Starting /dee2/code/volunteer_pipeline.sh SRR12671675 current disk space = 3049118564352 free memory = 1291376728 SRR12671675 SRAfilesize cf17f7ab473e03faaef0480bb7000aaf SRR12671675.sra SRR12671675.sra file validated SRR12671675 is paired end SRR12671675 is conventional basespace SRR12671675 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671675_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.406 37.0 37.0 37.0 37.0 37.0 2 36.2015 37.0 37.0 37.0 37.0 37.0 3 36.456 37.0 37.0 37.0 37.0 37.0 4 36.5725 37.0 37.0 37.0 37.0 37.0 5 36.4665 37.0 37.0 37.0 37.0 37.0 6 36.5365 37.0 37.0 37.0 37.0 37.0 7 36.4685 37.0 37.0 37.0 37.0 37.0 8 36.6205 37.0 37.0 37.0 37.0 37.0 9 36.474 37.0 37.0 37.0 37.0 37.0 10-14 36.502 37.0 37.0 37.0 37.0 37.0 15-19 36.543 37.0 37.0 37.0 37.0 37.0 20-24 36.4764 37.0 37.0 37.0 37.0 37.0 25-29 36.4627 37.0 37.0 37.0 37.0 37.0 30-34 36.4612 37.0 37.0 37.0 37.0 37.0 35-39 36.404599999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.408500000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.405199999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.3748 37.0 37.0 37.0 37.0 37.0 55-59 36.374700000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3124 37.0 37.0 37.0 37.0 37.0 65-69 36.3587 37.0 37.0 37.0 37.0 37.0 70-74 36.2894 37.0 37.0 37.0 37.0 37.0 75-79 36.2632 37.0 37.0 37.0 37.0 37.0 80-84 36.271800000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.2768 37.0 37.0 37.0 37.0 37.0 90-94 36.1908 37.0 37.0 37.0 37.0 37.0 95-99 36.1468 37.0 37.0 37.0 37.0 37.0 100-104 36.181 37.0 37.0 37.0 37.0 37.0 105-109 36.1084 37.0 37.0 37.0 37.0 37.0 110-114 36.1645 37.0 37.0 37.0 37.0 37.0 115-119 36.0995 37.0 37.0 37.0 37.0 37.0 120-124 36.0329 37.0 37.0 37.0 37.0 37.0 125-129 36.075799999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.9576 37.0 37.0 37.0 37.0 37.0 135-139 35.970099999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.8976 37.0 37.0 37.0 37.0 37.0 145-149 35.8548 37.0 37.0 37.0 37.0 37.0 150-151 35.42875 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 4.0 26 4.0 27 6.0 28 10.0 29 28.0 30 24.0 31 32.0 32 42.0 33 83.0 34 105.0 35 326.0 36 2962.0 37 371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.499999999999996 14.7 13.575000000000001 43.225 2 20.707831325301203 20.406626506024097 38.07730923694779 20.80823293172691 3 18.675 25.95 26.625 28.749999999999996 4 21.5 33.475 22.925 22.1 5 20.349999999999998 37.2 23.474999999999998 18.975 6 17.25 36.375 25.775 20.599999999999998 7 13.375 21.175 44.75 20.7 8 18.325 21.85 30.175 29.65 9 16.85 23.125 33.5 26.525 10-14 19.919999999999998 29.62 26.334999999999997 24.125 15-19 19.575 28.335 28.175 23.915 20-24 19.6 28.935 27.474999999999998 23.990000000000002 25-29 19.91 28.535 26.91 24.645 30-34 19.1 29.110000000000003 27.284999999999997 24.505 35-39 20.235 27.865000000000002 27.735 24.165 40-44 19.85 28.705000000000002 27.685 23.76 45-49 20.200000000000003 28.34 27.46 24.0 50-54 20.165 28.065 28.139999999999997 23.630000000000003 55-59 20.05 28.384999999999998 27.644999999999996 23.919999999999998 60-64 20.325 28.595 27.185 23.895 65-69 20.495 28.299999999999997 27.55 23.655 70-74 20.19 27.395000000000003 27.744999999999997 24.67 75-79 20.27 28.705000000000002 27.16 23.865 80-84 20.605 28.465 27.005000000000003 23.925 85-89 20.07 28.475 27.52 23.935000000000002 