Starting /dee2/code/volunteer_pipeline.sh SRR12671674 current disk space = 3049109110784 free memory = 1582340172 SRR12671674 SRAfilesize 8d4e2eaebf9a4e92b39008785a13e709 SRR12671674.sra SRR12671674.sra file validated SRR12671674 is paired end SRR12671674 is conventional basespace SRR12671674 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671674_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3295 37.0 37.0 37.0 37.0 37.0 2 36.29575 37.0 37.0 37.0 37.0 37.0 3 36.489 37.0 37.0 37.0 37.0 37.0 4 36.5255 37.0 37.0 37.0 37.0 37.0 5 36.579 37.0 37.0 37.0 37.0 37.0 6 36.5185 37.0 37.0 37.0 37.0 37.0 7 36.487 37.0 37.0 37.0 37.0 37.0 8 36.542 37.0 37.0 37.0 37.0 37.0 9 36.5165 37.0 37.0 37.0 37.0 37.0 10-14 36.5381 37.0 37.0 37.0 37.0 37.0 15-19 36.49380000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.515 37.0 37.0 37.0 37.0 37.0 25-29 36.460300000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.438100000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.445499999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4721 37.0 37.0 37.0 37.0 37.0 45-49 36.4096 37.0 37.0 37.0 37.0 37.0 50-54 36.352700000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.3507 37.0 37.0 37.0 37.0 37.0 60-64 36.3566 37.0 37.0 37.0 37.0 37.0 65-69 36.296 37.0 37.0 37.0 37.0 37.0 70-74 36.3267 37.0 37.0 37.0 37.0 37.0 75-79 36.3027 37.0 37.0 37.0 37.0 37.0 80-84 36.279 37.0 37.0 37.0 37.0 37.0 85-89 36.2434 37.0 37.0 37.0 37.0 37.0 90-94 36.2158 37.0 37.0 37.0 37.0 37.0 95-99 36.1389 37.0 37.0 37.0 37.0 37.0 100-104 36.16270000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.1479 37.0 37.0 37.0 37.0 37.0 110-114 36.1271 37.0 37.0 37.0 37.0 37.0 115-119 36.15990000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.019 37.0 37.0 37.0 37.0 37.0 125-129 36.0773 37.0 37.0 37.0 37.0 37.0 130-134 35.938900000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.9698 37.0 37.0 37.0 37.0 37.0 140-144 35.8977 37.0 37.0 37.0 37.0 37.0 145-149 35.8509 37.0 37.0 37.0 37.0 37.0 150-151 35.38575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 2.0 24 1.0 25 3.0 26 2.0 27 7.0 28 11.0 29 13.0 30 29.0 31 45.0 32 46.0 33 77.0 34 117.0 35 310.0 36 2936.0 37 398.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.374999999999996 15.575 11.375 41.675000000000004 2 20.00501378791677 22.06066683379293 38.12985710704437 19.804462271245924 3 17.7 28.050000000000004 27.325 26.924999999999997 4 21.6 32.95 22.45 23.0 5 21.55 38.25 22.975 17.224999999999998 6 17.675 36.8 25.45 20.075000000000003 7 13.0 20.7 45.25 21.05 8 17.599999999999998 22.475 29.45 30.475 9 17.224999999999998 22.75 32.375 27.650000000000002 10-14 19.62 29.25 27.250000000000004 23.880000000000003 15-19 19.45 28.51 27.775 24.265 20-24 19.400000000000002 29.23 27.400000000000002 23.97 25-29 19.759999999999998 28.655 27.725 23.86 30-34 20.145 28.904999999999998 27.915 23.035 35-39 19.55 29.21 27.525 23.715 40-44 19.77 28.4 27.810000000000002 24.02 45-49 19.415 28.67 27.965 23.95 50-54 19.785 28.449999999999996 27.875 23.89 55-59 19.985 28.67 27.500000000000004 23.845 60-64 20.330000000000002 27.939999999999998 28.02 23.71 65-69 19.72 28.865000000000002 27.855 23.56 70-74 19.634999999999998 28.455000000000002 28.13 23.78 75-79 19.935 28.89 27.47 23.705000000000002 80-84 20.119999999999997 