Starting /dee2/code/volunteer_pipeline.sh SRR12671672 current disk space = 3050816446464 free memory = 1496756628 SRR12671672 SRAfilesize 6370ee32fcbb971231bd5fe61991d0e3 SRR12671672.sra SRR12671672.sra file validated SRR12671672 is paired end SRR12671672 is conventional basespace SRR12671672 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671672_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.294 37.0 37.0 37.0 37.0 37.0 2 36.28025 37.0 37.0 37.0 37.0 37.0 3 36.482 37.0 37.0 37.0 37.0 37.0 4 36.558 37.0 37.0 37.0 37.0 37.0 5 36.577 37.0 37.0 37.0 37.0 37.0 6 36.511 37.0 37.0 37.0 37.0 37.0 7 36.562 37.0 37.0 37.0 37.0 37.0 8 36.522 37.0 37.0 37.0 37.0 37.0 9 36.4685 37.0 37.0 37.0 37.0 37.0 10-14 36.5213 37.0 37.0 37.0 37.0 37.0 15-19 36.511199999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.52550000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.4744 37.0 37.0 37.0 37.0 37.0 30-34 36.4442 37.0 37.0 37.0 37.0 37.0 35-39 36.423500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.429199999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.330799999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.348 37.0 37.0 37.0 37.0 37.0 55-59 36.3058 37.0 37.0 37.0 37.0 37.0 60-64 36.3156 37.0 37.0 37.0 37.0 37.0 65-69 36.2943 37.0 37.0 37.0 37.0 37.0 70-74 36.278999999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.2709 37.0 37.0 37.0 37.0 37.0 80-84 36.226699999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.214600000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.198 37.0 37.0 37.0 37.0 37.0 95-99 36.1255 37.0 37.0 37.0 37.0 37.0 100-104 36.1186 37.0 37.0 37.0 37.0 37.0 105-109 36.0955 37.0 37.0 37.0 37.0 37.0 110-114 36.0677 37.0 37.0 37.0 37.0 37.0 115-119 36.0801 37.0 37.0 37.0 37.0 37.0 120-124 35.96810000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.9787 37.0 37.0 37.0 37.0 37.0 130-134 35.950199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.9125 37.0 37.0 37.0 37.0 37.0 140-144 35.8633 37.0 37.0 37.0 37.0 37.0 145-149 35.7697 37.0 37.0 37.0 37.0 37.0 150-151 35.335750000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 1.0 25 1.0 26 9.0 27 5.0 28 12.0 29 22.0 30 21.0 31 34.0 32 59.0 33 79.0 34 127.0 35 359.0 36 2911.0 37 358.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.075000000000003 15.675 10.825 42.425000000000004 2 19.06195134186105 19.839478304489592 41.18384750438926 19.914722849260095 3 16.675 26.0 30.525000000000002 26.8 4 22.225 33.1 23.35 21.325 5 20.625 36.35 24.099999999999998 18.925 6 18.15 35.9 25.15 20.8 7 13.750000000000002 21.85 44.15 20.25 8 17.2 21.375 32.475 28.95 9 18.175 21.975 31.7 28.15 10-14 19.53 28.28 28.09 24.099999999999998 15-19 19.139999999999997 27.845 28.48 24.535 20-24 19.855 28.025 27.77 24.349999999999998 25-29 20.015 28.555000000000003 27.355 24.075 30-34 19.575 28.57 28.09 23.765 35-39 19.75 28.305000000000003 27.96 23.985 40-44 19.84 28.470000000000002 27.839999999999996 23.849999999999998 45-49 20.385 28.27 27.474999999999998 23.87 50-54 20.105 28.384999999999998 27.950000000000003 23.56 55-59 19.585 27.675 28.26 24.48 60-64 20.305 28.115000000000002 27.655 23.925 65-69 20.200000000000003 28.155 28.01 23.635 70-74 20.06 28.46 27.685 23.794999999999998 75-79 20.025000000000002 28.345 28.04 23.59 80-84 20.625 28.105000000000004 