90-94 20.525 28.585 27.089999999999996 23.799999999999997 95-99 20.73 28.62 27.310000000000002 23.34 100-104 20.965 28.405 26.935 23.695 105-109 20.03 28.475 28.04 23.455000000000002 110-114 21.275 27.88 27.165 23.68 115-119 20.815 28.275 26.97 23.94 120-124 20.505000000000003 27.58 27.375 24.54 125-129 20.84 28.255000000000003 26.625 24.279999999999998 130-134 20.76 28.29 26.875 24.075 135-139 20.74 27.72 27.725 23.815 140-144 20.95 27.860000000000003 27.055 24.135 145-149 21.075 28.425 26.845000000000002 23.655 150-151 21.925 27.737499999999997 26.825 23.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.5 22 2.0 23 1.5 24 3.5 25 5.0 26 4.5 27 5.0 28 10.0 29 15.5 30 15.5 31 19.5 32 28.5 33 40.0 34 53.0 35 83.0 36 101.5 37 110.5 38 137.5 39 156.0 40 188.0 41 204.5 42 219.5 43 267.5 44 282.5 45 264.0 46 261.0 47 249.5 48 224.0 49 199.5 50 175.0 51 132.5 52 105.0 53 91.5 54 68.5 55 65.0 56 55.5 57 39.5 58 30.5 59 25.5 60 21.5 61 14.0 62 7.5 63 4.5 64 2.5 65 3.0 66 1.0 67 0.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.875 #Duplication Level Percentage of deduplicated Percentage of total 1 93.98135818908122 88.225 2 5.699067909454062 10.7 3 0.2663115845539281 0.75 4 0.0 0.0 5 0.0 0.0 6 0.02663115845539281 0.15 7 0.02663115845539281 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 7 0.17500000000000002 No Hit GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0125 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0125 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.075 0.0 0.0 0.025 0.0 86-87 0.1125 0.0 0.0 0.025 0.0 88-89 0.1875 0.0 0.0 0.025 0.0 90-91 0.2 0.0 0.0 0.025 0.0 92-93 0.2375 0.0 0.0 0.025 0.0 94-95 0.2625 0.0 0.0 0.025 0.0 96-97 0.3625 0.0 0.0 0.025 0.0 98-99 0.4625 0.0 0.0 0.025 0.0 100-101 0.4875 0.0 0.0 0.025 0.0 102-103 0.5875 0.0 0.0 0.025 0.0 104-105 0.7 0.0 0.0 0.025 0.0 106-107 0.7124999999999999 0.0 0.0 0.025 0.0 108-109 0.7625 0.0 0.0 0.025 0.0 110-111 0.8375 0.0 0.0 0.025 0.0 112-113 0.9 0.0 0.0 0.025 0.0 114-115 1.0625 0.0 0.0 0.025 0.0 116-117 1.275 0.0 0.0 0.025 0.0 118-119 1.425 0.0 0.0 0.025 0.0 120-121 1.6625 0.0 0.0 0.025 0.0 122-123 1.775 0.0 0.0 0.025 0.0 124-125 1.9125 0.0 0.0 0.025 0.0 126-127 2.0374999999999996 0.0 0.0 0.025 0.0 128-129 2.2750000000000004 0.0 0.0 0.025 0.0 130-131 2.425 0.0 0.0 0.025 0.0 132-133 2.5875 0.0 0.0 0.025 0.0 134-135 2.9875 0.0 0.0 0.025 0.0 136-137 3.4124999999999996 0.0 0.0 0.025 0.0 138-139 3.825 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACAT 10 0.006830828 145.0 1 >>END_MODULE SRR12671675 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671675_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.225 37.0 37.0 37.0 37.0 37.0 2 35.9785 37.0 37.0 37.0 37.0 37.0 3 36.1665 37.0 37.0 37.0 37.0 37.0 4 36.1355 37.0 37.0 37.0 37.0 37.0 5 36.2995 37.0 37.0 37.0 37.0 37.0 6 36.225 37.0 37.0 37.0 37.0 37.0 7 36.2915 37.0 37.0 37.0 37.0 37.0 8 36.336 37.0 37.0 37.0 37.0 37.0 9 36.3035 37.0 37.0 37.0 37.0 37.0 10-14 36.2747 37.0 37.0 37.0 37.0 37.0 15-19 36.2246 37.0 37.0 37.0 37.0 37.0 20-24 36.196999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1529 37.0 37.0 37.0 37.0 37.0 30-34 36.171499999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.131 37.0 37.0 37.0 37.0 37.0 40-44 36.1215 37.0 37.0 37.0 37.0 37.0 45-49 36.146100000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.0735 