Starting /dee2/code/volunteer_pipeline.sh SRR12671673 current disk space = 3050804076544 free memory = 1494055748 SRR12671673 SRAfilesize 096acce0d9d1ebdb492460af3217cf0b SRR12671673.sra SRR12671673.sra file validated SRR12671673 is paired end SRR12671673 is conventional basespace SRR12671673 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671673_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.456 37.0 37.0 37.0 37.0 37.0 2 36.28625 37.0 37.0 37.0 37.0 37.0 3 36.507 37.0 37.0 37.0 37.0 37.0 4 36.5375 37.0 37.0 37.0 37.0 37.0 5 36.5355 37.0 37.0 37.0 37.0 37.0 6 36.5445 37.0 37.0 37.0 37.0 37.0 7 36.4765 37.0 37.0 37.0 37.0 37.0 8 36.573 37.0 37.0 37.0 37.0 37.0 9 36.6025 37.0 37.0 37.0 37.0 37.0 10-14 36.5683 37.0 37.0 37.0 37.0 37.0 15-19 36.5582 37.0 37.0 37.0 37.0 37.0 20-24 36.50750000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.499399999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.45 37.0 37.0 37.0 37.0 37.0 35-39 36.4876 37.0 37.0 37.0 37.0 37.0 40-44 36.472899999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.416199999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.423700000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3734 37.0 37.0 37.0 37.0 37.0 60-64 36.4018 37.0 37.0 37.0 37.0 37.0 65-69 36.3741 37.0 37.0 37.0 37.0 37.0 70-74 36.305 37.0 37.0 37.0 37.0 37.0 75-79 36.2813 37.0 37.0 37.0 37.0 37.0 80-84 36.278200000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.3113 37.0 37.0 37.0 37.0 37.0 90-94 36.2538 37.0 37.0 37.0 37.0 37.0 95-99 36.1723 37.0 37.0 37.0 37.0 37.0 100-104 36.230000000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.1602 37.0 37.0 37.0 37.0 37.0 110-114 36.106100000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.17620000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.0955 37.0 37.0 37.0 37.0 37.0 125-129 36.0432 37.0 37.0 37.0 37.0 37.0 130-134 36.0639 37.0 37.0 37.0 37.0 37.0 135-139 35.971199999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.959199999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.900400000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.432 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 5.0 27 5.0 28 13.0 29 14.0 30 25.0 31 41.0 32 43.0 33 76.0 34 107.0 35 314.0 36 2955.0 37 400.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.55 14.399999999999999 11.65 43.4 2 19.61374467017808 19.839478304489592 38.55028843742162 21.996488587910708 3 18.725 24.9 27.400000000000002 28.975 4 23.599999999999998 32.05 21.75 22.6 5 22.375 36.55 23.200000000000003 17.875 6 19.275000000000002 34.975 25.4 20.349999999999998 7 14.249999999999998 22.05 44.324999999999996 19.375 8 18.55 22.875 30.55 28.025 9 18.35 23.0 31.25 27.400000000000002 10-14 19.505 29.065 26.765 24.665 15-19 19.67 27.91 27.915 24.505 20-24 19.97 28.055000000000003 27.615000000000002 24.36 25-29 20.064999999999998 28.29 27.415 24.23 30-34 19.66 28.155 27.985 24.2 35-39 20.169999999999998 28.134999999999998 27.689999999999998 24.005000000000003 40-44 20.355 28.52 27.565 23.56 45-49 19.91 28.110000000000003 27.755000000000003 24.224999999999998 50-54 20.405 27.939999999999998 27.32 24.335 55-59 20.525 28.134999999999998 27.82 23.52 60-64 20.169999999999998 28.055000000000003 27.939999999999998 23.835 65-69 20.29 27.534999999999997 27.955000000000002 24.22 70-74 19.985 28.549999999999997 27.534999999999997 23.93 75-79 19.855 28.4 27.779999999999998 23.965 80-84 20.05 28.15 27.33 24.47 85-89 20.49 28.475 27.55 23.485 90-94 19.905 27.944999999999997 28.15 24.0 95-99 20.235 28.59 26.855 24.32 100-104 20.59 28.375 27.305 23.73 105-109 20.72 27.644999999999996 27.615000000000002 24.02 110-114 20.330000000000002 27.694999999999997 28.02 23.955000000000002 115-119 20.625 28.294999999999998 27.36 23.72 120-124 21.025 28.105000000000004 27.250000000000004 23.62 125-129 20.305 28.37 27.700000000000003 23.625 130-134 21.07 28.384999999999998 27.185 23.36 135-139 20.974999999999998 27.68 27.3 24.044999999999998 140-144 21.215 27.589999999999996 27.465 23.73 145-149 21.25 28.199999999999996 27.21 23.34 150-151 20.9375 28.425 27.200000000000003 23.