Starting /dee2/code/volunteer_pipeline.sh SRR12671670 current disk space = 3050483019776 free memory = 1535300376 SRR12671670 SRAfilesize 9780d6fa43509508aa0fa207fb0b2ee2 SRR12671670.sra SRR12671670.sra file validated SRR12671670 is paired end SRR12671670 is conventional basespace SRR12671670 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671670_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4575 37.0 37.0 37.0 37.0 37.0 2 36.29575 37.0 37.0 37.0 37.0 37.0 3 36.515 37.0 37.0 37.0 37.0 37.0 4 36.6045 37.0 37.0 37.0 37.0 37.0 5 36.5805 37.0 37.0 37.0 37.0 37.0 6 36.465 37.0 37.0 37.0 37.0 37.0 7 36.484 37.0 37.0 37.0 37.0 37.0 8 36.4795 37.0 37.0 37.0 37.0 37.0 9 36.5245 37.0 37.0 37.0 37.0 37.0 10-14 36.5923 37.0 37.0 37.0 37.0 37.0 15-19 36.5355 37.0 37.0 37.0 37.0 37.0 20-24 36.537 37.0 37.0 37.0 37.0 37.0 25-29 36.506600000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.502500000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.434099999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.4457 37.0 37.0 37.0 37.0 37.0 45-49 36.4101 37.0 37.0 37.0 37.0 37.0 50-54 36.3635 37.0 37.0 37.0 37.0 37.0 55-59 36.3682 37.0 37.0 37.0 37.0 37.0 60-64 36.353100000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.381600000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.3482 37.0 37.0 37.0 37.0 37.0 75-79 36.2961 37.0 37.0 37.0 37.0 37.0 80-84 36.3072 37.0 37.0 37.0 37.0 37.0 85-89 36.324 37.0 37.0 37.0 37.0 37.0 90-94 36.2694 37.0 37.0 37.0 37.0 37.0 95-99 36.2299 37.0 37.0 37.0 37.0 37.0 100-104 36.309799999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.17960000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.2154 37.0 37.0 37.0 37.0 37.0 115-119 36.195100000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.122699999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.1528 37.0 37.0 37.0 37.0 37.0 130-134 36.0068 37.0 37.0 37.0 37.0 37.0 135-139 35.973 37.0 37.0 37.0 37.0 37.0 140-144 36.0249 37.0 37.0 37.0 37.0 37.0 145-149 35.9347 37.0 37.0 37.0 37.0 37.0 150-151 35.533249999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 3.0 26 1.0 27 8.0 28 11.0 29 23.0 30 23.0 31 28.0 32 46.0 33 68.0 34 100.0 35 307.0 36 2995.0 37 384.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.1 12.475 12.925 43.5 2 20.145326985717865 18.59183162114758 39.31345527436733 21.949386118767226 3 19.025 22.375 27.200000000000003 31.4 4 22.900000000000002 31.624999999999996 22.5 22.975 5 23.599999999999998 34.65 24.05 17.7 6 19.0 35.075 24.85 21.075 7 14.149999999999999 22.2 43.3 20.349999999999998 8 18.5 23.75 29.625 28.125 9 18.8 22.15 32.324999999999996 26.724999999999998 10-14 19.950000000000003 28.875 26.86 24.315 15-19 20.244999999999997 27.534999999999997 27.775 24.445 20-24 19.57 27.57 28.689999999999998 24.169999999999998 25-29 19.97 28.04 27.584999999999997 24.404999999999998 30-34 20.105 27.644999999999996 27.42 24.83 35-39 20.305 27.605 27.515 24.575 40-44 20.41 27.900000000000002 27.689999999999998 24.0 45-49 20.974999999999998 27.54 27.48 24.005000000000003 50-54 21.0 27.77 26.974999999999998 24.255 55-59 20.585 28.02 26.86 24.535 60-64 20.405 27.400000000000002 28.384999999999998 23.810000000000002 65-69 21.060000000000002 26.745 27.905 24.29 70-74 20.735 27.6 27.42 24.245 75-79 20.53 27.325 28.060000000000002 24.085 80-84 20.345 27.785 27.900000000000002 23.97 85-89 21.060000000000002 27.389999999999997 27.139999999999997 24.41 90-94 21.2 27.544999999999998 27.084999999999997 24.169999999999998 95-99 21.185000000000002 26.85 27.42 24.545 100-104 22.045 27.26 26.88 23.815 105-109 20.925 27.27 27.615000000000002 24.19 110-114 21.709999999999997 26.805 27.589999999999996 23.895 115-119 21.305 27.155 27.325 24.215 120-124 21.305 27.705000000000002 27.215 23.775 125-129 21.615000000000002 27.35 26.905 24.13 130-134 21.68 27.57 27.185 23.565 135-139 21.815 26.595000000000002 27.415 24.175 140-144 21.825 26.765 27.425 23.985 145-149 21.725 27.975 26.5 23.799999999999997 150-151 20.8625 26.950000000000003 26.974999999999998 25.