Starting /dee2/code/volunteer_pipeline.sh SRR12671671 current disk space = 3050793152512 free memory = 1495794672 SRR12671671 SRAfilesize db37a4a128c53f90d39205618785c4e3 SRR12671671.sra SRR12671671.sra file validated SRR12671671 is paired end SRR12671671 is conventional basespace SRR12671671 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671671_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.306 37.0 37.0 37.0 37.0 37.0 2 36.192 37.0 37.0 37.0 37.0 37.0 3 36.4335 37.0 37.0 37.0 37.0 37.0 4 36.481 37.0 37.0 37.0 37.0 37.0 5 36.552 37.0 37.0 37.0 37.0 37.0 6 36.3745 37.0 37.0 37.0 37.0 37.0 7 36.4505 37.0 37.0 37.0 37.0 37.0 8 36.4085 37.0 37.0 37.0 37.0 37.0 9 36.466 37.0 37.0 37.0 37.0 37.0 10-14 36.5031 37.0 37.0 37.0 37.0 37.0 15-19 36.488099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4699 37.0 37.0 37.0 37.0 37.0 25-29 36.437400000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4968 37.0 37.0 37.0 37.0 37.0 35-39 36.4009 37.0 37.0 37.0 37.0 37.0 40-44 36.407799999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.394999999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.399899999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.3637 37.0 37.0 37.0 37.0 37.0 60-64 36.37670000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.286899999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.2582 37.0 37.0 37.0 37.0 37.0 75-79 36.2274 37.0 37.0 37.0 37.0 37.0 80-84 36.2407 37.0 37.0 37.0 37.0 37.0 85-89 36.214 37.0 37.0 37.0 37.0 37.0 90-94 36.148 37.0 37.0 37.0 37.0 37.0 95-99 36.11460000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.136 37.0 37.0 37.0 37.0 37.0 105-109 36.0253 37.0 37.0 37.0 37.0 37.0 110-114 36.1118 37.0 37.0 37.0 37.0 37.0 115-119 36.081900000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.028200000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.9739 37.0 37.0 37.0 37.0 37.0 130-134 36.013600000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.907 37.0 37.0 37.0 37.0 37.0 140-144 35.7607 37.0 37.0 37.0 37.0 37.0 145-149 35.715999999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.31425 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 0.0 26 4.0 27 8.0 28 18.0 29 19.0 30 25.0 31 40.0 32 56.0 33 93.0 34 116.0 35 331.0 36 2919.0 37 369.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.825 16.025 9.5 40.65 2 18.072289156626507 20.406626506024097 41.265060240963855 20.25602409638554 3 16.45 27.650000000000002 30.45 25.45 4 20.849999999999998 33.15 24.275 21.725 5 20.424999999999997 37.6 23.5 18.475 6 16.875 36.325 25.275 21.525 7 13.55 22.95 43.25 20.25 8 17.349999999999998 24.025 30.15 28.475 9 17.25 23.275000000000002 32.574999999999996 26.900000000000002 10-14 19.6 28.845 27.125 24.43 15-19 19.89 28.310000000000002 27.35 24.45 20-24 19.73 28.395 28.32 23.555 25-29 19.88 28.244999999999997 27.96 23.915 30-34 19.675 28.615000000000002 27.58 24.13 35-39 20.305 28.46 27.27 23.965 40-44 19.71 28.92 28.005000000000003 23.365 45-49 19.794999999999998 28.060000000000002 27.900000000000002 24.245 50-54 19.939999999999998 28.915000000000003 27.775 23.369999999999997 55-59 20.23 28.22 27.315 24.235 60-64 19.665 28.725 27.860000000000003 23.75 65-69 20.02 27.74 28.235 24.005000000000003 70-74 20.32 