Starting /dee2/code/volunteer_pipeline.sh SRR12671669 current disk space = 3050866802688 free memory = 1461269892 SRR12671669 SRAfilesize 7dae2736e1934c17e87aaf0aa6e2ee81 SRR12671669.sra SRR12671669.sra file validated SRR12671669 is paired end SRR12671669 is conventional basespace SRR12671669 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671669_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.354 37.0 37.0 37.0 37.0 37.0 2 36.332 37.0 37.0 37.0 37.0 37.0 3 36.4865 37.0 37.0 37.0 37.0 37.0 4 36.509 37.0 37.0 37.0 37.0 37.0 5 36.5345 37.0 37.0 37.0 37.0 37.0 6 36.5245 37.0 37.0 37.0 37.0 37.0 7 36.455 37.0 37.0 37.0 37.0 37.0 8 36.4475 37.0 37.0 37.0 37.0 37.0 9 36.555 37.0 37.0 37.0 37.0 37.0 10-14 36.525600000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.4992 37.0 37.0 37.0 37.0 37.0 20-24 36.476600000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.4462 37.0 37.0 37.0 37.0 37.0 30-34 36.4534 37.0 37.0 37.0 37.0 37.0 35-39 36.4375 37.0 37.0 37.0 37.0 37.0 40-44 36.416999999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.365300000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.398399999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.3377 37.0 37.0 37.0 37.0 37.0 60-64 36.326499999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3166 37.0 37.0 37.0 37.0 37.0 70-74 36.3143 37.0 37.0 37.0 37.0 37.0 75-79 36.2484 37.0 37.0 37.0 37.0 37.0 80-84 36.273700000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.2561 37.0 37.0 37.0 37.0 37.0 90-94 36.2692 37.0 37.0 37.0 37.0 37.0 95-99 36.1226 37.0 37.0 37.0 37.0 37.0 100-104 36.2183 37.0 37.0 37.0 37.0 37.0 105-109 36.0807 37.0 37.0 37.0 37.0 37.0 110-114 36.17210000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.1759 37.0 37.0 37.0 37.0 37.0 120-124 36.060500000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.023900000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.9212 37.0 37.0 37.0 37.0 37.0 135-139 35.9077 37.0 37.0 37.0 37.0 37.0 140-144 35.844699999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.8168 37.0 37.0 37.0 37.0 37.0 150-151 35.32225 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 1.0 26 4.0 27 9.0 28 13.0 29 20.0 30 24.0 31 40.0 32 50.0 33 85.0 34 115.0 35 307.0 36 2966.0 37 364.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.424999999999997 13.5 13.0 42.075 2 20.335167583791897 19.23461730865433 37.11855927963982 23.311655827913956 3 18.025 27.725 27.125 27.125 4 21.8 32.225 23.25 22.725 5 21.2 37.2 23.275000000000002 18.325 6 19.825 35.275 25.45 19.45 7 14.475 22.475 42.925000000000004 20.125 8 19.325 22.825 29.875 27.975 9 16.875 23.674999999999997 32.175 27.275 10-14 20.015 28.860000000000003 27.04 24.085 15-19 19.919999999999998 28.405 27.474999999999998 24.2 20-24 19.93 27.744999999999997 28.1 24.224999999999998 25-29 18.85 28.625 27.644999999999996 24.88 30-34 19.7 28.470000000000002 27.92 23.91 35-39 19.905 28.57 27.08 24.445 40-44 19.895 28.660000000000004 27.139999999999997 24.305 45-49 20.93 27.905 27.005000000000003 24.16 50-54 20.16 28.660000000000004 27.189999999999998 23.990000000000002 55-59 19.885 28.199999999999996 27.465 24.45 60-64 20.535 27.58 27.800000000000004 24.085 65-69 20.424999999999997 27.215 27.87 24.490000000000002 70-74 20.32 