27.334999999999997 23.935000000000002 85-89 19.545 28.395 28.125 23.935000000000002 90-94 20.580000000000002 27.705000000000002 27.955000000000002 23.76 95-99 20.355 27.77 27.88 23.995 100-104 20.24 27.99 27.994999999999997 23.775 105-109 20.3 27.74 28.305000000000003 23.655 110-114 20.919999999999998 27.6 27.665 23.815 115-119 20.845 27.845 28.035 23.275000000000002 120-124 20.599999999999998 27.500000000000004 27.77 24.13 125-129 19.86 28.035 27.950000000000003 24.154999999999998 130-134 20.145 27.68 28.060000000000002 24.115000000000002 135-139 20.73 27.565 28.15 23.555 140-144 20.674999999999997 27.625 27.644999999999996 24.055 145-149 20.11 28.255000000000003 27.589999999999996 24.044999999999998 150-151 20.75 27.575 27.275 24.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.0 22 1.0 23 2.5 24 3.0 25 4.0 26 6.0 27 8.0 28 12.0 29 12.0 30 17.5 31 26.0 32 30.5 33 37.5 34 58.5 35 77.0 36 91.5 37 116.0 38 142.0 39 172.5 40 182.0 41 208.5 42 249.5 43 252.0 44 271.5 45 272.0 46 243.5 47 232.5 48 226.5 49 209.5 50 182.5 51 147.5 52 115.0 53 92.0 54 62.5 55 61.0 56 56.0 57 32.0 58 22.5 59 20.0 60 15.5 61 9.0 62 5.0 63 4.5 64 2.0 65 0.5 66 1.0 67 0.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.625 #Duplication Level Percentage of deduplicated Percentage of total 1 93.77837116154873 87.8 2 5.740987983978639 10.75 3 0.3738317757009346 1.05 4 0.1068090787716956 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.5750000000000002 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 1.9125 0.0 0.0 0.0 0.0 126-127 2.1624999999999996 0.0 0.0 0.0 0.0 128-129 2.4375 0.0 0.0 0.0 0.0 130-131 2.6375 0.0 0.0 0.0 0.0 132-133 2.8125 0.0 0.0 0.0 0.0 134-135 2.9875 0.0 0.0 0.0 0.0 136-137 3.3 0.0 0.0 0.0 0.0 138-139 3.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGCA 10 0.006830828 145.0 8 CATATTC 10 0.006830828 145.0 9 >>END_MODULE SRR12671672 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671672_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1735 37.0 37.0 37.0 37.0 37.0 2 36.079 37.0 37.0 37.0 37.0 37.0 3 36.1325 37.0 37.0 37.0 37.0 37.0 4 36.1355 37.0 37.0 37.0 37.0 37.0 5 36.2475 37.0 37.0 37.0 37.0 37.0 6 36.1985 37.0 37.0 37.0 37.0 37.0 7 36.209 37.0 37.0 37.0 37.0 37.0 8 36.329 37.0 37.0 37.0 37.0 37.0 9 36.285 37.0 37.0 37.0 37.0 37.0 10-14 36.2464 37.0 37.0 37.0 37.0 37.0 15-19 36.221900000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.171800000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1289 37.0 37.0 37.0 37.0 37.0 30-34 36.117599999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.0977 37.0 37.0 37.0 37.0 37.0 40-44 36.0834 37.0 37.0 37.0 37.0 37.0 45-49 36.0736 37.0 37.0 37.0 37.0 37.0 50-54 36.1028 37.0 37.0 37.0 37.0 37.0 55-59 35.9559 37.0 37.0 37.0 37.0 37.0 60-64 35.9139 37.0 37.0 37.0 37.0 37.0 65-69 35.91930000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.92139999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.8684 37.0 37.0 37.0 37.0 37.0 80-84 35.89639999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.7949 37.0 37.0 37.0 37.0 37.0 90-94 35.766000000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.767399999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.7521 37.0 37.0 37.0 37.0 37.0 105-109 35.710699999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.6332 