27.839999999999996 27.700000000000003 24.34 85-89 20.115 28.970000000000002 27.33 23.585 90-94 20.225 28.325 27.495000000000005 23.955000000000002 95-99 20.415 27.865000000000002 27.63 24.09 100-104 19.89 28.095 28.084999999999997 23.93 105-109 20.4 28.155 28.005000000000003 23.44 110-114 20.9 28.575 27.205000000000002 23.32 115-119 20.79 28.785 26.625 23.799999999999997 120-124 20.345 28.93 27.185 23.54 125-129 20.895 28.375 27.034999999999997 23.695 130-134 20.525 28.77 27.055 23.65 135-139 21.05 27.97 26.685 24.295 140-144 21.02 28.32 27.005000000000003 23.655 145-149 20.830000000000002 28.084999999999997 26.640000000000004 24.445 150-151 20.724999999999998 28.037499999999998 27.5625 23.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 2.0 20 1.0 21 0.0 22 0.5 23 2.5 24 6.5 25 6.5 26 4.0 27 4.0 28 10.0 29 16.0 30 23.0 31 28.0 32 38.0 33 51.0 34 56.0 35 72.5 36 98.5 37 116.0 38 137.0 39 164.0 40 197.0 41 226.5 42 234.5 43 248.0 44 266.0 45 264.5 46 261.0 47 251.0 48 227.5 49 206.0 50 163.0 51 124.5 52 109.0 53 96.0 54 73.0 55 54.0 56 42.0 57 27.5 58 22.0 59 19.5 60 17.5 61 12.5 62 9.5 63 5.0 64 0.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.25 #Duplication Level Percentage of deduplicated Percentage of total 1 94.3501326259947 88.925 2 5.19893899204244 9.8 3 0.4509283819628647 1.275 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.6375 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.4749999999999996 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 2.9625 0.0 0.0 0.0 0.0 120-121 3.225 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.6375 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.199999999999999 0.0 0.0 0.0 0.0 130-131 4.7625 0.0 0.0 0.0 0.0 132-133 5.15 0.0 0.0 0.0 0.0 134-135 5.5625 0.0 0.0 0.0 0.0 136-137 6.1 0.0 0.0 0.0 0.0 138-139 6.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671674 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671674_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.288 37.0 37.0 37.0 37.0 37.0 2 35.9875 37.0 37.0 37.0 37.0 37.0 3 36.1985 37.0 37.0 37.0 37.0 37.0 4 36.2795 37.0 37.0 37.0 37.0 37.0 5 36.2795 37.0 37.0 37.0 37.0 37.0 6 36.2955 37.0 37.0 37.0 37.0 37.0 7 36.242 37.0 37.0 37.0 37.0 37.0 8 36.3025 37.0 37.0 37.0 37.0 37.0 9 36.193 37.0 37.0 37.0 37.0 37.0 10-14 36.294399999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2291 37.0 37.0 37.0 37.0 37.0 20-24 36.2183 37.0 37.0 37.0 37.0 37.0 25-29 36.194900000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.1677 37.0 37.0 37.0 37.0 37.0 35-39 36.1472 37.0 37.0 37.0 37.0 37.0 40-44 36.1079 37.0 37.0 37.0 37.0 37.0 45-49 36.0946 37.0 37.0 37.0 37.0 37.0 50-54 36.1392 37.0 37.0 37.0 37.0 37.0 55-59 36.049800000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.9636 37.0 37.0 37.0 37.0 37.0 65-69 35.941500000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.9516 37.0 37.0 37.0 37.0 37.0 75-79 35.9243 37.0 37.0 37.0 37.0 37.0 80-84 35.966899999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.8392 37.0 37.0 37.0 37.0 37.0 90-94 35.85209999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.882000000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8371 37.0 37.0 37.0 37.0 37.0 105-109 35.76520000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.673 37.0 37.0 37.0 37.0 37.0 115-119 