Starting /dee2/code/volunteer_pipeline.sh SRR12671668 current disk space = 3050861223936 free memory = 1571796880 SRR12671668 SRAfilesize ab975f8adca847a0357cc3a9699e2e91 SRR12671668.sra SRR12671668.sra file validated SRR12671668 is paired end SRR12671668 is conventional basespace SRR12671668 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671668_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.371 37.0 37.0 37.0 37.0 37.0 2 36.26275 37.0 37.0 37.0 37.0 37.0 3 36.6225 37.0 37.0 37.0 37.0 37.0 4 36.5935 37.0 37.0 37.0 37.0 37.0 5 36.534 37.0 37.0 37.0 37.0 37.0 6 36.5375 37.0 37.0 37.0 37.0 37.0 7 36.4885 37.0 37.0 37.0 37.0 37.0 8 36.5735 37.0 37.0 37.0 37.0 37.0 9 36.624 37.0 37.0 37.0 37.0 37.0 10-14 36.596700000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.561099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.581900000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.5212 37.0 37.0 37.0 37.0 37.0 30-34 36.5142 37.0 37.0 37.0 37.0 37.0 35-39 36.484300000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.4653 37.0 37.0 37.0 37.0 37.0 45-49 36.4827 37.0 37.0 37.0 37.0 37.0 50-54 36.4928 37.0 37.0 37.0 37.0 37.0 55-59 36.387800000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.42960000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.422700000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.363800000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.34740000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.3771 37.0 37.0 37.0 37.0 37.0 85-89 36.321 37.0 37.0 37.0 37.0 37.0 90-94 36.3349 37.0 37.0 37.0 37.0 37.0 95-99 36.2094 37.0 37.0 37.0 37.0 37.0 100-104 36.2839 37.0 37.0 37.0 37.0 37.0 105-109 36.2185 37.0 37.0 37.0 37.0 37.0 110-114 36.1777 37.0 37.0 37.0 37.0 37.0 115-119 36.1908 37.0 37.0 37.0 37.0 37.0 120-124 36.124900000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.0791 37.0 37.0 37.0 37.0 37.0 130-134 36.037400000000005 37.0 37.0 37.0 37.0 37.0 135-139 36.075300000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.9973 37.0 37.0 37.0 37.0 37.0 145-149 35.9294 37.0 37.0 37.0 37.0 37.0 150-151 35.3885 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 0.0 25 0.0 26 1.0 27 5.0 28 10.0 29 15.0 30 21.0 31 28.0 32 47.0 33 65.0 34 106.0 35 319.0 36 2978.0 37 402.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.0 14.499999999999998 12.174999999999999 43.325 2 20.200752823086574 20.55207026348808 39.974905897114176 19.27227101631117 3 18.075 25.624999999999996 26.724999999999998 29.575000000000003 4 20.724999999999998 34.949999999999996 22.75 21.575 5 21.325 37.6 22.95 18.125 6 17.25 35.675000000000004 26.325 20.75 7 13.750000000000002 20.375 46.675 19.2 8 18.025 22.0 29.575000000000003 30.4 9 18.099999999999998 21.75 33.050000000000004 27.1 10-14 19.965 29.24 26.345000000000002 24.45 15-19 19.145 28.02 28.335 24.5 20-24 20.01 28.18 27.584999999999997 24.224999999999998 25-29 19.5 28.84 27.63 24.03 30-34 19.395 28.384999999999998 28.634999999999998 23.585 35-39 19.545 28.455000000000002 28.15 23.849999999999998 40-44 19.945 27.97 28.055000000000003 24.03 45-49 20.580000000000002 28.675 26.995 23.75 50-54 19.49 28.199999999999996 27.915 24.395 55-59 19.845 28.384999999999998 27.425 24.345 60-64 20.419999999999998 28.04 27.61 23.93 65-69 20.155 28.689999999999998 27.21 23.945 70-74 20.29 28.694999999999997 27.13 23.885 75-79 19.835 29.220000000000002 27.525 23.419999999999998 80-84 20.18 28.435 27.224999999999998 24.16 85-89 20.445 28.64 27.355 23.56 90-94 19.85 28.634999999999998 27.450000000000003 24.065 95-99 20.52 28.405 27.715 23.36 100-104 20.41 28.82 26.88 23.89 105-109 20.34 28.349999999999998 26.715 24.595 110-114 20.66 27.925 27.98 23.435 115-119 20.965 27.97 27.27 23.794999999999998 120-124 20.48 28.24 27.584999999999997 23.695 125-129 20.905 27.505000000000003 27.655 23.935000000000002 130-134 20.525 28.299999999999997 27.99 23.185 135-139 20.445 27.935 27.735 23.885 140-144 21.044999999999998 28.825 26.840000000000003 23.29 145-149 20.990000000000002 27.925 27.52 23.565 150-151 20.65 29.299999999999997 26.700000000000003 23.