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 2.5 24 3.0 25 0.5 26 3.0 27 6.0 28 7.0 29 10.5 30 12.5 31 17.0 32 25.0 33 28.0 34 40.0 35 52.0 36 61.0 37 96.0 38 126.5 39 138.5 40 170.5 41 198.0 42 204.0 43 230.0 44 260.5 45 278.0 46 296.5 47 278.5 48 240.5 49 228.5 50 206.0 51 164.0 52 135.5 53 118.0 54 91.0 55 63.5 56 54.0 57 45.5 58 28.5 59 21.5 60 20.0 61 11.5 62 6.5 63 6.5 64 4.5 65 3.0 66 1.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.45 #Duplication Level Percentage of deduplicated Percentage of total 1 93.57945425361156 87.45 2 5.858747993579454 10.95 3 0.5350454788657035 1.5 4 0.026752273943285176 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.8374999999999999 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.6749999999999998 0.0 0.0 0.0 0.0 120-121 1.8 0.0 0.0 0.0 0.0 122-123 2.0625 0.0 0.0 0.0 0.0 124-125 2.2750000000000004 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.6875 0.0 0.0 0.0 0.0 130-131 2.8625 0.0 0.0 0.0 0.0 132-133 3.0999999999999996 0.0 0.0 0.0 0.0 134-135 3.3499999999999996 0.0 0.0 0.0 0.0 136-137 3.675 0.0 0.0 0.0 0.0 138-139 4.112500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACATAG 10 0.006830828 145.0 7 ACATAGA 10 0.006830828 145.0 8 CCCCCAA 10 0.006830828 145.0 9 >>END_MODULE SRR12671670 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671670_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2785 37.0 37.0 37.0 37.0 37.0 2 36.088 37.0 37.0 37.0 37.0 37.0 3 36.1855 37.0 37.0 37.0 37.0 37.0 4 36.171 37.0 37.0 37.0 37.0 37.0 5 36.3185 37.0 37.0 37.0 37.0 37.0 6 36.268 37.0 37.0 37.0 37.0 37.0 7 36.2595 37.0 37.0 37.0 37.0 37.0 8 36.311 37.0 37.0 37.0 37.0 37.0 9 36.208 37.0 37.0 37.0 37.0 37.0 10-14 36.274 37.0 37.0 37.0 37.0 37.0 15-19 36.34159999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.28680000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.2781 37.0 37.0 37.0 37.0 37.0 30-34 36.25 37.0 37.0 37.0 37.0 37.0 35-39 36.179500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1676 37.0 37.0 37.0 37.0 37.0 45-49 36.215999999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.1774 37.0 37.0 37.0 37.0 37.0 55-59 36.082 37.0 37.0 37.0 37.0 37.0 60-64 36.0819 37.0 37.0 37.0 37.0 37.0 65-69 36.0757 37.0 37.0 37.0 37.0 37.0 70-74 36.030899999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.977999999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.035999999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.9837 37.0 37.0 37.0 37.0 37.0 90-94 35.9422 37.0 37.0 37.0 37.0 37.0 95-99 35.934900000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.9434 37.0 37.0 37.0 37.0 37.0 105-109 35.8717 37.0 37.0 37.0 37.0 37.0 110-114 35.861000000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.7937 37.0 37.0 37.0 37.0 37.0 120-124 35.823499999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.6539 37.0 37.0 37.0 37.0 37.0 130-134 35.774800000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.6882 37.0 37.0 37.0 37.0 37.0 140-144 35.3561 37.0 37.0 37.0 32.2 37.0 145-149 35.595800000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.07825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 3.0 19 0.0 20 0.0 21 0.0 22 0.0 23 6.0 24 8.0 25 7.0 26 12.0 27 9.0 28 15.0 29 14.0 30 28.0 31 36.0 32 52.0 33 70.0 34 187.0 35 535.0 36 2785.0 37 230.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.2 17.724999999999998 16.5 32.574999999999996 2 25.95 23.9 34.25 15.9 3 22.900000000000002 26.400000000000002 30.325000000000003 20.375 4 24.349999999999998 34.275 21.45 19.925 5 25.424999999999997 35.85 21.625 17.1 6 18.425 38.1 23.425 20.05 7 18.9 17.375 41.05 22.675 8 21.7 22.675 27.700000000000003 27.925 9 23.225 24.25 28.625 23.9 10-14 23.57 28.98 25.47 21.98 15-19 23.635 27.279999999999998 27.37 21.715 20-24 22.67 28.199999999999996 27.01 22.12 25-29 22.71 28.215 26.950000000000003 22.125 30-34 23.26 28.49 26.645000000000003 21.605 35-39 23.080000000000002 28.71 27.155 21.055 40-44 23.325000000000003 28.03 27.189999999999998 21.455 45-49 22.73 28.144999999999996 27.04 