Starting /dee2/code/volunteer_pipeline.sh SRR12671676 current disk space = 3049572229120 free memory = 1264230188 SRR12671676 SRAfilesize aba5bbcae6c14d0c62488ebfa1e690d4 SRR12671676.sra SRR12671676.sra file validated SRR12671676 is paired end SRR12671676 is conventional basespace SRR12671676 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671676_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.417 37.0 37.0 37.0 37.0 37.0 2 36.31625 37.0 37.0 37.0 37.0 37.0 3 36.5865 37.0 37.0 37.0 37.0 37.0 4 36.568 37.0 37.0 37.0 37.0 37.0 5 36.663 37.0 37.0 37.0 37.0 37.0 6 36.617 37.0 37.0 37.0 37.0 37.0 7 36.551 37.0 37.0 37.0 37.0 37.0 8 36.547 37.0 37.0 37.0 37.0 37.0 9 36.5395 37.0 37.0 37.0 37.0 37.0 10-14 36.597699999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5472 37.0 37.0 37.0 37.0 37.0 20-24 36.552699999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.5025 37.0 37.0 37.0 37.0 37.0 30-34 36.492599999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4954 37.0 37.0 37.0 37.0 37.0 40-44 36.4568 37.0 37.0 37.0 37.0 37.0 45-49 36.4204 37.0 37.0 37.0 37.0 37.0 50-54 36.4094 37.0 37.0 37.0 37.0 37.0 55-59 36.4161 37.0 37.0 37.0 37.0 37.0 60-64 36.3719 37.0 37.0 37.0 37.0 37.0 65-69 36.3731 37.0 37.0 37.0 37.0 37.0 70-74 36.326600000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.202 37.0 37.0 37.0 37.0 37.0 80-84 36.3008 37.0 37.0 37.0 37.0 37.0 85-89 36.240399999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.197199999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.206 37.0 37.0 37.0 37.0 37.0 100-104 36.2282 37.0 37.0 37.0 37.0 37.0 105-109 36.1297 37.0 37.0 37.0 37.0 37.0 110-114 36.183400000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.1487 37.0 37.0 37.0 37.0 37.0 120-124 36.101800000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.0994 37.0 37.0 37.0 37.0 37.0 130-134 35.973499999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.9671 37.0 37.0 37.0 37.0 37.0 140-144 35.9332 37.0 37.0 37.0 37.0 37.0 145-149 35.8509 37.0 37.0 37.0 37.0 37.0 150-151 35.4285 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 2.0 26 3.0 27 7.0 28 7.0 29 15.0 30 24.0 31 39.0 32 38.0 33 72.0 34 105.0 35 348.0 36 2982.0 37 355.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.975 13.575000000000001 13.325000000000001 44.125 2 20.51667920742413 20.566842237271132 38.75094055680963 20.165537998495108 3 18.85 23.799999999999997 27.075 30.275000000000002 4 22.125 33.875 21.2 22.8 5 21.15 36.075 24.275 18.5 6 17.675 34.625 27.175 20.525 7 14.575 21.025 44.1 20.3 8 18.475 22.425 29.4 29.7 9 18.55 23.724999999999998 31.924999999999997 25.8 10-14 19.785 29.515 27.075 23.625 15-19 20.044999999999998 27.894999999999996 27.839999999999996 24.22 20-24 19.919999999999998 28.73 27.845 23.505000000000003 25-29 19.82 28.43 27.534999999999997 24.215 30-34 19.985 28.53 27.284999999999997 24.2 35-39 19.634999999999998 28.189999999999998 27.889999999999997 24.285 40-44 20.585 28.244999999999997 27.3 23.87 45-49 20.150000000000002 29.375 26.455000000000002 24.02 50-54 19.865 28.999999999999996 27.85 23.285 55-59 20.47 28.215 27.750000000000004 23.565 60-64 20.445 28.470000000000002 27.76 23.325000000000003 65-69 20.265 28.794999999999998 27.455000000000002 23.485 70-74 20.205000000000002 28.415000000000003 27.465 23.915 75-79 20.27 28.244999999999997 27.715 23.77 80-84 20.755000000000003 28.694999999999997 26.924999999999997 23.625 85-89 21.029999999999998 28.384999999999998 26.950000000000003 23.635 90-94 20.215 28.115000000000002 27.58 24.09 95-99 20.62 28.08 27.169999999999998 24.13 100-104 20.41 28.29 27.87 23.43 105-109 20.445 28.494999999999997 27.224999999999998 23.835 110-114 20.97 27.839999999999996 27.825 23.365 115-119 20.36 28.105000000000004 27.794999999999998 23.74 120-124 20.365 28.49 27.034999999999997 24.11 125-129 20.59 27.905 27.805000000000003 23.7 130-134 20.76 27.99 27.575 23.674999999999997 135-139 20.51 27.889999999999997 27.779999999999998 23.82 140-144 20.69 27.73 27.37 24.21 145-149 20.724999999999998 28.525 27.500000000000004 23.25 150-151 20.6125 27.3125 27.750000000000004 24.