37.0 37.0 37.0 37.0 37.0 55-59 36.0033 37.0 37.0 37.0 37.0 37.0 60-64 35.9692 37.0 37.0 37.0 37.0 37.0 65-69 35.997800000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.9529 37.0 37.0 37.0 37.0 37.0 75-79 35.87089999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.8469 37.0 37.0 37.0 37.0 37.0 85-89 35.82770000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.8264 37.0 37.0 37.0 37.0 37.0 95-99 35.856899999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.7919 37.0 37.0 37.0 37.0 37.0 105-109 35.7531 37.0 37.0 37.0 37.0 37.0 110-114 35.6974 37.0 37.0 37.0 37.0 37.0 115-119 35.6813 37.0 37.0 37.0 37.0 37.0 120-124 35.6429 37.0 37.0 37.0 37.0 37.0 125-129 35.630100000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.5881 37.0 37.0 37.0 37.0 37.0 135-139 35.5738 37.0 37.0 37.0 37.0 37.0 140-144 35.3806 37.0 37.0 37.0 34.6 37.0 145-149 35.4085 37.0 37.0 37.0 34.6 37.0 150-151 34.994749999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 2.0 20 1.0 21 0.0 22 2.0 23 3.0 24 3.0 25 8.0 26 10.0 27 6.0 28 22.0 29 21.0 30 28.0 31 58.0 32 61.0 33 114.0 34 195.0 35 584.0 36 2645.0 37 233.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.775 16.875 16.7 32.65 2 23.775 23.075000000000003 35.875 17.275 3 20.075000000000003 26.424999999999997 31.474999999999998 22.025 4 23.1 36.275 20.45 20.175 5 23.05 36.675000000000004 21.925 18.35 6 17.9 39.525 24.525 18.05 7 18.725 17.575 40.625 23.075000000000003 8 19.925 23.95 27.85 28.275 9 21.525 22.975 29.275000000000002 26.224999999999998 10-14 22.42 28.939999999999998 26.205000000000002 22.435 15-19 21.81 28.18 27.810000000000002 22.2 20-24 22.220000000000002 28.375 27.900000000000002 21.505 25-29 22.395 28.37 27.715 21.52 30-34 22.32 28.15 27.67 21.86 35-39 22.2 28.865000000000002 27.345000000000002 21.59 40-44 22.33 28.27 27.495000000000005 21.905 45-49 22.095000000000002 28.549999999999997 27.48 21.875 50-54 23.04 27.705000000000002 27.395000000000003 21.86 55-59 22.48 27.575 28.235 21.709999999999997 60-64 22.78 27.334999999999997 27.83 22.055 65-69 23.235 27.495000000000005 27.35 21.92 70-74 23.31 27.185 27.61 21.895 75-79 22.905 27.465 27.32 22.31 80-84 22.56 27.884999999999998 27.6 21.955 85-89 23.655 27.145000000000003 27.725 21.475 90-94 23.580000000000002 27.99 26.974999999999998 21.455 95-99 23.035 27.894999999999996 27.61 21.46 100-104 22.855 27.055 28.32 21.77 105-109 23.599999999999998 27.865000000000002 27.62 20.915 110-114 23.655 27.375 27.325 21.645 115-119 23.880000000000003 27.92 27.41 20.79 120-124 22.915 28.055000000000003 27.295 21.735 125-129 23.805 27.99 27.18 21.025 130-134 23.985 27.235 27.529999999999998 21.25 135-139 24.09 28.28 27.025 20.605 140-144 24.415 27.474999999999998 27.169999999999998 20.94 145-149 24.305 27.544999999999998 27.255000000000003 20.895 150-151 24.775 27.425 26.674999999999997 21.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.5 21 1.5 22 1.5 23 1.0 24 2.0 25 3.5 26 4.5 27 3.5 28 4.5 29 9.5 30 18.0 31 23.0 32 31.5 33 39.0 34 46.5 35 63.5 36 81.0 37 99.5 38 127.0 39 164.0 40 188.5 41 203.0 42 222.0 43 243.0 44 279.5 45 287.0 46 264.0 47 245.0 48 215.5 49 199.5 50 167.0 51 131.5 52 125.5 53 110.5 54 83.0 55 64.0 56 64.0 57 53.5 58 30.0 59 23.0 60 22.0 61 14.0 62 12.0 63 11.0 64 5.0 65 2.5 66 1.