22.085 50-54 23.47 27.785 26.490000000000002 22.255 55-59 23.43 28.060000000000002 26.534999999999997 21.975 60-64 23.425 26.905 27.439999999999998 22.23 65-69 23.474999999999998 27.315 27.169999999999998 22.040000000000003 70-74 23.625 27.810000000000002 26.284999999999997 22.28 75-79 24.14 27.634999999999998 26.46 21.765 80-84 23.94 27.950000000000003 26.009999999999998 22.1 85-89 24.025 28.055000000000003 26.11 21.81 90-94 24.325 27.71 26.590000000000003 21.375 95-99 23.799999999999997 27.755000000000003 26.72 21.725 100-104 23.57 27.595 26.634999999999998 22.2 105-109 23.615 27.915 26.695 21.775 110-114 23.515 27.67 26.895000000000003 21.92 115-119 24.3 27.689999999999998 26.5 21.51 120-124 25.035 27.884999999999998 25.974999999999998 21.105 125-129 24.59 27.655 26.365 21.39 130-134 24.58 27.42 26.695 21.305 135-139 24.795 27.775 26.41 21.02 140-144 24.709999999999997 27.485 25.965 21.84 145-149 24.87 28.449999999999996 26.009999999999998 20.669999999999998 150-151 25.162499999999998 27.500000000000004 25.6125 21.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 2.5 17 2.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 2.0 26 2.0 27 2.5 28 4.0 29 3.5 30 4.5 31 6.0 32 11.5 33 21.5 34 26.5 35 37.0 36 54.5 37 77.5 38 114.0 39 146.5 40 163.0 41 200.5 42 227.0 43 241.5 44 285.5 45 309.5 46 298.5 47 265.5 48 241.5 49 223.5 50 186.0 51 154.5 52 131.5 53 105.0 54 96.0 55 89.5 56 77.0 57 56.5 58 35.0 59 26.5 60 18.0 61 10.0 62 9.5 63 10.0 64 5.0 65 3.5 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.975 #Duplication Level Percentage of deduplicated Percentage of total 1 93.3046517881151 86.75 2 6.050013444474321 11.25 3 0.4840010755579457 1.35 4 0.10755579456843238 0.4 5 0.05377789728421619 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.4875 0.0 0.0 0.0 0.0 118-119 1.7000000000000002 0.0 0.0 0.0 0.0 120-121 1.825 0.0 0.0 0.0 0.0 122-123 2.0875 0.0 0.0 0.0 0.0 124-125 2.3 0.0 0.0 0.0 0.0 126-127 2.575 0.0 0.0 0.0 0.0 128-129 2.7375 0.0 0.0 0.0 0.0 130-131 2.9125 0.0 0.0 0.0 0.0 132-133 3.1500000000000004 0.0 0.0 0.0 0.0 134-135 3.4000000000000004 0.0 0.0 0.0 0.0 136-137 3.725 0.0 0.0 0.0 0.0 138-139 4.175000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794760 spots for SRR12671670.sra Written 794760 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra Read 794753 spots for SRR12671670.sra Written 794753 spots for SRR12671670.sra SRR ids: ['SRR12671670.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yidi0npv SRR12671670.sra spots: 15895067 blocks: [[1, 794753], [794754, 1589506], [1589507, 2384259], [2384260, 3179012], [3179013, 3973765], [3973766, 4768518], [4768519, 5563271], [5563272, 6358024], [6358025, 7152777], [7152778, 7947530], [7947531, 8742283], [8742284, 9537036], [9537037, 10331789], [10331790, 11126542], [11126543, 11921295], [11921296, 12716048], [12716049, 13510801], [13510802, 14305554], [14305555, 15100307], [15100308, 15895067]] SRR12671670 file size 5380138 SRR12671670 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671670 SRR12671670_1.fastq SRR12671670_2.fastq Input file: SRR12671670_1.fastq Paired file: SRR12671670_2.fastq trimmed: SRR12671670-trimmed-pair1.fastq, SRR12671670-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:00:31 2025 >> started Wed Feb 12 02:00:56 2025 >> done (24.276s) 15895067 read pairs processed; of these: 11 ( 0.00%) short read pairs filtered out after trimming by size control 2237 ( 0.01%) empty read pairs filtered out after trimming by size control 15892819 (99.99%) read pairs available; of these: 1068844 ( 6.73%) trimmed read pairs available after processing 14823975 (93.