35.6973 37.0 37.0 37.0 37.0 37.0 120-124 35.727199999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.6055 37.0 37.0 37.0 37.0 37.0 130-134 35.617399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.5519 37.0 37.0 37.0 37.0 37.0 140-144 35.2569 37.0 37.0 37.0 32.2 37.0 145-149 35.3116 37.0 37.0 37.0 32.2 37.0 150-151 34.89675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 2.0 15 4.0 16 0.0 17 1.0 18 0.0 19 1.0 20 1.0 21 4.0 22 4.0 23 5.0 24 3.0 25 5.0 26 10.0 27 12.0 28 14.0 29 24.0 30 27.0 31 32.0 32 67.0 33 109.0 34 211.0 35 533.0 36 2668.0 37 261.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.525 19.075 14.399999999999999 32.0 2 25.6 24.4 34.55 15.45 3 19.875 25.674999999999997 33.074999999999996 21.375 4 22.7 36.225 22.475 18.6 5 23.275000000000002 37.574999999999996 22.25 16.900000000000002 6 18.2 38.324999999999996 23.575 19.900000000000002 7 17.724999999999998 16.950000000000003 44.725 20.599999999999998 8 21.3 21.5 28.025 29.175 9 21.725 24.975 28.1 25.2 10-14 22.88 28.615000000000002 26.46 22.045 15-19 22.105 27.615000000000002 28.810000000000002 21.47 20-24 22.78 27.839999999999996 28.27 21.11 25-29 22.720000000000002 28.08 28.33 20.87 30-34 22.195 28.375 28.365000000000002 21.065 35-39 22.18 28.08 28.04 21.7 40-44 22.505 28.084999999999997 28.025 21.385 45-49 22.625 27.884999999999998 28.455000000000002 21.035 50-54 22.93 27.915 27.79 21.365000000000002 55-59 23.595 27.825 27.725 20.855 60-64 23.345 27.794999999999998 27.74 21.12 65-69 22.685 27.37 28.33 21.615000000000002 70-74 23.225 27.825 28.1 20.849999999999998 75-79 23.169999999999998 27.779999999999998 27.794999999999998 21.255 80-84 23.535 27.860000000000003 27.339999999999996 21.265 85-89 23.465 27.689999999999998 28.144999999999996 20.7 90-94 23.075000000000003 28.46 27.35 21.115000000000002 95-99 23.16 27.500000000000004 28.1 21.240000000000002 100-104 23.119999999999997 27.525 28.125 21.23 105-109 22.975 27.800000000000004 27.93 21.295 110-114 23.29 28.275 27.66 20.775 115-119 24.015 27.62 27.525 20.84 120-124 23.51 27.779999999999998 28.285 20.424999999999997 125-129 24.38 27.495000000000005 27.644999999999996 20.48 130-134 24.12 27.805000000000003 27.735 20.34 135-139 24.6 27.200000000000003 27.994999999999997 20.205000000000002 140-144 24.95 27.075 27.860000000000003 20.115 145-149 25.069999999999997 28.305000000000003 27.04 19.585 150-151 24.875 28.175 26.2875 20.6625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 1.0 14 2.5 15 2.0 16 0.5 17 0.0 18 1.5 19 2.5 20 1.5 21 3.0 22 3.0 23 2.5 24 2.0 25 2.5 26 5.5 27 6.5 28 8.0 29 10.0 30 14.0 31 23.0 32 36.0 33 44.5 34 51.5 35 70.0 36 89.5 37 108.0 38 132.0 39 156.0 40 184.5 41 216.0 42 233.0 43 243.0 44 254.0 45 263.0 46 274.0 47 260.5 48 247.5 49 208.5 50 158.5 51 132.5 52 117.0 53 99.5 54 75.0 55 62.0 56 44.5 57 35.0 58 27.0 59 24.5 60 21.0 61 14.5 62 9.0 63 4.0 64 2.5 65 0.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 94.2537909018356 88.575 2 5.107741420590583 9.6 3 0.6118648576749135 1.725 4 0.026602819898909287 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.3250000000000002 0.0 0.0 0.0 0.0 108-109 1.6125 0.0 0.0 0.0 0.0 110-111 1.8250000000000002 0.0 0.0 0.0 0.0 112-113 2.15 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 2.9125 0.0 0.0 0.0 0.0 120-121 3.175 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.6 0.0 0.0 0.0 0.0 126-127 3.8625 0.0 0.0 0.0 0.0 128-129 4.175000000000001 0.0 0.0 0.0 0.0 130-131 4.725 0.0 0.0 0.0 0.0 132-133 5.1 0.0 0.0 0.0 0.0 134-135 5.4875 0.0 0.0 0.0 0.0 136-137 6.0 0.0 0.0 0.0 0.0 138-139 6.