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 2.0 22 2.0 23 0.5 24 1.0 25 2.5 26 5.0 27 6.5 28 8.5 29 12.0 30 20.0 31 24.5 32 32.5 33 38.5 34 46.0 35 70.0 36 85.5 37 98.0 38 125.0 39 156.5 40 187.5 41 208.0 42 235.0 43 262.5 44 270.5 45 264.0 46 249.0 47 251.0 48 250.5 49 205.5 50 178.5 51 173.5 52 119.5 53 83.0 54 82.5 55 64.0 56 41.5 57 38.5 58 31.0 59 18.5 60 17.0 61 10.0 62 5.0 63 5.5 64 2.5 65 2.5 66 2.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.73166177647373 87.85 2 5.868231528407575 11.0 3 0.37343291544411844 1.05 4 0.026673779674579887 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.8375 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.1875 0.0 0.0 0.0 0.0 126-127 1.35 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.1375 0.0 0.0 0.0 0.0 134-135 2.3125 0.0 0.0 0.0 0.0 136-137 2.55 0.0 0.0 0.0 0.0 138-139 2.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACTGC 10 0.006830828 145.0 7 CTCACTT 10 0.006830828 145.0 1 GGGGAGA 10 0.006830828 145.0 6 >>END_MODULE SRR12671673 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671673_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2885 37.0 37.0 37.0 37.0 37.0 2 36.137 37.0 37.0 37.0 37.0 37.0 3 36.227 37.0 37.0 37.0 37.0 37.0 4 36.112 37.0 37.0 37.0 37.0 37.0 5 36.273 37.0 37.0 37.0 37.0 37.0 6 36.3035 37.0 37.0 37.0 37.0 37.0 7 36.2655 37.0 37.0 37.0 37.0 37.0 8 36.2565 37.0 37.0 37.0 37.0 37.0 9 36.314 37.0 37.0 37.0 37.0 37.0 10-14 36.2954 37.0 37.0 37.0 37.0 37.0 15-19 36.2302 37.0 37.0 37.0 37.0 37.0 20-24 36.254 37.0 37.0 37.0 37.0 37.0 25-29 36.21560000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.1961 37.0 37.0 37.0 37.0 37.0 35-39 36.1666 37.0 37.0 37.0 37.0 37.0 40-44 36.12239999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.1299 37.0 37.0 37.0 37.0 37.0 50-54 36.064800000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.056200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.0244 37.0 37.0 37.0 37.0 37.0 65-69 36.00359999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.977700000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.887 37.0 37.0 37.0 37.0 37.0 80-84 35.9261 37.0 37.0 37.0 37.0 37.0 85-89 35.8556 37.0 37.0 37.0 37.0 37.0 90-94 35.787099999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8472 37.0 37.0 37.0 37.0 37.0 100-104 35.7947 37.0 37.0 37.0 37.0 37.0 105-109 35.7859 37.0 37.0 37.0 37.0 37.0 110-114 35.6816 37.0 37.0 37.0 37.0 37.0 115-119 35.6687 37.0 37.0 37.0 37.0 37.0 120-124 35.6665 37.0 37.0 37.0 37.0 37.0 125-129 35.661500000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.640699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.5514 37.0 37.0 37.0 37.0 37.0 140-144 35.37949999999999 37.0 37.0 37.0 34.6 37.0 145-149 35.4557 37.0 37.0 37.0 34.6 37.0 150-151 35.06075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 3.0 16 0.0 17 0.0 18 2.0 19 0.0 20 1.0 21 2.0 22 3.0 23 2.0 24 2.0 25 1.0 26 7.0 27 12.0 28 11.0 29 30.0 30 32.0 31 43.0 32 66.0 33 103.0 34 186.0 35 550.0 36 2719.0 37 220.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.95 16.950000000000003 16.275000000000002 33.825 2 25.900000000000002 21.85 35.949999999999996 16.3 3 19.875 26.8 31.624999999999996 21.7 4 23.150000000000002 34.75 22.3 19.8 5 22.650000000000002 38.074999999999996 22.2 17.075000000000003 6 18.2 37.675 25.25 18.875 7 18.125 17.275 41.9 22.7 8 21.05 22.75 28.249999999999996 27.950000000000003 9 21.575 23.45 29.15 25.825 10-14 22.75 28.849999999999998 26.465 21.935 15-19 22.95 28.349999999999998 26.915 21.785 20-24 22.439999999999998 27.939999999999998 28.110000000000003 21.51 25-29 22.535 28.355000000000004 27.35 21.759999999999998 30-34 21.675 28.4 27.794999999999998 22.13 35-39 22.67 27.334999999999997 28.005000000000003 21.990000000000002 40-44 22.78 28.050000000000004 27.55 21.62 45-49 22.86 27.589999999999996 27.334999999999997 22.215 50-54 22.555 27.435 28.055000000000003 21.955 55-59 