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 1 0.00% 21 4 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 3 0.00% 29 2 0.00% 30 1 0.00% 31 6 0.00% 32 5 0.00% 33 8 0.00% 34 9 0.00% 35 7 0.00% 36 10 0.00% 37 9 0.00% 38 16 0.00% 39 17 0.00% 40 9 0.00% 41 18 0.00% 42 18 0.00% 43 19 0.00% 44 19 0.00% 45 28 0.00% 46 28 0.00% 47 22 0.00% 48 28 0.00% 49 33 0.00% 50 25 0.00% 51 37 0.00% 52 55 0.00% 53 50 0.00% 54 61 0.00% 55 65 0.00% 56 65 0.00% 57 81 0.00% 58 87 0.00% 59 71 0.00% 60 107 0.00% 61 129 0.00% 62 167 0.00% 63 145 0.00% 64 170 0.00% 65 221 0.00% 66 245 0.00% 67 254 0.00% 68 299 0.00% 69 295 0.00% 70 335 0.00% 71 392 0.00% 72 491 0.00% 73 518 0.00% 74 575 0.00% 75 706 0.00% 76 799 0.01% 77 833 0.01% 78 956 0.01% 79 1039 0.01% 80 1138 0.01% 81 1257 0.01% 82 1421 0.01% 83 1665 0.01% 84 1799 0.01% 85 1960 0.01% 86 2236 0.01% 87 2358 0.01% 88 2604 0.02% 89 2800 0.02% 90 3082 0.02% 91 3394 0.02% 92 3637 0.02% 93 4032 0.03% 94 4346 0.03% 95 4621 0.03% 96 4826 0.03% 97 5307 0.03% 98 5311 0.03% 99 5659 0.04% 100 6176 0.04% 101 6451 0.04% 102 6857 0.04% 103 7461 0.05% 104 7652 0.05% 105 8165 0.05% 106 8664 0.05% 107 8934 0.06% 108 9467 0.06% 109 9956 0.06% 110 10178 0.06% 111 10586 0.07% 112 11463 0.07% 113 11589 0.07% 114 12375 0.08% 115 12941 0.08% 116 13237 0.08% 117 13912 0.09% 118 14512 0.09% 119 14565 0.09% 120 15475 0.10% 121 16156 0.10% 122 16562 0.10% 123 17616 0.11% 124 18322 0.12% 125 18635 0.12% 126 19307 0.12% 127 19899 0.13% 128 20359 0.13% 129 20669 0.13% 130 21268 0.13% 131 21936 0.14% 132 23164 0.15% 133 24134 0.15% 134 24666 0.16% 135 25662 0.16% 136 25892 0.16% 137 26539 0.17% 138 27397 0.17% 139 27882 0.18% 140 28283 0.18% 141 28901 0.18% 142 29854 0.19% 143 30982 0.19% 144 32754 0.21% 145 33299 0.21% 146 34402 0.22% 147 34324 0.22% 148 35211 0.22% 149 35531 0.22% 150 35559 0.22% 151 14823975 93.27% 15892819 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=17 prefix-density=0.78 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=15.10 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.3 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=19 prefix-density=1.01 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=23.55 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.8 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR12671670 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:01:42 Started mapping on | Feb 12 02:01:42 Finished on | Feb 12 02:03:36 Mapping speed, Million of reads per hour | 501.88 Number of input reads | 15892819 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14896295 Uniquely mapped reads % | 93.73% Average mapped length | 298.04 Number of splices: Total | 15961720 Number of splices: Annotated (sjdb) | 15704462 Number of splices: GT/AG | 15638989 Number of splices: GC/AG | 281081 Number of splices: AT/AC | 8066 Number of splices: Non-canonical | 33584 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351871 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 169774 % of reads mapped to too many loci | 1.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 644653 644653 644653 N_multimapping 351871 351871 351871 N_noFeature 413622 14651557 476195 N_ambiguous 268415 1107 85531 UnstrandedReadsAssigned:14214258 PositiveStrandReadsAssigned:243631 NegativeStrandReadsAssigned:14334569 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671670 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671670-trimmed-pair1.fastq SRR12671670-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,892,819 reads, 14,392,199 reads pseudoaligned [quant] estimated average fragment length: 281.959 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,009 rounds 52401 SRR12671670.ke.tsv 34699 SRR12671670.se.tsv 87100 total ==> SRR12671670.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.04 507 16.6832 Potri.005G024800.1.v4.1 1035 754.041 230 17.4347 Potri.004G059700.1.v4.1 961 680.352 1 0.0840132 Potri.007G009000.2.v4.1 1416 1135.04 0 0 Potri.003G141000.2.v4.1 2943 2662.04 850 18.251 Potri.016G087400.1.v4.1 270 76.0594 704 529.055 Potri.015G069301.1.v4.1 564 300.93 0 0 Potri.010G195200.1.v4.1 1773 1492.04 45.9055 1.75859 Potri.012G127500.1.v4.1 977 696.251 71 5.82873 ==> SRR12671670.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 56 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 184 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12671670 completed mapping pipeline successfully