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 1.5 22 2.0 23 0.5 24 1.5 25 2.5 26 4.5 27 8.0 28 11.5 29 18.5 30 21.5 31 20.5 32 27.0 33 41.5 34 64.5 35 74.5 36 85.5 37 112.5 38 142.5 39 151.0 40 164.0 41 207.0 42 226.5 43 251.0 44 276.5 45 269.5 46 256.5 47 244.5 48 230.0 49 217.0 50 185.5 51 147.0 52 122.5 53 96.0 54 75.0 55 56.5 56 39.5 57 34.0 58 30.0 59 22.0 60 15.5 61 11.0 62 10.0 63 8.0 64 3.5 65 3.0 66 2.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.8 #Duplication Level Percentage of deduplicated Percentage of total 1 94.85759493670885 89.925 2 4.825949367088608 9.15 3 0.290084388185654 0.8250000000000001 4 0.026371308016877634 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.7625 0.0 0.0 0.0 0.0 124-125 0.9125000000000001 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.0750000000000002 0.0 0.0 0.0 0.0 130-131 1.2000000000000002 0.0 0.0 0.0 0.0 132-133 1.2625000000000002 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.525 0.0 0.0 0.0 0.0 138-139 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671676 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671676_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.312 37.0 37.0 37.0 37.0 37.0 2 36.2075 37.0 37.0 37.0 37.0 37.0 3 36.429 37.0 37.0 37.0 37.0 37.0 4 36.2595 37.0 37.0 37.0 37.0 37.0 5 36.356 37.0 37.0 37.0 37.0 37.0 6 36.357 37.0 37.0 37.0 37.0 37.0 7 36.4275 37.0 37.0 37.0 37.0 37.0 8 36.387 37.0 37.0 37.0 37.0 37.0 9 36.392 37.0 37.0 37.0 37.0 37.0 10-14 36.3791 37.0 37.0 37.0 37.0 37.0 15-19 36.349 37.0 37.0 37.0 37.0 37.0 20-24 36.301300000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.3046 37.0 37.0 37.0 37.0 37.0 30-34 36.26610000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.2358 37.0 37.0 37.0 37.0 37.0 40-44 36.1846 37.0 37.0 37.0 37.0 37.0 45-49 36.15599999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.0924 37.0 37.0 37.0 37.0 37.0 55-59 36.1374 37.0 37.0 37.0 37.0 37.0 60-64 36.0315 37.0 37.0 37.0 37.0 37.0 65-69 36.0385 37.0 37.0 37.0 37.0 37.0 70-74 36.0777 37.0 37.0 37.0 37.0 37.0 75-79 35.951499999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.9764 37.0 37.0 37.0 37.0 37.0 85-89 35.9102 37.0 37.0 37.0 37.0 37.0 90-94 35.894 37.0 37.0 37.0 37.0 37.0 95-99 35.9391 37.0 37.0 37.0 37.0 37.0 100-104 35.874700000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.8639 37.0 37.0 37.0 37.0 37.0 110-114 35.7958 37.0 37.0 37.0 37.0 37.0 115-119 35.800200000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.749900000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.7292 37.0 37.0 37.0 37.0 37.0 130-134 35.772499999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.74679999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.4594 37.0 37.0 37.0 37.0 37.0 145-149 35.5667 37.0 37.0 37.0 37.0 37.0 150-151 35.176 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 1.0 15 1.0 16 0.0 17 0.0 18 2.0 19 0.0 20 1.0 21 0.0 22 4.0 23 7.0 24 8.0 25 6.0 26 4.0 27 11.0 28 8.0 29 16.0 30 23.0 31 26.0 32 60.0 33 96.0 34 169.0 35 540.0 36 2768.0 37 246.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.2 16.6 15.950000000000001 36.25 2 24.5 24.725 36.35 14.424999999999999 3 19.650000000000002 26.35 32.275 21.725 4 21.7 33.975 23.95 20.375 5 23.875 36.275 22.650000000000002 17.2 6 18.25 37.574999999999996 24.3 19.875 7 17.724999999999998 15.725 45.2 21.349999999999998 8 21.05 22.45 27.150000000000002 29.349999999999998 9 21.275 24.5 30.625000000000004 23.599999999999998 10-14 22.41 28.634999999999998 27.04 21.915000000000003 15-19 22.015 28.21 28.37 21.404999999999998 20-24 22.455 27.865000000000002 28.560000000000002 21.12 25-29 22.040000000000003 27.985 28.49 21.485000000000003 30-34 21.86 28.09 28.389999999999997 21.66 35-39 22.98 27.250000000000004 28.42 21.349999999999998 40-44 22.645 28.03 27.560000000000002 