37.0 37.0 37.0 37.0 37.0 115-119 35.637600000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.630300000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.4697 37.0 37.0 37.0 37.0 37.0 130-134 35.5555 37.0 37.0 37.0 37.0 37.0 135-139 35.5631 37.0 37.0 37.0 37.0 37.0 140-144 35.2607 37.0 37.0 37.0 29.8 37.0 145-149 35.3405 37.0 37.0 37.0 34.6 37.0 150-151 34.91175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 5.0 15 1.0 16 0.0 17 0.0 18 1.0 19 0.0 20 2.0 21 3.0 22 1.0 23 7.0 24 3.0 25 10.0 26 10.0 27 12.0 28 14.0 29 32.0 30 27.0 31 40.0 32 61.0 33 114.0 34 202.0 35 551.0 36 2677.0 37 223.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.65 19.05 13.525 32.775 2 24.325 25.074999999999996 34.599999999999994 16.0 3 18.925 28.125 32.0 20.95 4 21.8 35.3 22.1 20.8 5 22.375 37.125 22.625 17.875 6 19.2 37.525 23.75 19.525000000000002 7 17.925 18.45 42.275 21.349999999999998 8 19.75 23.05 27.875 29.325000000000003 9 21.224999999999998 22.775000000000002 29.375 26.625 10-14 22.075 28.03 27.189999999999998 22.705000000000002 15-19 22.314999999999998 27.63 28.410000000000004 21.645 20-24 22.585 27.85 28.105000000000004 21.46 25-29 21.775 28.575 28.005000000000003 21.645 30-34 22.145 27.939999999999998 28.349999999999998 21.565 35-39 22.32 27.99 27.925 21.765 40-44 22.425 28.07 28.389999999999997 21.115000000000002 45-49 22.36 28.01 28.02 21.61 50-54 22.59 28.1 27.805000000000003 21.505 55-59 23.18 26.91 28.04 21.87 60-64 22.6 27.61 28.12 21.67 65-69 23.25 28.050000000000004 27.325 21.375 70-74 22.73 28.32 27.36 21.59 75-79 22.965 28.110000000000003 27.55 21.375 80-84 22.73 28.22 27.474999999999998 21.575 85-89 23.325000000000003 28.12 27.200000000000003 21.355 90-94 22.59 28.02 27.810000000000002 21.58 95-99 22.99 27.915 27.785 21.310000000000002 100-104 23.775 27.505000000000003 27.37 21.349999999999998 105-109 22.8 28.439999999999998 27.650000000000002 21.11 110-114 23.035 28.38 27.01 21.575 115-119 23.1 28.37 27.46 21.07 120-124 22.96 27.92 27.634999999999998 21.485000000000003 125-129 23.385 28.185 27.384999999999998 21.044999999999998 130-134 23.895 27.96 27.215 20.93 135-139 24.935 27.655 26.919999999999998 20.49 140-144 23.96 27.97 27.384999999999998 20.685000000000002 145-149 24.2 28.17 26.97 20.66 150-151 23.9125 29.049999999999997 26.775 20.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 1.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 2.0 26 4.5 27 6.5 28 12.0 29 19.5 30 18.5 31 24.0 32 32.0 33 39.0 34 49.5 35 59.5 36 78.5 37 104.5 38 132.5 39 161.5 40 189.0 41 215.0 42 245.0 43 264.0 44 265.0 45 265.0 46 265.0 47 245.0 48 229.0 49 216.0 50 180.5 51 136.0 52 97.0 53 77.5 54 71.5 55 62.5 56 51.0 57 47.5 58 37.0 59 24.5 60 19.5 61 15.0 62 11.0 63 6.0 64 2.0 65 1.5 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 93.80838003736322 87.875 2 5.764611689351481 10.8 3 0.32025620496397117 0.8999999999999999 4 0.08006405124099279 0.3 5 0.02668801708033093 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0125 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.1 0.0 0.0 0.025 0.0 86-87 0.1375 0.0 0.0 0.025 0.0 88-89 0.16249999999999998 0.0 0.0 0.025 0.0 90-91 0.175 0.0 0.0 0.025 0.0 92-93 0.2625 0.0 0.0 0.025 0.0 94-95 0.3 0.0 0.0 0.025 0.0 96-97 0.325 0.0 0.0 0.025 0.0 98-99 0.3625 0.0 0.0 0.025 0.0 100-101 