28.525 27.705000000000002 23.45 75-79 20.09 27.93 27.800000000000004 24.18 80-84 20.3 27.875 27.735 24.09 85-89 20.04 27.915 27.834999999999997 24.21 90-94 20.315 28.825 26.93 23.93 95-99 20.49 28.294999999999998 27.68 23.535 100-104 20.23 28.57 27.07 24.13 105-109 20.015 28.335 27.935 23.715 110-114 20.465 28.244999999999997 27.375 23.915 115-119 20.75 27.91 27.37 23.97 120-124 20.75 27.6 27.794999999999998 23.855 125-129 20.34 28.945 27.21 23.505000000000003 130-134 20.9 28.23 26.935 23.935000000000002 135-139 21.125 28.615000000000002 26.279999999999998 23.98 140-144 20.674999999999997 27.655 27.05 24.62 145-149 20.31 28.115000000000002 27.04 24.535 150-151 21.512500000000003 27.9375 27.0625 23.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 1.5 24 3.5 25 2.5 26 2.0 27 4.5 28 8.5 29 16.0 30 23.0 31 29.0 32 29.0 33 40.0 34 55.5 35 64.0 36 92.5 37 126.0 38 146.5 39 158.0 40 186.0 41 237.0 42 263.5 43 257.5 44 249.5 45 260.0 46 274.0 47 255.5 48 212.0 49 195.0 50 177.0 51 140.5 52 114.0 53 89.0 54 74.0 55 57.0 56 42.0 57 32.0 58 21.5 59 15.5 60 10.5 61 11.5 62 9.5 63 3.5 64 2.0 65 2.5 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.325 #Duplication Level Percentage of deduplicated Percentage of total 1 94.48714550755368 89.125 2 5.08878876225815 9.6 3 0.3710575139146568 1.05 4 0.026504108136761195 0.1 5 0.026504108136761195 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACATATCTTCACCAAGCAACAATTTTGCAAACCTCTCCTTTATCATGTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 3.15 0.0 0.0 0.0 0.0 118-119 3.5999999999999996 0.0 0.0 0.0 0.0 120-121 3.875 0.0 0.0 0.0 0.0 122-123 4.225 0.0 0.0 0.0 0.0 124-125 4.825 0.0 0.0 0.0 0.0 126-127 5.4375 0.0 0.0 0.0 0.0 128-129 6.05 0.0 0.0 0.0 0.0 130-131 6.6125 0.0 0.0 0.0 0.0 132-133 7.012499999999999 0.0 0.0 0.0 0.0 134-135 7.5375 0.0 0.0 0.0 0.0 136-137 8.075 0.0 0.0 0.0 0.0 138-139 8.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTCAA 10 0.006830828 145.0 5 CATAGCA 10 0.006830828 145.0 7 GCATAGC 10 0.006830828 145.0 6 >>END_MODULE SRR12671671 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671671_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2705 37.0 37.0 37.0 37.0 37.0 2 36.124 37.0 37.0 37.0 37.0 37.0 3 36.243 37.0 37.0 37.0 37.0 37.0 4 36.214 37.0 37.0 37.0 37.0 37.0 5 36.2345 37.0 37.0 37.0 37.0 37.0 6 36.241 37.0 37.0 37.0 37.0 37.0 7 36.3135 37.0 37.0 37.0 37.0 37.0 8 36.3755 37.0 37.0 37.0 37.0 37.0 9 36.322 37.0 37.0 37.0 37.0 37.0 10-14 36.3854 37.0 37.0 37.0 37.0 37.0 15-19 36.295100000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.2957 37.0 37.0 37.0 37.0 37.0 25-29 36.2851 37.0 37.0 37.0 37.0 37.0 30-34 36.2104 37.0 37.0 37.0 37.0 37.0 35-39 36.200900000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.146699999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.1712 37.0 37.0 37.0 37.0 37.0 50-54 36.1283 37.0 37.0 37.0 37.0 37.0 55-59 36.133399999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.0363 37.0 37.0 37.0 37.0 37.0 65-69 36.04879999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.0726 37.0 37.0 37.0 37.0 37.0 75-79 36.0012 37.0 37.0 37.0 37.0 37.0 80-84 35.9593 37.0 37.0 37.0 37.0 37.0 85-89 35.9148 37.0 37.0 37.0 37.0 37.0 90-94 35.902 37.0 37.0 37.0 37.0 