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.94505201387037 88.05 2 5.521472392638037 10.35 3 0.480128034142438 1.35 4 0.026673779674579887 0.1 5 0.0 0.0 6 0.026673779674579887 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.425 0.0 0.0 0.0 0.0 120-121 1.6749999999999998 0.0 0.0 0.0 0.0 122-123 1.7999999999999998 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.0875000000000004 0.0 0.0 0.0 0.0 128-129 2.325 0.0 0.0 0.0 0.0 130-131 2.4749999999999996 0.0 0.0 0.0 0.0 132-133 2.6375 0.0 0.0 0.0 0.0 134-135 3.0375 0.0 0.0 0.0 0.0 136-137 3.4625000000000004 0.0 0.0 0.0 0.0 138-139 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205186 spots for SRR12671675.sra Written 1205186 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra Read 1205179 spots for SRR12671675.sra Written 1205179 spots for SRR12671675.sra SRR ids: ['SRR12671675.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5z7i92vm SRR12671675.sra spots: 24103587 blocks: [[1, 1205179], [1205180, 2410358], [2410359, 3615537], [3615538, 4820716], [4820717, 6025895], [6025896, 7231074], [7231075, 8436253], [8436254, 9641432], [9641433, 10846611], [10846612, 12051790], [12051791, 13256969], [13256970, 14462148], [14462149, 15667327], [15667328, 16872506], [16872507, 18077685], [18077686, 19282864], [19282865, 20488043], [20488044, 21693222], [21693223, 22898401], [22898402, 24103587]] SRR12671675 file size 8169753 SRR12671675 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671675 SRR12671675_1.fastq SRR12671675_2.fastq Input file: SRR12671675_1.fastq Paired file: SRR12671675_2.fastq trimmed: SRR12671675-trimmed-pair1.fastq, SRR12671675-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:54:57 2025 >> started Wed Feb 12 02:55:35 2025 >> done (37.781s) 24103587 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 3346 ( 0.01%) empty read pairs filtered out after trimming by size control 24100227 (99.99%) read pairs available; of these: 1470666 ( 6.10%) trimmed read pairs available after processing 22629561 (93.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 6 0.00% 22 2 0.00% 23 3 0.00% 24 2 0.00% 25 9 0.00% 26 4 0.00% 27 4 0.00% 28 5 0.00% 29 6 0.00% 30 10 0.00% 31 10 0.00% 32 11 0.00% 33 12 0.00% 34 11 0.00% 35 23 0.00% 36 13 0.00% 37 20 0.00% 38 22 0.00% 39 22 0.00% 40 29 0.00% 41 30 0.00% 42 39 0.00% 43 29 0.00% 44 42 0.00% 45 39 0.00% 46 47 0.00% 47 53 0.00% 48 65 0.00% 49 48 0.00% 50 82 0.00% 51 80 0.00% 52 74 0.00% 53 105 0.00% 54 103 0.00% 55 112 0.00% 56 104 0.00% 57 122 0.00% 58 132 0.00% 59 154 0.00% 60 172 0.00% 61 159 0.00% 62 215 0.00% 63 228 0.00% 64 263 0.00% 65 299 0.00% 66 287 0.00% 67 318 0.00% 68 424 0.00% 69 421 0.00% 70 435 0.00% 71 540 0.00% 72 566 0.00% 73 691 0.00% 74 702 0.00% 75 879 0.00% 76 905 0.00% 77 993 0.00% 78 1117 0.00% 79 1192 0.00% 80 1409 0.01% 81 1565 0.01% 82 1720 0.01% 83 1928 0.01% 84 2218 0.01% 85 2478 0.01% 86 2733 0.01% 87 2880 0.01% 88 3061 0.01% 89 3408 0.01% 90 3596 0.01% 91 3937 0.02% 92 4424 0.02% 93 4977 0.02% 94 5233 0.02% 95 5847 0.02% 96 6251 0.03% 97 6665 0.03% 98 7148 0.03% 99 7564 0.03% 100 8029 0.03% 101 8493 0.04% 102 9339 0.04% 103 9715 0.04% 104 10082 0.04% 105 11007 0.05% 106 11475 0.05% 107 12435 0.05% 108 12927 0.05% 109 13661 0.06% 110 14058 0.06% 111 14911 0.06% 112 15456 0.06% 113 15821 0.07% 114 16939 0.07% 115 17703 0.07% 116 18587 0.08% 117 19327 0.08% 118 20104 0.08% 119 20865 0.09% 120 21678 