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 2.0 22 1.5 23 3.0 24 4.5 25 5.5 26 5.5 27 5.0 28 9.0 29 14.5 30 20.0 31 25.0 32 29.5 33 47.0 34 65.5 35 78.5 36 92.5 37 101.5 38 117.5 39 156.5 40 196.0 41 226.5 42 248.5 43 248.5 44 269.0 45 277.0 46 253.0 47 253.5 48 230.0 49 203.0 50 182.0 51 133.5 52 104.5 53 78.0 54 58.5 55 60.5 56 55.0 57 42.5 58 28.5 59 20.5 60 13.0 61 9.5 62 7.0 63 1.5 64 3.0 65 4.0 66 2.5 67 2.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 94.65891062929667 89.5 2 4.918032786885246 9.3 3 0.42305658381808564 1.2 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.2000000000000002 0.0 0.0 0.0 0.0 118-119 1.3624999999999998 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.2375 0.0 0.0 0.0 0.0 130-131 2.4125 0.0 0.0 0.0 0.0 132-133 2.6 0.0 0.0 0.0 0.0 134-135 2.7750000000000004 0.0 0.0 0.0 0.0 136-137 3.075 0.0 0.0 0.0 0.0 138-139 3.2874999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAATAC 10 0.006830828 145.0 1 ATTCGTT 10 0.006830828 145.0 145 AATACTT 15 1.1411342E-4 145.0 3 GAATACT 10 0.006830828 145.0 2 ATACTTG 15 1.1411342E-4 145.0 4 TACTTGC 10 0.006830828 145.0 5 GTAATCA 10 0.006830828 145.0 145 >>END_MODULE SRR12671668 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671668_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1485 37.0 37.0 37.0 37.0 37.0 2 35.997 37.0 37.0 37.0 37.0 37.0 3 36.025 37.0 37.0 37.0 37.0 37.0 4 36.1085 37.0 37.0 37.0 37.0 37.0 5 36.205 37.0 37.0 37.0 37.0 37.0 6 36.065 37.0 37.0 37.0 37.0 37.0 7 36.156 37.0 37.0 37.0 37.0 37.0 8 36.235 37.0 37.0 37.0 37.0 37.0 9 36.209 37.0 37.0 37.0 37.0 37.0 10-14 36.142399999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.1661 37.0 37.0 37.0 37.0 37.0 20-24 36.0975 37.0 37.0 37.0 37.0 37.0 25-29 36.0547 37.0 37.0 37.0 37.0 37.0 30-34 36.0557 37.0 37.0 37.0 37.0 37.0 35-39 36.0128 37.0 37.0 37.0 37.0 37.0 40-44 35.9334 37.0 37.0 37.0 37.0 37.0 45-49 35.9967 37.0 37.0 37.0 37.0 37.0 50-54 35.946200000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.8829 37.0 37.0 37.0 37.0 37.0 60-64 35.9061 37.0 37.0 37.0 37.0 37.0 65-69 35.82619999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.840799999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.7499 37.0 37.0 37.0 37.0 37.0 80-84 35.75920000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.728500000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.653 37.0 37.0 37.0 37.0 37.0 95-99 35.693000000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.65 37.0 37.0 37.0 37.0 37.0 105-109 35.54780000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.453500000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.5558 37.0 37.0 37.0 37.0 37.0 120-124 35.516799999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.4599 37.0 37.0 37.0 37.0 37.0 130-134 35.4059 37.0 37.0 37.0 34.6 37.0 135-139 35.39639999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.1588 37.0 37.0 37.0 27.4 37.0 145-149 35.2702 37.0 37.0 37.0 29.8 37.0 150-151 34.848749999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 2.0 21 2.0 22 5.0 23 6.0 24 12.0 25 8.0 26 11.0 27 12.0 28 26.0 29 21.0 30 41.0 31 32.0 32 66.0 33 151.0 34 215.0 35 626.0 36 2577.0 37 181.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.825000000000003 16.475 15.85 36.85 2 24.2 23.45 36.85 15.5 3 19.1 26.900000000000002 31.474999999999998 22.525000000000002 4 22.675 35.475 21.675 20.175 5 23.200000000000003 38.275 21.025 17.5 6 17.025000000000002 38.324999999999996 24.2 20.45 7 17.724999999999998 15.8 44.224999999999994 22.25 8 20.925 22.6 28.575 27.900000000000002 9 21.3 23.375 30.7 24.625 10-14 22.655 28.485 26.985 21.875 15-19 22.605 27.975 28.345 21.075 20-24 22.17 28.215 28.125 21.490000000000002 25-29 22.665 27.950000000000003 28.365000000000002 21.02 30-34 22.189999999999998 27.855 28.299999999999997 21.654999999999998 35-39 22.485 28.58 28.084999999999997 20.849999999999998 40-44 22.49 27.825 28.43 21.255 45-49 22.375 28.18 28.015 21.43 50-54 23.1 