72 238 0.00% 73 262 0.00% 74 323 0.00% 75 317 0.00% 76 370 0.00% 77 395 0.00% 78 373 0.00% 79 496 0.00% 80 528 0.00% 81 556 0.00% 82 711 0.00% 83 793 0.00% 84 817 0.00% 85 987 0.01% 86 1064 0.01% 87 1076 0.01% 88 1127 0.01% 89 1254 0.01% 90 1429 0.01% 91 1551 0.01% 92 1749 0.01% 93 2037 0.01% 94 2212 0.01% 95 2275 0.01% 96 2439 0.01% 97 2518 0.01% 98 2559 0.01% 99 2813 0.02% 100 3136 0.02% 101 3430 0.02% 102 3706 0.02% 103 4059 0.02% 104 4335 0.02% 105 4518 0.03% 106 4774 0.03% 107 4948 0.03% 108 5155 0.03% 109 5278 0.03% 110 5615 0.03% 111 5810 0.03% 112 6281 0.04% 113 6744 0.04% 114 7195 0.04% 115 7717 0.04% 116 7940 0.05% 117 8355 0.05% 118 8548 0.05% 119 8651 0.05% 120 9053 0.05% 121 9420 0.05% 122 10078 0.06% 123 10710 0.06% 124 11191 0.06% 125 11646 0.07% 126 12114 0.07% 127 12616 0.07% 128 12701 0.07% 129 13093 0.08% 130 13526 0.08% 131 13832 0.08% 132 14509 0.08% 133 15257 0.09% 134 15917 0.09% 135 16827 0.10% 136 17560 0.10% 137 17684 0.10% 138 18356 0.11% 139 18589 0.11% 140 18590 0.11% 141 19418 0.11% 142 20089 0.12% 143 20756 0.12% 144 22101 0.13% 145 23064 0.13% 146 24112 0.14% 147 24398 0.14% 148 24980 0.14% 149 25038 0.14% 150 25308 0.15% 151 16753481 96.13% 17427640 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.75 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=43.16 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.8 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=21 prefix-density=0.93 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=36.75 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.9 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCT SRR12671667 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:51:36 Started mapping on | Feb 12 01:51:36 Finished on | Feb 12 01:53:26 Mapping speed, Million of reads per hour | 570.36 Number of input reads | 17427640 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 16302198 Uniquely mapped reads % | 93.54% Average mapped length | 299.30 Number of splices: Total | 16761787 Number of splices: Annotated (sjdb) | 16476224 Number of splices: GT/AG | 16431955 Number of splices: GC/AG | 281846 Number of splices: AT/AC | 10292 Number of splices: Non-canonical | 37694 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 419130 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 88117 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.43% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 706312 706312 706312 N_multimapping 419130 419130 419130 N_noFeature 372937 16047926 442527 N_ambiguous 292784 941 107733 UnstrandedReadsAssigned:15636477 PositiveStrandReadsAssigned:253331 NegativeStrandReadsAssigned:15751938 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671667 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671667-trimmed-pair1.fastq SRR12671667-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,427,640 reads, 15,812,465 reads pseudoaligned [quant] estimated average fragment length: 306.107 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR12671667.ke.tsv 34699 SRR12671667.se.tsv 87100 total ==> SRR12671667.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1712.89 590 18.8103 Potri.005G024800.1.v4.1 1035 729.893 156 11.6718 Potri.004G059700.1.v4.1 961 656.327 16 1.33129 Potri.007G009000.2.v4.1 1416 1110.89 0 0 Potri.003G141000.2.v4.1 2943 2637.89 799 16.541 Potri.016G087400.1.v4.1 270 68.5004 750 597.918 Potri.015G069301.1.v4.1 564 283.741 0 0 Potri.010G195200.1.v4.1 1773 1467.89 34 1.26491 Potri.012G127500.1.v4.1 977 672.149 131 10.6434 ==> SRR12671667.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 615 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 299 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671667 completed mapping pipeline successfully