37.0 95-99 35.9523 37.0 37.0 37.0 37.0 37.0 100-104 35.8822 37.0 37.0 37.0 37.0 37.0 105-109 35.8236 37.0 37.0 37.0 37.0 37.0 110-114 35.750899999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.7051 37.0 37.0 37.0 37.0 37.0 120-124 35.6923 37.0 37.0 37.0 37.0 37.0 125-129 35.642399999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.5774 37.0 37.0 37.0 37.0 37.0 135-139 35.52720000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.234500000000004 37.0 37.0 37.0 29.8 37.0 145-149 35.2701 37.0 37.0 37.0 34.6 37.0 150-151 34.844750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 2.0 15 1.0 16 1.0 17 0.0 18 1.0 19 2.0 20 1.0 21 3.0 22 3.0 23 5.0 24 6.0 25 7.0 26 7.0 27 13.0 28 9.0 29 23.0 30 30.0 31 42.0 32 55.0 33 99.0 34 192.0 35 462.0 36 2753.0 37 280.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.6 19.825 12.575 31.0 2 25.7 23.35 36.3 14.649999999999999 3 19.15 27.6 33.85 19.400000000000002 4 22.625 34.875 22.95 19.55 5 24.325 37.275000000000006 21.675 16.725 6 19.275000000000002 39.225 21.975 19.525000000000002 7 19.05 18.625 41.3 21.025 8 20.349999999999998 24.3 26.900000000000002 28.449999999999996 9 21.15 24.8 28.675 25.374999999999996 10-14 23.255 28.345 26.69 21.709999999999997 15-19 22.64 28.225 27.73 21.404999999999998 20-24 23.21 28.7 27.175 20.915 25-29 22.564999999999998 28.694999999999997 27.11 21.63 30-34 23.69 27.975 27.91 20.424999999999997 35-39 22.720000000000002 28.189999999999998 28.144999999999996 20.945 40-44 23.175 28.535 27.52 20.77 45-49 23.595 28.17 27.54 20.695 50-54 22.814999999999998 28.139999999999997 27.825 21.22 55-59 22.545 27.99 28.345 21.12 60-64 23.215 27.815 27.905 21.065 65-69 23.0 28.02 27.785 21.195 70-74 22.81 28.4 27.279999999999998 21.51 75-79 23.294999999999998 28.08 27.915 20.71 80-84 23.035 27.88 27.084999999999997 22.0 85-89 23.835 27.785 27.43 20.95 90-94 23.485 28.139999999999997 27.43 20.945 95-99 23.39 28.165000000000003 28.04 20.405 100-104 23.575 28.235 27.529999999999998 20.66 105-109 24.205 27.975 27.79 20.03 110-114 23.655 28.58 26.979999999999997 20.785 115-119 24.22 28.060000000000002 27.500000000000004 20.22 120-124 23.68 27.994999999999997 27.96 20.365 125-129 24.48 27.779999999999998 27.61 20.13 130-134 25.155 27.750000000000004 26.965 20.13 135-139 25.895000000000003 27.325 27.250000000000004 19.53 140-144 25.41 27.62 27.27 19.7 145-149 26.105 27.99 26.57 19.335 150-151 25.9875 29.1125 25.687500000000004 19.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.5 17 1.5 18 1.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.5 26 3.0 27 6.5 28 11.5 29 12.5 30 16.0 31 24.5 32 29.0 33 33.5 34 50.5 35 70.0 36 80.5 37 95.0 38 135.0 39 165.0 40 188.0 41 228.0 42 243.0 43 275.0 44 287.5 45 270.0 46 265.5 47 238.0 48 206.5 49 198.0 50 175.5 51 138.5 52 113.0 53 94.5 54 73.5 55 59.5 56 60.5 57 43.5 58 27.0 59 21.5 60 15.0 61 9.5 62 8.0 63 6.0 64 2.5 65 1.5 66 0.5 67 0.