21.765 45-49 22.895 28.349999999999998 27.265 21.490000000000002 50-54 22.955000000000002 28.235 27.834999999999997 20.974999999999998 55-59 22.74 27.515 28.144999999999996 21.6 60-64 23.24 27.685 27.48 21.595 65-69 22.705000000000002 26.900000000000002 28.27 22.125 70-74 22.86 27.12 28.194999999999997 21.825 75-79 22.975 27.935 27.875 21.215 80-84 22.825 28.71 27.465 21.0 85-89 23.35 28.005000000000003 27.43 21.215 90-94 23.485 27.91 27.589999999999996 21.015 95-99 23.45 27.62 27.76 21.17 100-104 23.355 27.38 28.285 20.979999999999997 105-109 22.96 27.505000000000003 28.055000000000003 21.48 110-114 23.34 27.794999999999998 27.834999999999997 21.029999999999998 115-119 23.34 28.244999999999997 26.924999999999997 21.490000000000002 120-124 23.369999999999997 27.83 27.61 21.19 125-129 24.05 27.47 27.48 21.0 130-134 23.715 27.665 27.675 20.945 135-139 24.349999999999998 27.334999999999997 27.389999999999997 20.925 140-144 23.685000000000002 27.87 27.33 21.115000000000002 145-149 24.38 28.49 26.87 20.26 150-151 24.587500000000002 28.037499999999998 27.375 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 2.0 16 2.0 17 0.5 18 0.0 19 0.0 20 1.5 21 2.5 22 2.0 23 1.0 24 1.5 25 1.5 26 4.0 27 5.5 28 8.0 29 17.5 30 22.5 31 24.5 32 25.0 33 36.0 34 48.0 35 52.5 36 80.0 37 115.0 38 139.5 39 162.5 40 189.5 41 215.0 42 237.5 43 253.0 44 262.0 45 271.5 46 277.5 47 265.0 48 234.5 49 195.5 50 159.0 51 141.5 52 121.0 53 100.5 54 78.0 55 57.5 56 45.5 57 36.0 58 29.5 59 22.0 60 16.5 61 11.5 62 9.5 63 5.5 64 1.5 65 1.5 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.80073898126155 89.8 2 4.85616257587754 9.2 3 0.3167062549485352 0.8999999999999999 4 0.026392187912377938 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.7875 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.0 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.2125 0.0 0.0 0.0 0.0 132-133 1.2625000000000002 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.525 0.0 0.0 0.0 0.0 138-139 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 40 0.0076550315 18.125 1 >>END_MODULE Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063371 spots for SRR12671676.sra Written 1063371 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra Read 1063369 spots for SRR12671676.sra Written 1063369 spots for SRR12671676.sra SRR ids: ['SRR12671676.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tphfax2m SRR12671676.sra spots: 21267382 blocks: [[1, 1063369], [1063370, 2126738], [2126739, 3190107], [3190108, 4253476], [4253477, 5316845], [5316846, 6380214], [6380215, 7443583], [7443584, 8506952], [8506953, 9570321], [9570322, 10633690], [10633691, 11697059], [11697060, 12760428], [12760429, 13823797], [13823798, 14887166], [14887167, 15950535], [15950536, 17013904], [17013905, 18077273], [18077274, 19140642], [19140643, 20204011], [20204012, 21267382]] SRR12671676 file size 7205886 SRR12671676 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671676 SRR12671676_1.fastq SRR12671676_2.fastq Input file: SRR12671676_1.fastq Paired file: SRR12671676_2.fastq trimmed: SRR12671676-trimmed-pair1.fastq, SRR12671676-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:21:22 2025 >> started Wed Feb 12 02:21:58 2025 >> done (35.513s) 21267382 read pairs processed; of these: 10 ( 0.00%) short read pairs filtered out after trimming by size control 794 ( 0.00%) empty read pairs filtered out after trimming by size control 21266578 (100.00%) read pairs available; of these: 592796 ( 2.79%) trimmed read pairs available after processing 20673782 (97.