21.985 27.595 27.955000000000002 22.465 60-64 23.18 27.67 27.279999999999998 21.87 65-69 22.82 27.139999999999997 28.48 21.560000000000002 70-74 22.85 28.475 26.8 21.875 75-79 22.685 27.49 27.96 21.865000000000002 80-84 22.955000000000002 28.084999999999997 27.229999999999997 21.73 85-89 23.695 26.955000000000002 27.72 21.63 90-94 22.945 28.035 27.439999999999998 21.58 95-99 23.18 27.389999999999997 28.21 21.22 100-104 23.025000000000002 27.24 28.07 21.665 105-109 23.494999999999997 27.515 28.115000000000002 20.875 110-114 23.195 27.73 27.83 21.245 115-119 23.35 27.500000000000004 27.73 21.42 120-124 23.235 27.32 28.044999999999998 21.4 125-129 23.11 27.810000000000002 27.52 21.560000000000002 130-134 23.46 27.865000000000002 27.650000000000002 21.025 135-139 23.785 27.589999999999996 27.3 21.325 140-144 24.145 27.415 27.365000000000002 21.075 145-149 24.14 27.985 27.189999999999998 20.685000000000002 150-151 24.125 27.400000000000002 27.175 21.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.5 22 2.5 23 3.0 24 2.5 25 2.0 26 2.0 27 4.5 28 5.5 29 9.5 30 15.0 31 18.5 32 24.0 33 40.0 34 44.5 35 59.5 36 82.0 37 98.0 38 115.0 39 141.0 40 184.5 41 222.5 42 253.5 43 266.5 44 258.5 45 262.0 46 282.5 47 258.5 48 227.5 49 209.0 50 166.5 51 131.5 52 112.0 53 91.5 54 82.5 55 73.5 56 60.5 57 55.5 58 40.0 59 24.5 60 16.0 61 12.0 62 10.5 63 6.5 64 4.0 65 2.0 66 1.5 67 1.0 68 0.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.325 #Duplication Level Percentage of deduplicated Percentage of total 1 93.38333779801769 87.15 2 6.107688186445218 11.4 3 0.4821859094562015 1.35 4 0.026788106080900084 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.8375 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.3875000000000002 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.1625 0.0 0.0 0.0 0.0 134-135 2.325 0.0 0.0 0.0 0.0 136-137 2.55 0.0 0.0 0.0 0.0 138-139 2.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.00593511 29.0 135-139 >>END_MODULE Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909770 spots for SRR12671673.sra Written 909770 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra Read 909761 spots for SRR12671673.sra Written 909761 spots for SRR12671673.sra SRR ids: ['SRR12671673.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z7g6363s SRR12671673.sra spots: 18195229 blocks: [[1, 909761], [909762, 1819522], [1819523, 2729283], [2729284, 3639044], [3639045, 4548805], [4548806, 5458566], [5458567, 6368327], [6368328, 7278088], [7278089, 8187849], [8187850, 9097610], [9097611, 10007371], [10007372, 10917132], [10917133, 11826893], [11826894, 12736654], [12736655, 13646415], [13646416, 14556176], [14556177, 15465937], [15465938, 16375698], [16375699, 17285459], [17285460, 18195229]] SRR12671673 file size 6161834 SRR12671673 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671673 SRR12671673_1.fastq SRR12671673_2.fastq Input file: SRR12671673_1.fastq Paired file: SRR12671673_2.fastq trimmed: SRR12671673-trimmed-pair1.fastq, SRR12671673-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:41:36 2025 >> started Wed Feb 12 01:41:57 2025 >> done (20.503s) 18195229 read pairs processed; of these: 9 ( 0.00%) short read pairs filtered out after trimming by size control 1328 ( 0.01%) empty read pairs filtered out after trimming by size control 18193892 (99.99%) read pairs available; of these: 840360 ( 4.62%) trimmed read pairs available after processing 17353532 (95.