0.3875 0.0 0.0 0.025 0.0 102-103 0.5 0.0 0.0 0.025 0.0 104-105 0.6625 0.0 0.0 0.025 0.0 106-107 0.75 0.0 0.0 0.025 0.0 108-109 0.775 0.0 0.0 0.025 0.0 110-111 0.875 0.0 0.0 0.025 0.0 112-113 1.0375 0.0 0.0 0.025 0.0 114-115 1.1625 0.0 0.0 0.025 0.0 116-117 1.225 0.0 0.0 0.025 0.0 118-119 1.4125 0.0 0.0 0.025 0.0 120-121 1.5750000000000002 0.0 0.0 0.025 0.0 122-123 1.725 0.0 0.0 0.025 0.0 124-125 1.9125 0.0 0.0 0.025 0.0 126-127 2.1875 0.0 0.0 0.025 0.0 128-129 2.4749999999999996 0.0 0.0 0.025 0.0 130-131 2.7 0.0 0.0 0.025 0.0 132-133 2.8875 0.0 0.0 0.025 0.0 134-135 3.0625 0.0 0.0 0.025 0.0 136-137 3.375 0.0 0.0 0.025 0.0 138-139 3.6125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048080 spots for SRR12671672.sra Written 1048080 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra Read 1048069 spots for SRR12671672.sra Written 1048069 spots for SRR12671672.sra SRR ids: ['SRR12671672.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ff3alku SRR12671672.sra spots: 20961391 blocks: [[1, 1048069], [1048070, 2096138], [2096139, 3144207], [3144208, 4192276], [4192277, 5240345], [5240346, 6288414], [6288415, 7336483], [7336484, 8384552], [8384553, 9432621], [9432622, 10480690], [10480691, 11528759], [11528760, 12576828], [12576829, 13624897], [13624898, 14672966], [14672967, 15721035], [15721036, 16769104], [16769105, 17817173], [17817174, 18865242], [18865243, 19913311], [19913312, 20961391]] SRR12671672 file size 7101897 SRR12671672 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671672 SRR12671672_1.fastq SRR12671672_2.fastq Input file: SRR12671672_1.fastq Paired file: SRR12671672_2.fastq trimmed: SRR12671672-trimmed-pair1.fastq, SRR12671672-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:56:17 2025 >> started Wed Feb 12 01:56:43 2025 >> done (25.893s) 20961391 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 2285 ( 0.01%) empty read pairs filtered out after trimming by size control 20959080 (99.99%) read pairs available; of these: 1179550 ( 5.63%) trimmed read pairs available after processing 19779530 (94.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 5 0.00% 22 3 0.00% 23 7 0.00% 24 5 0.00% 25 4 0.00% 26 1 0.00% 27 3 0.00% 28 3 0.00% 29 6 0.00% 30 9 0.00% 31 8 0.00% 32 17 0.00% 33 15 0.00% 34 17 0.00% 35 22 0.00% 36 12 0.00% 37 9 0.00% 38 26 0.00% 39 15 0.00% 40 27 0.00% 41 29 0.00% 42 34 0.00% 43 37 0.00% 44 28 0.00% 45 33 0.00% 46 31 0.00% 47 41 0.00% 48 51 0.00% 49 59 0.00% 50 60 0.00% 51 71 0.00% 52 87 0.00% 53 81 0.00% 54 90 0.00% 55 82 0.00% 56 71 0.00% 57 94 0.00% 58 134 0.00% 59 132 0.00% 60 138 0.00% 61 189 0.00% 62 200 0.00% 63 219 0.00% 64 218 0.00% 65 269 0.00% 66 275 0.00% 67 325 0.00% 68 358 0.00% 69 360 0.00% 70 470 0.00% 71 553 0.00% 72 635 0.00% 73 666 0.00% 74 732 0.00% 75 881 0.00% 76 866 0.00% 77 1005 0.00% 78 1054 0.01% 79 1167 0.01% 80 1353 0.01% 81 1539 0.01% 82 1743 0.01% 83 1979 0.01% 84 2149 0.01% 85 2352 0.01% 86 2694 0.01% 87 2849 0.01% 88 3045 0.01% 89 3321 0.02% 90 3559 0.02% 91 4032 0.02% 92 4300 0.02% 93 4728 0.02% 94 5253 0.03% 95 5654 0.03% 96 5791 0.03% 97 6208 0.03% 98 6346 0.03% 99 6813 0.03% 100 7256 0.03% 101 7812 0.04% 102 8455 0.04% 103 8987 0.04% 104 9535 0.05% 105 10216 0.05% 106 10469 0.05% 107 10722 0.05% 108 11175 0.05% 109 11533 0.06% 110 11890 0.06% 111 12571 