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 4 0.00% 23 3 0.00% 24 4 0.00% 25 1 0.00% 26 4 0.00% 27 4 0.00% 28 3 0.00% 29 7 0.00% 30 4 0.00% 31 8 0.00% 32 2 0.00% 33 7 0.00% 34 9 0.00% 35 10 0.00% 36 8 0.00% 37 6 0.00% 38 4 0.00% 39 12 0.00% 40 14 0.00% 41 12 0.00% 42 18 0.00% 43 18 0.00% 44 18 0.00% 45 16 0.00% 46 15 0.00% 47 16 0.00% 48 23 0.00% 49 19 0.00% 50 35 0.00% 51 36 0.00% 52 27 0.00% 53 39 0.00% 54 38 0.00% 55 55 0.00% 56 46 0.00% 57 50 0.00% 58 45 0.00% 59 66 0.00% 60 69 0.00% 61 81 0.00% 62 77 0.00% 63 88 0.00% 64 95 0.00% 65 117 0.00% 66 124 0.00% 67 107 0.00% 68 127 0.00% 69 142 0.00% 70 166 0.00% 71 205 0.00% 72 208 0.00% 73 218 0.00% 74 273 0.00% 75 276 0.00% 76 296 0.00% 77 360 0.00% 78 358 0.00% 79 453 0.00% 80 416 0.00% 81 506 0.00% 82 579 0.00% 83 674 0.00% 84 732 0.00% 85 848 0.00% 86 868 0.00% 87 972 0.00% 88 1035 0.00% 89 1150 0.01% 90 1282 0.01% 91 1391 0.01% 92 1480 0.01% 93 1620 0.01% 94 1728 0.01% 95 1994 0.01% 96 2067 0.01% 97 2275 0.01% 98 2313 0.01% 99 2462 0.01% 100 2624 0.01% 101 2891 0.01% 102 3101 0.01% 103 3330 0.02% 104 3531 0.02% 105 3661 0.02% 106 4025 0.02% 107 4085 0.02% 108 4398 0.02% 109 4714 0.02% 110 4961 0.02% 111 5173 0.02% 112 5413 0.03% 113 5734 0.03% 114 6090 0.03% 115 6489 0.03% 116 6711 0.03% 117 6871 0.03% 118 7307 0.03% 119 7483 0.04% 120 7966 0.04% 121 8207 0.04% 122 8605 0.04% 123 9064 0.04% 124 9376 0.04% 125 9859 0.05% 126 10348 0.05% 127 11007 0.05% 128 11261 0.05% 129 11283 0.05% 130 11651 0.05% 131 12243 0.06% 132 12821 0.06% 133 13599 0.06% 134 13850 0.07% 135 14654 0.07% 136 14825 0.07% 137 15373 0.07% 138 15997 0.08% 139 16845 0.08% 140 16926 0.08% 141 17368 0.08% 142 18303 0.09% 143 18833 0.09% 144 20050 0.09% 145 20577 0.10% 146 21505 0.10% 147 21924 0.10% 148 22587 0.11% 149 22801 0.11% 150 23553 0.11% 151 20673782 97.21% 21266578 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=30 prefix-density=0.54 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=54.43 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.7 sequence=CAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=24 prefix-density=0.69 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=22.13 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=6.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR12671676 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:23:12 Started mapping on | Feb 12 02:23:12 Finished on | Feb 12 02:25:11 Mapping speed, Million of reads per hour | 643.36 Number of input reads | 21266578 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 19708616 Uniquely mapped reads % | 92.67% Average mapped length | 291.98 Number of splices: Total | 20018153 Number of splices: Annotated (sjdb) | 19638722 Number of splices: GT/AG | 19623828 Number of splices: GC/AG | 329288 Number of splices: AT/AC | 11463 Number of splices: Non-canonical | 53574 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 469704 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 146642 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.30% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1088258 1088258 1088258 N_multimapping 469704 469704 469704 N_noFeature 666759 19422042 736131 N_ambiguous 375647 1323 157681 UnstrandedReadsAssigned:18666210 PositiveStrandReadsAssigned:285251 NegativeStrandReadsAssigned:18814804 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671676 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671676-trimmed-pair1.fastq SRR12671676-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,266,578 reads, 19,222,950 reads pseudoaligned [quant] estimated average fragment length: 307.115 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR12671676.ke.tsv 34699 SRR12671676.se.tsv 87100 total ==> SRR12671676.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1711.89 848 24.0278 Potri.005G024800.1.v4.1 1035 728.885 268 17.8348 Potri.004G059700.1.v4.1 961 655.289 0 0 Potri.007G009000.2.v4.1 1416 1109.89 0 0 Potri.003G141000.2.v4.1 2943 2636.89 1181.46 21.7331 Potri.016G087400.1.v4.1 270 68.1147 958 682.21 Potri.015G069301.1.v4.1 564 282.433 0 0 Potri.010G195200.1.v4.1 1773 1466.89 130 4.29873 Potri.012G127500.1.v4.1 977 671.144 262 18.9356 ==> SRR12671676.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 214 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 8 SRR12671676 completed mapping pipeline successfully