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAAAA 10 0.006830828 145.0 7 AGATATC 10 0.006830828 145.0 4 >>END_MODULE Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266197 spots for SRR12671674.sra Written 1266197 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra Read 1266184 spots for SRR12671674.sra Written 1266184 spots for SRR12671674.sra SRR ids: ['SRR12671674.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6q404oah SRR12671674.sra spots: 25323693 blocks: [[1, 1266184], [1266185, 2532368], [2532369, 3798552], [3798553, 5064736], [5064737, 6330920], [6330921, 7597104], [7597105, 8863288], [8863289, 10129472], [10129473, 11395656], [11395657, 12661840], [12661841, 13928024], [13928025, 15194208], [15194209, 16460392], [16460393, 17726576], [17726577, 18992760], [18992761, 20258944], [20258945, 21525128], [21525129, 22791312], [22791313, 24057496], [24057497, 25323693]] SRR12671674 file size 8584398 SRR12671674 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671674 SRR12671674_1.fastq SRR12671674_2.fastq Input file: SRR12671674_1.fastq Paired file: SRR12671674_2.fastq trimmed: SRR12671674-trimmed-pair1.fastq, SRR12671674-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:20:39 2025 >> started Wed Feb 12 02:21:08 2025 >> done (29.722s) 25323693 read pairs processed; of these: 33 ( 0.00%) short read pairs filtered out after trimming by size control 6392 ( 0.03%) empty read pairs filtered out after trimming by size control 25317268 (99.97%) read pairs available; of these: 2607021 (10.30%) trimmed read pairs available after processing 22710247 (89.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 3 0.00% 20 1 0.00% 21 0 0.00% 22 5 0.00% 23 4 0.00% 24 8 0.00% 25 6 0.00% 26 9 0.00% 27 8 0.00% 28 10 0.00% 29 20 0.00% 30 16 0.00% 31 21 0.00% 32 26 0.00% 33 20 0.00% 34 33 0.00% 35 27 0.00% 36 36 0.00% 37 46 0.00% 38 61 0.00% 39 53 0.00% 40 69 0.00% 41 83 0.00% 42 89 0.00% 43 98 0.00% 44 105 0.00% 45 88 0.00% 46 93 0.00% 47 115 0.00% 48 135 0.00% 49 155 0.00% 50 154 0.00% 51 193 0.00% 52 211 0.00% 53 223 0.00% 54 238 0.00% 55 262 0.00% 56 266 0.00% 57 261 0.00% 58 295 0.00% 59 343 0.00% 60 421 0.00% 61 498 0.00% 62 519 0.00% 63 634 0.00% 64 670 0.00% 65 717 0.00% 66 758 0.00% 67 871 0.00% 68 925 0.00% 69 1030 0.00% 70 1222 0.00% 71 1379 0.01% 72 1609 0.01% 73 1847 0.01% 74 2010 0.01% 75 2247 0.01% 76 2340 0.01% 77 2572 0.01% 78 2868 0.01% 79 3122 0.01% 80 3446 0.01% 81 4037 0.02% 82 4607 0.02% 83 5078 0.02% 84 5734 0.02% 85 6286 0.02% 86 6698 0.03% 87 7215 0.03% 88 7884 0.03% 89 8364 0.03% 90 9067 0.04% 91 10182 0.04% 92 10895 0.04% 93 12206 0.05% 94 13327 0.05% 95 14175 0.06% 96 14860 0.06% 97 15776 0.06% 98 16479 0.07% 99 17484 0.07% 100 18543 0.07% 101 19579 0.08% 102 21175 0.08% 103 22224 0.09% 104 23632 0.09% 105 24639 0.10% 106 26321 0.10% 107 26795 0.11% 108 27782 0.11% 109 28861 0.11% 110 29375 0.12% 111 30696 0.12% 112 32308 0.13% 113 33562 0.13% 114 35058 0.14% 115 36293 0.14% 116 37793 0.15% 117 38839 0.15% 118 39580 0.16% 119 40370 0.16% 120 41414 