27.625 27.865000000000002 21.41 55-59 22.57 28.189999999999998 27.715 21.525 60-64 22.59 28.084999999999997 27.665 21.66 65-69 22.28 27.765 27.575 22.38 70-74 22.495 27.834999999999997 28.065 21.605 75-79 23.11 27.175 28.199999999999996 21.515 80-84 23.115 28.134999999999998 27.295 21.455 85-89 23.080000000000002 28.065 27.439999999999998 21.415 90-94 23.150000000000002 28.050000000000004 27.415 21.385 95-99 22.85 27.500000000000004 28.28 21.37 100-104 23.200000000000003 28.015 27.74 21.044999999999998 105-109 23.72 27.750000000000004 27.555000000000003 20.974999999999998 110-114 23.875 27.62 27.52 20.985 115-119 23.525 28.249999999999996 27.35 20.875 120-124 23.724999999999998 27.625 27.810000000000002 20.84 125-129 23.84 28.244999999999997 27.055 20.86 130-134 24.87 27.175 27.250000000000004 20.705000000000002 135-139 24.44 28.01 27.279999999999998 20.27 140-144 25.025 27.455000000000002 27.455000000000002 20.064999999999998 145-149 24.55 28.18 27.029999999999998 20.24 150-151 25.525 27.2625 27.650000000000002 19.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.5 19 3.0 20 3.0 21 0.5 22 0.5 23 3.0 24 5.0 25 5.0 26 5.0 27 6.0 28 10.0 29 13.5 30 18.5 31 23.0 32 27.0 33 43.0 34 54.5 35 66.5 36 86.0 37 103.5 38 130.0 39 158.0 40 187.0 41 225.5 42 247.0 43 244.5 44 260.5 45 267.5 46 250.5 47 252.0 48 251.0 49 204.5 50 161.5 51 140.0 52 118.0 53 92.5 54 66.5 55 57.0 56 48.0 57 41.5 58 34.5 59 24.5 60 17.5 61 10.0 62 4.5 63 3.0 64 4.0 65 3.5 66 0.5 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.32907348242811 88.575 2 5.085197018104366 9.55 3 0.4792332268370607 1.35 4 0.05324813631522897 0.2 5 0.026624068157614485 0.125 6 0.0 0.0 7 0.0 0.0 8 0.026624068157614485 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 8 0.2 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.4874999999999998 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.8250000000000002 0.0 0.0 0.0 0.0 126-127 2.025 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.3625 0.0 0.0 0.0 0.0 132-133 2.55 0.0 0.0 0.0 0.0 134-135 2.75 0.0 0.0 0.0 0.0 136-137 3.0625 0.0 0.0 0.0 0.0 138-139 3.2874999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078565 spots for SRR12671668.sra Written 1078565 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra Read 1078558 spots for SRR12671668.sra Written 1078558 spots for SRR12671668.sra SRR ids: ['SRR12671668.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5u7o817g SRR12671668.sra spots: 21571167 blocks: [[1, 1078558], [1078559, 2157116], [2157117, 3235674], [3235675, 4314232], [4314233, 5392790], [5392791, 6471348], [6471349, 7549906], [7549907, 8628464], [8628465, 9707022], [9707023, 10785580], [10785581, 11864138], [11864139, 12942696], [12942697, 14021254], [14021255, 15099812], [15099813, 16178370], [16178371, 17256928], [17256929, 18335486], [18335487, 19414044], [19414045, 20492602], [20492603, 21571167]] SRR12671668 file size 7309125 SRR12671668 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671668 SRR12671668_1.fastq SRR12671668_2.fastq Input file: SRR12671668_1.fastq Paired file: SRR12671668_2.fastq trimmed: SRR12671668-trimmed-pair1.fastq, SRR12671668-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:56:45 2025 >> started Wed Feb 12 01:57:08 2025 >> done (22.609s) 21571167 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 10662 ( 0.05%) empty read pairs filtered out after trimming by size control 21560481 (99.95%) read pairs available; of these: 1066036 ( 4.94%) trimmed read pairs available after processing 20494445 (95.