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 5 0.00% 22 3 0.00% 23 1 0.00% 24 2 0.00% 25 0 0.00% 26 2 0.00% 27 2 0.00% 28 1 0.00% 29 8 0.00% 30 5 0.00% 31 5 0.00% 32 7 0.00% 33 7 0.00% 34 10 0.00% 35 8 0.00% 36 19 0.00% 37 9 0.00% 38 13 0.00% 39 11 0.00% 40 12 0.00% 41 21 0.00% 42 23 0.00% 43 21 0.00% 44 28 0.00% 45 20 0.00% 46 21 0.00% 47 31 0.00% 48 46 0.00% 49 42 0.00% 50 44 0.00% 51 43 0.00% 52 43 0.00% 53 63 0.00% 54 57 0.00% 55 44 0.00% 56 59 0.00% 57 65 0.00% 58 75 0.00% 59 80 0.00% 60 84 0.00% 61 120 0.00% 62 121 0.00% 63 114 0.00% 64 131 0.00% 65 166 0.00% 66 145 0.00% 67 168 0.00% 68 197 0.00% 69 194 0.00% 70 236 0.00% 71 261 0.00% 72 280 0.00% 73 333 0.00% 74 405 0.00% 75 417 0.00% 76 464 0.00% 77 495 0.00% 78 556 0.00% 79 664 0.00% 80 735 0.00% 81 732 0.00% 82 868 0.00% 83 912 0.01% 84 1152 0.01% 85 1176 0.01% 86 1280 0.01% 87 1430 0.01% 88 1596 0.01% 89 1685 0.01% 90 1927 0.01% 91 1955 0.01% 92 2237 0.01% 93 2579 0.01% 94 2763 0.02% 95 3039 0.02% 96 3333 0.02% 97 3323 0.02% 98 3612 0.02% 99 3891 0.02% 100 4233 0.02% 101 4479 0.02% 102 4687 0.03% 103 5140 0.03% 104 5465 0.03% 105 5906 0.03% 106 6254 0.03% 107 6338 0.03% 108 6880 0.04% 109 7307 0.04% 110 7383 0.04% 111 7960 0.04% 112 8459 0.05% 113 8527 0.05% 114 9139 0.05% 115 9581 0.05% 116 10004 0.05% 117 10523 0.06% 118 10965 0.06% 119 11318 0.06% 120 11940 0.07% 121 12552 0.07% 122 13031 0.07% 123 13447 0.07% 124 14106 0.08% 125 14550 0.08% 126 15304 0.08% 127 15497 0.09% 128 16372 0.09% 129 16872 0.09% 130 16934 0.09% 131 17636 0.10% 132 18385 0.10% 133 19151 0.11% 134 20139 0.11% 135 20619 0.11% 136 21004 0.12% 137 21962 0.12% 138 22179 0.12% 139 22958 0.13% 140 22946 0.13% 141 23921 0.13% 142 24968 0.14% 143 25510 0.14% 144 27059 0.15% 145 27462 0.15% 146 28373 0.16% 147 28717 0.16% 148 29583 0.16% 149 29659 0.16% 150 30240 0.17% 151 17353532 95.38% 18193892 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=23 prefix-density=0.55 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=9.80 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.7 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=28 prefix-density=0.92 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.14 sequence-density-rank=27 fanout-score=32.92 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=12.1 sequence=AAAGAAAAGAAAA SRR12671673 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:42:40 Started mapping on | Feb 12 01:42:40 Finished on | Feb 12 01:44:34 Mapping speed, Million of reads per hour | 574.54 Number of input reads | 18193892 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 17119623 Uniquely mapped reads % | 94.10% Average mapped length | 298.87 Number of splices: Total | 17699110 Number of splices: Annotated (sjdb) | 17340585 Number of splices: GT/AG | 17350012 Number of splices: GC/AG | 291610 Number of splices: AT/AC | 10533 Number of splices: Non-canonical | 46955 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 3.03 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 422874 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 179336 % of reads mapped to too many loci | 0.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.37% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 651395 651395 651395 N_multimapping 422874 422874 422874 N_noFeature 610702 16852323 689116 N_ambiguous 295657 1121 106184 UnstrandedReadsAssigned:16213264 PositiveStrandReadsAssigned:266179 NegativeStrandReadsAssigned:16324323 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671673 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671673-trimmed-pair1.fastq SRR12671673-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,193,892 reads, 16,336,597 reads pseudoaligned [quant] estimated average fragment length: 302.581 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52401 SRR12671673.ke.tsv 34699 SRR12671673.se.tsv 87100 total ==> SRR12671673.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1716.42 603 19.0056 Potri.005G024800.1.v4.1 1035 733.419 162 11.9495 Potri.004G059700.1.v4.1 961 659.794 4 0.327973 Potri.007G009000.2.v4.1 1416 1114.42 0 0 Potri.003G141000.2.v4.1 2943 2641.42 957.483 19.6101 Potri.016G087400.1.v4.1 270 71.2751 657.689 499.194 Potri.015G069301.1.v4.1 564 287.887 0 0 Potri.010G195200.1.v4.1 1773 1471.42 75 2.75748 Potri.012G127500.1.v4.1 977 675.626 60 4.80432 ==> SRR12671673.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 296 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 169 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR12671673 completed mapping pipeline successfully