27.825 27.47 24.385 75-79 20.64 27.889999999999997 27.915 23.555 80-84 20.865000000000002 27.33 27.91 23.895 85-89 20.544999999999998 28.22 27.0 24.235 90-94 20.96 27.46 27.275 24.305 95-99 20.61 27.22 27.975 24.195 100-104 20.755000000000003 28.225 26.96 24.060000000000002 105-109 20.79 27.74 27.445000000000004 24.025 110-114 20.735 27.505000000000003 27.72 24.04 115-119 21.285 27.57 27.200000000000003 23.945 120-124 20.705000000000002 27.705000000000002 27.200000000000003 24.39 125-129 20.97 28.205000000000002 27.025 23.799999999999997 130-134 20.95 27.295 27.845 23.91 135-139 21.27 27.474999999999998 27.474999999999998 23.78 140-144 21.07 27.525 27.215 24.19 145-149 21.0 27.175 27.16 24.665 150-151 21.2625 26.687499999999996 27.762500000000003 24.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 1.5 24 1.5 25 4.0 26 7.5 27 9.5 28 10.0 29 9.0 30 15.0 31 23.5 32 27.0 33 40.5 34 59.5 35 75.5 36 89.5 37 107.5 38 122.0 39 144.5 40 178.5 41 205.0 42 217.5 43 226.5 44 261.5 45 258.0 46 249.5 47 255.0 48 235.0 49 217.5 50 175.0 51 147.5 52 141.5 53 110.5 54 81.5 55 67.5 56 55.5 57 47.5 58 34.0 59 25.0 60 20.0 61 12.0 62 8.5 63 4.0 64 3.5 65 5.0 66 3.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.85329018338727 86.075 2 6.472491909385113 12.0 3 0.6202804746494067 1.725 4 0.05393743257820927 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.45 0.0 0.0 0.0 0.0 124-125 1.525 0.0 0.0 0.0 0.0 126-127 1.75 0.0 0.0 0.0 0.0 128-129 1.8125 0.0 0.0 0.0 0.0 130-131 2.0 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.3499999999999996 0.0 0.0 0.0 0.0 136-137 2.6375 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAATTA 10 0.006830828 145.0 7 CAGTCCA 10 0.006830828 145.0 3 AGAAGCT 10 0.006830828 145.0 4 AATTAAA 10 0.006830828 145.0 9 CAATTAA 10 0.006830828 145.0 8 GCCAGTC 10 0.006830828 145.0 1 GTCCAAT 10 0.006830828 145.0 5 TCCAATT 10 0.006830828 145.0 6 AGTCCAA 10 0.006830828 145.0 4 >>END_MODULE SRR12671669 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671669_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9795 37.0 37.0 37.0 37.0 37.0 2 35.825 37.0 37.0 37.0 37.0 37.0 3 35.9825 37.0 37.0 37.0 37.0 37.0 4 36.024 37.0 37.0 37.0 37.0 37.0 5 36.1535 37.0 37.0 37.0 37.0 37.0 6 36.0365 37.0 37.0 37.0 37.0 37.0 7 35.9785 37.0 37.0 37.0 37.0 37.0 8 36.1115 37.0 37.0 37.0 37.0 37.0 9 36.058 37.0 37.0 37.0 37.0 37.0 10-14 36.1019 37.0 37.0 37.0 37.0 37.0 15-19 36.0903 37.0 37.0 37.0 37.0 37.0 20-24 36.0794 37.0 37.0 37.0 37.0 37.0 25-29 35.9914 37.0 37.0 37.0 37.0 37.0 30-34 35.996500000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.9603 37.0 37.0 37.0 37.0 37.0 40-44 35.937200000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.9156 37.0 37.0 37.0 37.0 37.0 50-54 35.9411 37.0 37.0 37.0 37.0 37.0 55-59 35.8628 37.0 37.0 37.0 37.0 37.0 60-64 35.8457 37.0 37.0 37.0 37.0 37.0 65-69 35.81179999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.7789 37.0 37.0 37.0 37.0 37.0 75-79 35.7317 37.0 37.0 37.0 37.0 37.0 80-84 35.6927 37.0 37.0 37.0 37.0 37.0 85-89 35.7213 37.0 37.0 37.0 37.0 37.0 90-94 35.6564 37.0 37.0 37.0 37.0 37.0 95-99 35.722699999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.5952 37.0 37.0 37.0 37.0 37.0 105-109 35.60530000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.4918 