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 3 0.00% 25 2 0.00% 26 4 0.00% 27 4 0.00% 28 6 0.00% 29 14 0.00% 30 4 0.00% 31 10 0.00% 32 15 0.00% 33 14 0.00% 34 15 0.00% 35 18 0.00% 36 16 0.00% 37 18 0.00% 38 24 0.00% 39 26 0.00% 40 29 0.00% 41 29 0.00% 42 39 0.00% 43 38 0.00% 44 38 0.00% 45 46 0.00% 46 43 0.00% 47 50 0.00% 48 39 0.00% 49 55 0.00% 50 54 0.00% 51 79 0.00% 52 87 0.00% 53 94 0.00% 54 108 0.00% 55 93 0.00% 56 98 0.00% 57 116 0.00% 58 142 0.00% 59 152 0.00% 60 186 0.00% 61 173 0.00% 62 202 0.00% 63 195 0.00% 64 246 0.00% 65 275 0.00% 66 307 0.00% 67 323 0.00% 68 313 0.00% 69 363 0.00% 70 410 0.00% 71 475 0.00% 72 512 0.00% 73 601 0.00% 74 635 0.00% 75 711 0.00% 76 788 0.00% 77 836 0.00% 78 1012 0.00% 79 1044 0.00% 80 1109 0.01% 81 1262 0.01% 82 1532 0.01% 83 1670 0.01% 84 1828 0.01% 85 2010 0.01% 86 2139 0.01% 87 2214 0.01% 88 2453 0.01% 89 2722 0.01% 90 2932 0.01% 91 3342 0.02% 92 3628 0.02% 93 3948 0.02% 94 4268 0.02% 95 4568 0.02% 96 4775 0.02% 97 5185 0.02% 98 5239 0.02% 99 5725 0.03% 100 6091 0.03% 101 6448 0.03% 102 6969 0.03% 103 7384 0.03% 104 7798 0.04% 105 8180 0.04% 106 8805 0.04% 107 9152 0.04% 108 9409 0.04% 109 9934 0.05% 110 10180 0.05% 111 10749 0.05% 112 11331 0.05% 113 11731 0.05% 114 12404 0.06% 115 13124 0.06% 116 13491 0.06% 117 14004 0.06% 118 14509 0.07% 119 14979 0.07% 120 15367 0.07% 121 16249 0.08% 122 16465 0.08% 123 17361 0.08% 124 18021 0.08% 125 18780 0.09% 126 19206 0.09% 127 19647 0.09% 128 20476 0.09% 129 20827 0.10% 130 21497 0.10% 131 22226 0.10% 132 22961 0.11% 133 24030 0.11% 134 24837 0.12% 135 25307 0.12% 136 25914 0.12% 137 26255 0.12% 138 26899 0.12% 139 27698 0.13% 140 28181 0.13% 141 28800 0.13% 142 30017 0.14% 143 31087 0.14% 144 31985 0.15% 145 32801 0.15% 146 33724 0.16% 147 33767 0.16% 148 34546 0.16% 149 34985 0.16% 150 35660 0.17% 151 20494445 95.06% 21560481 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=31 prefix-density=0.43 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=33.76 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=8.3 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=30 prefix-density=0.83 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=24.48 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=1.4 sequence=TGGCTTCCTCTACGCTCTCCCCTGCCACTCCCTCACAGCTATGCTCTAGCAAGAGTGGCATGTTCTCTCCTACACATGCGGTGTTTGTGAAACCAACAAGGACAAATATGGTG SRR12671668 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:57:49 Started mapping on | Feb 12 01:57:49 Finished on | Feb 12 01:59:58 Mapping speed, Million of reads per hour | 601.69 Number of input reads | 21560481 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20412240 Uniquely mapped reads % | 94.67% Average mapped length | 298.48 Number of splices: Total | 20871631 Number of splices: Annotated (sjdb) | 20428532 Number of splices: GT/AG | 20451386 Number of splices: GC/AG | 345414 Number of splices: AT/AC | 12338 Number of splices: Non-canonical | 62493 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 486980 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 88688 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.56% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 661261 661261 661261 N_multimapping 486980 486980 486980 N_noFeature 787053 20087079 891655 N_ambiguous 349305 1438 127823 UnstrandedReadsAssigned:19275882 PositiveStrandReadsAssigned:323723 NegativeStrandReadsAssigned:19392762 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671668 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671668-trimmed-pair1.fastq SRR12671668-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,560,481 reads, 19,314,931 reads pseudoaligned [quant] estimated average fragment length: 308.183 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR12671668.ke.tsv 34699 SRR12671668.se.tsv 87100 total ==> SRR12671668.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1710.82 893 25.3334 Potri.005G024800.1.v4.1 1035 727.817 455 30.3413 Potri.004G059700.1.v4.1 961 654.352 6 0.445026 Potri.007G009000.2.v4.1 1416 1108.82 0 0 Potri.003G141000.2.v4.1 2943 2635.82 1331 24.508 Potri.016G087400.1.v4.1 270 73.3011 997 660.13 Potri.015G069301.1.v4.1 564 286.602 0 0 Potri.010G195200.1.v4.1 1773 1465.82 93 3.07927 Potri.012G127500.1.v4.1 977 670.139 270 19.5544 ==> SRR12671668.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 190 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 243 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 8 SRR12671668 completed mapping pipeline successfully