0.06% 112 13505 0.06% 113 14056 0.07% 114 14527 0.07% 115 15399 0.07% 116 15689 0.07% 117 16478 0.08% 118 16476 0.08% 119 16872 0.08% 120 17342 0.08% 121 18142 0.09% 122 18448 0.09% 123 19877 0.09% 124 20445 0.10% 125 21348 0.10% 126 22312 0.11% 127 22423 0.11% 128 22978 0.11% 129 22903 0.11% 130 23308 0.11% 131 23793 0.11% 132 25059 0.12% 133 26236 0.13% 134 27082 0.13% 135 27655 0.13% 136 28530 0.14% 137 28869 0.14% 138 29388 0.14% 139 29675 0.14% 140 29592 0.14% 141 30044 0.14% 142 31148 0.15% 143 31968 0.15% 144 33916 0.16% 145 34670 0.17% 146 35805 0.17% 147 36172 0.17% 148 36589 0.17% 149 36114 0.17% 150 36343 0.17% 151 19779530 94.37% 20959080 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=33 prefix-density=0.57 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCATGTTGGCTTGTGCCGGGGTGCGGTTGACGGTGGCAACGGCTGCCGATGAGATCATAGAGGAGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=25.81 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=7.6 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=33 prefix-density=0.82 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=61.56 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.2 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671672 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:57:29 Started mapping on | Feb 12 01:57:29 Finished on | Feb 12 01:59:41 Mapping speed, Million of reads per hour | 571.61 Number of input reads | 20959080 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19578253 Uniquely mapped reads % | 93.41% Average mapped length | 298.01 Number of splices: Total | 19741736 Number of splices: Annotated (sjdb) | 19336091 Number of splices: GT/AG | 19354653 Number of splices: GC/AG | 320991 Number of splices: AT/AC | 12187 Number of splices: Non-canonical | 53905 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 489512 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 122914 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.54% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 891315 891315 891315 N_multimapping 489512 489512 489512 N_noFeature 693033 19282481 778787 N_ambiguous 353146 1458 142297 UnstrandedReadsAssigned:18532074 PositiveStrandReadsAssigned:294314 NegativeStrandReadsAssigned:18657169 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671672 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671672-trimmed-pair1.fastq SRR12671672-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,959,080 reads, 18,616,137 reads pseudoaligned [quant] estimated average fragment length: 310.95 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52401 SRR12671672.ke.tsv 34699 SRR12671672.se.tsv 87100 total ==> SRR12671672.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1708.05 1251 36.0514 Potri.005G024800.1.v4.1 1035 725.05 262 17.7868 Potri.004G059700.1.v4.1 961 651.917 12 0.906054 Potri.007G009000.2.v4.1 1416 1106.05 0 0 Potri.003G141000.2.v4.1 2943 2633.05 824.376 15.411 Potri.016G087400.1.v4.1 270 75.8656 752 487.908 Potri.015G069301.1.v4.1 564 287.448 0 0 Potri.010G195200.1.v4.1 1773 1463.05 54 1.81677 Potri.012G127500.1.v4.1 977 667.551 107 7.88977 ==> SRR12671672.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 261 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR12671672 completed mapping pipeline successfully