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.175 #Duplication Level Percentage of deduplicated Percentage of total 1 94.50491106981683 89.0 2 5.017255110167242 9.45 3 0.34510220334483677 0.975 4 0.053092646668436425 0.2 5 0.07963897000265463 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit CTGGAGAGTGCAAGAGCTTTGTCTCTAGTGGAAATGGAAGTAAAGAGAAG 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.6375000000000002 0.0 0.0 0.0 0.0 108-109 1.8875000000000002 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 3.125 0.0 0.0 0.0 0.0 118-119 3.575 0.0 0.0 0.0 0.0 120-121 3.825 0.0 0.0 0.0 0.0 122-123 4.175 0.0 0.0 0.0 0.0 124-125 4.775 0.0 0.0 0.0 0.0 126-127 5.4125 0.0 0.0 0.0 0.0 128-129 6.025 0.0 0.0 0.0 0.0 130-131 6.5875 0.0 0.0 0.0 0.0 132-133 7.0 0.0 0.0 0.0 0.0 134-135 7.5875 0.0 0.0 0.0 0.0 136-137 8.2 0.0 0.0 0.0 0.0 138-139 8.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870071 spots for SRR12671671.sra Written 870071 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra Read 870065 spots for SRR12671671.sra Written 870065 spots for SRR12671671.sra SRR ids: ['SRR12671671.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xuelfjm6 SRR12671671.sra spots: 17401306 blocks: [[1, 870065], [870066, 1740130], [1740131, 2610195], [2610196, 3480260], [3480261, 4350325], [4350326, 5220390], [5220391, 6090455], [6090456, 6960520], [6960521, 7830585], [7830586, 8700650], [8700651, 9570715], [9570716, 10440780], [10440781, 11310845], [11310846, 12180910], [12180911, 13050975], [13050976, 13921040], [13921041, 14791105], [14791106, 15661170], [15661171, 16531235], [16531236, 17401306]] SRR12671671 file size 5892024 SRR12671671 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671671 SRR12671671_1.fastq SRR12671671_2.fastq Input file: SRR12671671_1.fastq Paired file: SRR12671671_2.fastq trimmed: SRR12671671-trimmed-pair1.fastq, SRR12671671-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:41:37 2025 >> started Wed Feb 12 01:41:56 2025 >> done (18.808s) 17401306 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 2558 ( 0.01%) empty read pairs filtered out after trimming by size control 17398733 (99.99%) read pairs available; of these: 2174302 (12.50%) trimmed read pairs available after processing 15224431 (87.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 3 0.00% 26 3 0.00% 27 4 0.00% 28 15 0.00% 29 5 0.00% 30 6 0.00% 31 10 0.00% 32 7 0.00% 33 10 0.00% 34 9 0.00% 35 12 0.00% 36 11 0.00% 37 14 0.00% 38 22 0.00% 39 27 0.00% 40 25 0.00% 41 47 0.00% 42 34 0.00% 43 41 0.00% 44 53 0.00% 45 45 0.00% 46 49 0.00% 47 64 0.00% 48 63 0.00% 49 78 0.00% 50 87 0.00% 51 111 0.00% 52 136 0.00% 53 120 0.00% 54 138 0.00% 55 114 0.00% 56 135 0.00% 57 176 0.00% 58 187 0.00% 59 208 0.00% 60 269 0.00% 61 314 0.00% 62 345 0.00% 63 419 0.00% 64 395 0.00% 65 473 0.00% 66 463 0.00% 67 545 0.00% 68 611 0.00% 69 669 0.00% 70 796 0.00% 71 929 0.01% 72 1082 0.01% 73 1350 0.01% 74 1532 0.01% 75 1535 0.01% 76 1727 0.01% 77 1771 0.01% 78 1873 0.01% 79 2214 0.01% 80 2460 0.01% 81 3012 0.02% 82 3429 0.02% 83 4015 0.02% 84 4553 0.03% 85 4903 0.03% 86 5191 0.03% 87 5441 0.03% 88 5748 0.03% 89 6302 0.04% 90 7131 0.04% 91 8167 0.05% 92 9002 0.05% 93 10275 0.06% 94 11059 0.06% 95 12140 0.07% 96 12289 0.07% 97 13104 0.08% 98 13442 0.08% 99 14243 0.08% 100 15053 0.09% 101 16265 0.09% 102 17827 0.10% 103 19375 0.11% 104 20579 0.12% 105 22288 0.13% 106 22896 0.13% 107 23264 0.13% 108 23771 0.14% 109 23860 0.14% 110 24893 0.14% 111 26212 0.15% 112 28050 0.16% 113 29626 0.17% 114 31425 0.18% 115 32849 0.19% 116 33683 0.19% 117 