37.0 37.0 37.0 37.0 37.0 115-119 35.46560000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.5034 37.0 37.0 37.0 37.0 37.0 125-129 35.3947 37.0 37.0 37.0 34.6 37.0 130-134 35.4084 37.0 37.0 37.0 37.0 37.0 135-139 35.420500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.1139 37.0 37.0 37.0 27.4 37.0 145-149 35.308800000000005 37.0 37.0 37.0 34.6 37.0 150-151 34.7735 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 1.0 15 2.0 16 0.0 17 1.0 18 6.0 19 0.0 20 3.0 21 1.0 22 3.0 23 7.0 24 11.0 25 5.0 26 9.0 27 10.0 28 28.0 29 23.0 30 29.0 31 56.0 32 67.0 33 90.0 34 248.0 35 666.0 36 2593.0 37 137.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.025 18.45 15.925 31.6 2 26.75 23.724999999999998 33.425 16.1 3 20.474999999999998 26.025 33.0 20.5 4 22.900000000000002 34.675 22.900000000000002 19.525000000000002 5 23.400000000000002 36.6 22.25 17.75 6 19.35 37.0 23.674999999999997 19.975 7 17.8 16.775000000000002 42.425000000000004 23.0 8 20.599999999999998 25.05 25.674999999999997 28.675 9 22.075 24.575 28.525 24.825 10-14 22.939999999999998 29.054999999999996 26.31 21.695 15-19 23.22 27.765 27.22 21.795 20-24 22.645 27.839999999999996 27.735 21.78 25-29 22.865 27.79 27.47 21.875 30-34 22.495 28.01 28.02 21.475 35-39 22.74 28.110000000000003 27.38 21.77 40-44 23.13 28.01 27.505000000000003 21.355 45-49 23.16 27.735 27.36 21.745 50-54 23.369999999999997 27.49 26.99 22.15 55-59 23.23 27.55 26.950000000000003 22.27 60-64 22.835 27.38 27.41 22.375 65-69 22.985 27.694999999999997 26.775 22.545 70-74 23.75 27.355 26.93 21.965 75-79 23.435 27.825 26.61 22.13 80-84 23.885 27.63 26.810000000000002 21.675 85-89 23.985 27.189999999999998 26.705000000000002 22.12 90-94 24.215 27.425 27.060000000000002 21.3 95-99 24.044999999999998 27.224999999999998 26.945000000000004 21.785 100-104 23.880000000000003 27.52 27.26 21.34 105-109 23.919999999999998 27.384999999999998 27.215 21.48 110-114 23.830000000000002 27.889999999999997 26.939999999999998 21.34 115-119 24.52 28.1 26.545 20.835 120-124 23.835 27.91 26.68 21.575 125-129 24.535 27.500000000000004 26.58 21.385 130-134 24.19 27.51 26.68 21.62 135-139 24.19 27.855 26.834999999999997 21.12 140-144 24.865000000000002 27.134999999999998 26.979999999999997 21.02 145-149 24.845 27.715 26.63 20.810000000000002 150-151 24.05 27.85 27.1375 20.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 1.0 23 1.5 24 3.0 25 2.0 26 2.0 27 7.0 28 10.0 29 8.0 30 7.5 31 13.5 32 20.0 33 29.5 34 44.5 35 57.5 36 78.0 37 95.5 38 107.5 39 144.5 40 196.0 41 198.5 42 202.0 43 234.0 44 246.0 45 254.0 46 272.5 47 260.5 48 233.0 49 232.5 50 197.5 51 148.5 52 136.0 53 115.5 54 94.5 55 81.0 56 60.5 57 45.5 58 37.5 59 29.5 60 21.0 61 19.0 62 15.0 63 9.0 64 6.0 65 4.0 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 1.0 96 1.