0.09% 121 22771 0.09% 122 23555 0.10% 123 24423 0.10% 124 25341 0.11% 125 26045 0.11% 126 27240 0.11% 127 27903 0.12% 128 28600 0.12% 129 29445 0.12% 130 30100 0.12% 131 30900 0.13% 132 32030 0.13% 133 33667 0.14% 134 34307 0.14% 135 35154 0.15% 136 36082 0.15% 137 36789 0.15% 138 38033 0.16% 139 39124 0.16% 140 39894 0.17% 141 40793 0.17% 142 42126 0.17% 143 42822 0.18% 144 45204 0.19% 145 45305 0.19% 146 46768 0.19% 147 46725 0.19% 148 47611 0.20% 149 48319 0.20% 150 49442 0.21% 151 22629561 93.90% 24100227 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=32 prefix-density=0.38 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=99.34 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=6.8 sequence=TCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGATATAGCTAGGGACACATCAAGTTCTGGGACGACTTAGACACCTTTCGGCTTGGCGGCAATAAAGCTGATGCACTGCACTTGACG criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=30 prefix-density=0.67 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.12 sequence-density-rank=29 fanout-score=12.71 fanout-score-rank=1 prefix-density=1.20 prefix-fanout=1.2 sequence=CAGCTACACTGATGCAACCCACCAAGGTGGGTGTGCCTTCTAGGACCAGCCTTCAACT SRR12671675 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:56:22 Started mapping on | Feb 12 02:56:22 Finished on | Feb 12 02:58:58 Mapping speed, Million of reads per hour | 556.16 Number of input reads | 24100227 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22652030 Uniquely mapped reads % | 93.99% Average mapped length | 298.10 Number of splices: Total | 23132131 Number of splices: Annotated (sjdb) | 22632593 Number of splices: GT/AG | 22671583 Number of splices: GC/AG | 377912 Number of splices: AT/AC | 13965 Number of splices: Non-canonical | 68671 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 594482 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 200174 % of reads mapped to too many loci | 0.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.52% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 853715 853715 853715 N_multimapping 594482 594482 594482 N_noFeature 884770 22225185 1016097 N_ambiguous 435513 1902 138847 UnstrandedReadsAssigned:21331747 PositiveStrandReadsAssigned:424943 NegativeStrandReadsAssigned:21497086 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671675 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671675-trimmed-pair1.fastq SRR12671675-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,100,227 reads, 21,490,794 reads pseudoaligned [quant] estimated average fragment length: 297.689 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR12671675.ke.tsv 34699 SRR12671675.se.tsv 87100 total ==> SRR12671675.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1721.31 859 19.4826 Potri.005G024800.1.v4.1 1035 738.311 380 20.0936 Potri.004G059700.1.v4.1 961 664.835 0 0 Potri.007G009000.2.v4.1 1416 1119.31 0 0 Potri.003G141000.2.v4.1 2943 2646.31 1334.98 19.6946 Potri.016G087400.1.v4.1 270 76.616 1031.08 525.395 Potri.015G069301.1.v4.1 564 294.688 0 0 Potri.010G195200.1.v4.1 1773 1476.31 107 2.82957 Potri.012G127500.1.v4.1 977 680.602 88 5.04781 ==> SRR12671675.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 200 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 90 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR12671675 completed mapping pipeline successfully