34026 0.20% 118 34361 0.20% 119 34208 0.20% 120 34871 0.20% 121 35968 0.21% 122 37203 0.21% 123 39537 0.23% 124 41256 0.24% 125 42342 0.24% 126 43571 0.25% 127 43294 0.25% 128 43341 0.25% 129 43100 0.25% 130 43528 0.25% 131 43363 0.25% 132 44893 0.26% 133 47139 0.27% 134 48647 0.28% 135 50259 0.29% 136 51287 0.29% 137 50942 0.29% 138 50932 0.29% 139 50866 0.29% 140 50091 0.29% 141 50609 0.29% 142 51230 0.29% 143 52774 0.30% 144 55659 0.32% 145 55570 0.32% 146 57388 0.33% 147 56586 0.33% 148 56509 0.32% 149 55369 0.32% 150 54367 0.31% 151 15224431 87.50% 17398733 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=18 prefix-density=0.31 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=290.06 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=17.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCGGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=14 prefix-density=0.40 prefix-fanout=3.7 sequence=TCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=61.32 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.3 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCG SRR12671671 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:42:38 Started mapping on | Feb 12 01:42:38 Finished on | Feb 12 01:44:40 Mapping speed, Million of reads per hour | 513.41 Number of input reads | 17398733 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16066824 Uniquely mapped reads % | 92.34% Average mapped length | 294.38 Number of splices: Total | 16368162 Number of splices: Annotated (sjdb) | 15967267 Number of splices: GT/AG | 16055576 Number of splices: GC/AG | 239310 Number of splices: AT/AC | 10841 Number of splices: Non-canonical | 62435 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 473300 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 75526 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.37% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 858609 858609 858609 N_multimapping 473300 473300 473300 N_noFeature 611603 15743093 716067 N_ambiguous 336717 1288 116732 UnstrandedReadsAssigned:15118504 PositiveStrandReadsAssigned:322443 NegativeStrandReadsAssigned:15234025 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671671 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671671-trimmed-pair1.fastq SRR12671671-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,398,733 reads, 15,176,989 reads pseudoaligned [quant] estimated average fragment length: 268.421 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR12671671.ke.tsv 34699 SRR12671671.se.tsv 87100 total ==> SRR12671671.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.58 973 31.9115 Potri.005G024800.1.v4.1 1035 767.579 274 20.4948 Potri.004G059700.1.v4.1 961 693.895 0 0 Potri.007G009000.2.v4.1 1416 1148.58 0 0 Potri.003G141000.2.v4.1 2943 2675.58 1117.38 23.9773 Potri.016G087400.1.v4.1 270 90.3508 1150 730.771 Potri.015G069301.1.v4.1 564 318.658 0 0 Potri.010G195200.1.v4.1 1773 1505.58 422 16.0925 Potri.012G127500.1.v4.1 977 709.717 86 6.95711 ==> SRR12671671.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 157 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 222 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 21 SRR12671671 completed mapping pipeline successfully