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.75 #Duplication Level Percentage of deduplicated Percentage of total 1 93.18059299191374 86.425 2 6.037735849056604 11.200000000000001 3 0.6199460916442049 1.725 4 0.1078167115902965 0.4 5 0.05390835579514825 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit GGTTTGACCCACTTGGATGGGGAAGTGGTTCTCCTGAGAAGATCAAGGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.1125 0.0 0.0 0.0 0.0 118-119 1.2 0.0 0.0 0.0 0.0 120-121 1.325 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.5750000000000002 0.0 0.0 0.0 0.0 126-127 1.7999999999999998 0.0 0.0 0.0 0.0 128-129 1.8624999999999998 0.0 0.0 0.0 0.0 130-131 2.05 0.0 0.0 0.0 0.0 132-133 2.25 0.0 0.0 0.0 0.0 134-135 2.45 0.0 0.0 0.0 0.0 136-137 2.7249999999999996 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTATGG 10 0.006830828 145.0 3 TCCTATG 10 0.006830828 145.0 2 CTCCTAT 10 0.006830828 145.0 1 ATGGACT 10 0.006830828 145.0 6 AGTATGA 10 0.006830828 145.0 8 CTATGGA 10 0.006830828 145.0 4 TATGGAC 10 0.006830828 145.0 5 >>END_MODULE Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834783 spots for SRR12671669.sra Written 834783 spots for SRR12671669.sra Read 834793 spots for SRR12671669.sra Written 834793 spots for SRR12671669.sra SRR ids: ['SRR12671669.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3_map5jb SRR12671669.sra spots: 16695670 blocks: [[1, 834783], [834784, 1669566], [1669567, 2504349], [2504350, 3339132], [3339133, 4173915], [4173916, 5008698], [5008699, 5843481], [5843482, 6678264], [6678265, 7513047], [7513048, 8347830], [8347831, 9182613], [9182614, 10017396], [10017397, 10852179], [10852180, 11686962], [11686963, 12521745], [12521746, 13356528], [13356529, 14191311], [14191312, 15026094], [15026095, 15860877], [15860878, 16695670]] SRR12671669 file size 5652218 SRR12671669 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671669 SRR12671669_1.fastq SRR12671669_2.fastq Input file: SRR12671669_1.fastq Paired file: SRR12671669_2.fastq trimmed: SRR12671669-trimmed-pair1.fastq, SRR12671669-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:35:06 2025 >> started Wed Feb 12 01:35:35 2025 >> done (28.889s) 16695670 read pairs processed; of these: 8 ( 0.00%) short read pairs filtered out after trimming by size control 1565 ( 0.01%) empty read pairs filtered out after trimming by size control 16694097 (99.99%) read pairs available; of these: 826071 ( 4.95%) trimmed read pairs available after processing 15868026 (95.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 3 0.00% 22 4 0.00% 23 0 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 2 0.00% 28 7 0.00% 29 6 0.00% 30 2 0.00% 31 5 0.00% 32 10 0.00% 33 4 0.00% 34 5 0.00% 35 15 0.00% 36 7 0.00% 37 9 0.00% 38 10 0.00% 39 9 0.00% 40 12 0.00% 41 15 0.00% 42 16 0.00% 43 18 0.00% 44 18 0.00% 45 17 0.00% 46 26 0.00% 47 21 0.00% 48 26 0.00% 49 32 0.00% 50 33 0.00% 51 33 0.00% 52 46 0.00% 53 34 0.00% 54 49 0.00% 55 51 0.00% 56 38 0.00% 57 64 0.00% 58 57 0.00% 59 66 0.00% 60 72 0.00% 61 88 0.00% 62 107 0.00% 63 119 0.00% 64 136 0.00% 65 126 0.00% 66 164 0.00% 67 157 0.00% 68 166 0.00% 69 199 0.00% 70 206 0.00% 71 215 0.00% 72 306 0.00% 73 365 0.00% 74 386 0.00% 75 393 0.00% 76 456 0.00% 77 482 0.00% 78 504 0.00% 79 571 0.00% 80 701 0.00% 81 775 0.00% 82 920 0.01% 83 1035 0.01% 84 1127 0.01% 85 1228 0.01% 86 1326 0.01% 87 1463 0.01% 88 1547 0.01% 89 1660 0.01% 90 1787 0.01% 91 2135 0.01% 92 2318 0.01% 93 2611 0.02% 94 2932 0.02% 95 3065 0.02% 96 3139 0.02% 97 3348 0.02% 98 3527 0.02% 99 3746 0.02% 100 4084 0.02% 101 4380 0.03% 102 4791 0.03% 103 4974 0.03% 104 5543 0.03% 105 5673 0.03% 106 6246 0.04% 107 6500 0.04% 108 6703 0.04% 109 6915 0.04% 110 7246 