0.16% 121 42951 0.17% 122 43969 0.17% 123 45114 0.18% 124 47114 0.19% 125 47872 0.19% 126 48932 0.19% 127 49839 0.20% 128 50623 0.20% 129 51450 0.20% 130 52390 0.21% 131 52735 0.21% 132 54393 0.21% 133 56311 0.22% 134 57622 0.23% 135 58964 0.23% 136 59745 0.24% 137 60545 0.24% 138 61424 0.24% 139 61827 0.24% 140 62182 0.25% 141 62633 0.25% 142 64918 0.26% 143 65645 0.26% 144 67939 0.27% 145 68415 0.27% 146 69957 0.28% 147 69187 0.27% 148 70464 0.28% 149 70295 0.28% 150 70772 0.28% 151 22710247 89.70% 25317268 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=29 prefix-density=0.49 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=30.14 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=9.1 sequence=CTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=30 prefix-density=0.65 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=30.82 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.6 sequence=ATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATTGGTCGACTATGGAAAAGATAGCGTTACCGTCAATATCCCATCAACTGGCGATGTATCATCTAGAAGCCAGCCTCCTACCTATGCCCCACGAACTGGCAGTGGATGTAGCATTTACCAACGAGATTGTCCTAAGAAAAAACCTTGTAATCCTTACAAGCGTAGCTGCCATCGCCCTTGAAAATGAAAGAGTAGTTTGATTTGGGTCCATTATCTAGTGGTAAAAGCTGTGAGCTCAAAGCACCAGGGCTATCTATTACTTTCATTTCCATTACCAATGTAATTA SRR12671674 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:21:52 Started mapping on | Feb 12 02:21:53 Finished on | Feb 12 02:24:20 Mapping speed, Million of reads per hour | 620.01 Number of input reads | 25317268 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 23833154 Uniquely mapped reads % | 94.14% Average mapped length | 295.62 Number of splices: Total | 23799012 Number of splices: Annotated (sjdb) | 23320805 Number of splices: GT/AG | 23322036 Number of splices: GC/AG | 385980 Number of splices: AT/AC | 13578 Number of splices: Non-canonical | 77418 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 587616 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 77729 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 896498 896498 896498 N_multimapping 587616 587616 587616 N_noFeature 912306 23473873 1049847 N_ambiguous 372500 1593 149809 UnstrandedReadsAssigned:22548348 PositiveStrandReadsAssigned:357688 NegativeStrandReadsAssigned:22633498 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671674 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671674-trimmed-pair1.fastq SRR12671674-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,317,268 reads, 22,626,415 reads pseudoaligned [quant] estimated average fragment length: 275.542 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52401 SRR12671674.ke.tsv 34699 SRR12671674.se.tsv 87100 total ==> SRR12671674.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.46 943 23.8383 Potri.005G024800.1.v4.1 1035 760.458 632 36.6284 Potri.004G059700.1.v4.1 961 686.964 1 0.0641567 Potri.007G009000.2.v4.1 1416 1141.46 0 0 Potri.003G141000.2.v4.1 2943 2668.46 1363.9 22.5267 Potri.016G087400.1.v4.1 270 86.3996 796 406.048 Potri.015G069301.1.v4.1 564 313.301 0 0 Potri.010G195200.1.v4.1 1773 1498.46 108.767 3.1991 Potri.012G127500.1.v4.1 977 702.769 626 39.2589 ==> SRR12671674.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 200 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12671674 completed mapping pipeline successfully