0.04% 111 7580 0.05% 112 8280 0.05% 113 8589 0.05% 114 9099 0.05% 115 9735 0.06% 116 10063 0.06% 117 10556 0.06% 118 10583 0.06% 119 10830 0.06% 120 11342 0.07% 121 11826 0.07% 122 12286 0.07% 123 13349 0.08% 124 14131 0.08% 125 14600 0.09% 126 14939 0.09% 127 15451 0.09% 128 15820 0.09% 129 15997 0.10% 130 16568 0.10% 131 17321 0.10% 132 17898 0.11% 133 19114 0.11% 134 19739 0.12% 135 20486 0.12% 136 21180 0.13% 137 21500 0.13% 138 22298 0.13% 139 22297 0.13% 140 22090 0.13% 141 23246 0.14% 142 24250 0.15% 143 25037 0.15% 144 26550 0.16% 145 27255 0.16% 146 28007 0.17% 147 28822 0.17% 148 29041 0.17% 149 29366 0.18% 150 29513 0.18% 151 15868026 95.05% 16694097 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=22 prefix-density=0.65 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=55.58 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.1 sequence=ACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=23 prefix-density=0.77 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=27.83 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR12671669 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:36:52 Started mapping on | Feb 12 01:36:52 Finished on | Feb 12 01:41:23 Mapping speed, Million of reads per hour | 221.77 Number of input reads | 16694097 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14944522 Uniquely mapped reads % | 89.52% Average mapped length | 291.23 Number of splices: Total | 15145121 Number of splices: Annotated (sjdb) | 14869688 Number of splices: GT/AG | 14837175 Number of splices: GC/AG | 258549 Number of splices: AT/AC | 8937 Number of splices: Non-canonical | 40460 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390092 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 215192 % of reads mapped to too many loci | 1.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.63% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1359483 1359483 1359483 N_multimapping 390092 390092 390092 N_noFeature 499772 14672311 570984 N_ambiguous 325130 1571 123072 UnstrandedReadsAssigned:14119620 PositiveStrandReadsAssigned:270640 NegativeStrandReadsAssigned:14250466 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=143 echo kmer=139 SRR12671669 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671669-trimmed-pair1.fastq SRR12671669-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,694,097 reads, 14,926,088 reads pseudoaligned [quant] estimated average fragment length: 283.06 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR12671669.ke.tsv 34699 SRR12671669.se.tsv 87100 total ==> SRR12671669.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.94 592 18.8267 Potri.005G024800.1.v4.1 1035 752.94 219 16.0573 Potri.004G059700.1.v4.1 961 679.151 3 0.243861 Potri.007G009000.2.v4.1 1416 1133.94 0 0 Potri.003G141000.2.v4.1 2943 2660.94 772.477 16.0265 Potri.016G087400.1.v4.1 270 75.8296 631 459.387 Potri.015G069301.1.v4.1 564 300.557 0 0 Potri.010G195200.1.v4.1 1773 1490.94 86 3.18439 Potri.012G127500.1.v4.1 977 695.052 135 10.7227 ==> SRR12671669.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 311 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 296 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671669 completed mapping pipeline successfully