Starting /dee2/code/volunteer_pipeline.sh SRR12671677 current disk space = 3049950384128 free memory = 1494111292 SRR12671677 SRAfilesize 7b9c2c49ee057bc59ebff69a64469be9 SRR12671677.sra SRR12671677.sra file validated SRR12671677 is paired end SRR12671677 is conventional basespace SRR12671677 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671677_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.484 37.0 37.0 37.0 37.0 37.0 2 36.39125 37.0 37.0 37.0 37.0 37.0 3 36.4085 37.0 37.0 37.0 37.0 37.0 4 36.4815 37.0 37.0 37.0 37.0 37.0 5 36.603 37.0 37.0 37.0 37.0 37.0 6 36.5435 37.0 37.0 37.0 37.0 37.0 7 36.5075 37.0 37.0 37.0 37.0 37.0 8 36.5195 37.0 37.0 37.0 37.0 37.0 9 36.6115 37.0 37.0 37.0 37.0 37.0 10-14 36.5827 37.0 37.0 37.0 37.0 37.0 15-19 36.59009999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.549099999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.523 37.0 37.0 37.0 37.0 37.0 30-34 36.5453 37.0 37.0 37.0 37.0 37.0 35-39 36.5035 37.0 37.0 37.0 37.0 37.0 40-44 36.4575 37.0 37.0 37.0 37.0 37.0 45-49 36.4207 37.0 37.0 37.0 37.0 37.0 50-54 36.3834 37.0 37.0 37.0 37.0 37.0 55-59 36.4034 37.0 37.0 37.0 37.0 37.0 60-64 36.41929999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.4051 37.0 37.0 37.0 37.0 37.0 70-74 36.38250000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.307599999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.3206 37.0 37.0 37.0 37.0 37.0 85-89 36.2995 37.0 37.0 37.0 37.0 37.0 90-94 36.2602 37.0 37.0 37.0 37.0 37.0 95-99 36.205200000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.2247 37.0 37.0 37.0 37.0 37.0 105-109 36.130700000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.1348 37.0 37.0 37.0 37.0 37.0 115-119 36.174 37.0 37.0 37.0 37.0 37.0 120-124 36.0831 37.0 37.0 37.0 37.0 37.0 125-129 36.102999999999994 37.0 37.0 37.0 37.0 37.0 130-134 36.017199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.9739 37.0 37.0 37.0 37.0 37.0 140-144 35.8986 37.0 37.0 37.0 37.0 37.0 145-149 35.9303 37.0 37.0 37.0 37.0 37.0 150-151 35.4445 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 3.0 26 6.0 27 4.0 28 7.0 29 17.0 30 14.0 31 38.0 32 60.0 33 68.0 34 112.0 35 268.0 36 3011.0 37 390.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.65 15.15 7.725 39.475 2 18.115760461037333 19.268353796041094 40.09020295665246 22.525682786269105 3 16.950000000000003 24.325 30.5 28.225 4 22.225 32.925 23.25 21.6 5 20.825 36.075 24.725 18.375 6 17.275 36.825 24.75 21.15 7 14.575 20.3 44.7 20.424999999999997 8 16.725 22.25 29.349999999999998 31.674999999999997 9 17.325 21.575 33.725 27.375 10-14 20.28 29.325000000000003 26.525 23.87 15-19 20.064999999999998 27.96 27.765 24.21 20-24 19.85 28.42 27.675 24.055 25-29 20.080000000000002 28.59 27.834999999999997 23.494999999999997 30-34 19.805 27.884999999999998 28.04 24.27 35-39 20.505000000000003 27.775 27.439999999999998 24.279999999999998 40-44 20.155 28.315 27.58 23.95 45-49 19.835 27.675 28.115000000000002 24.375 50-54 20.72 27.63 27.944999999999997 23.705000000000002 55-59 20.86 27.67 27.794999999999998 23.674999999999997 60-64 20.435 27.875 27.560000000000002 24.13 65-69 20.200000000000003 27.875 27.755000000000003 24.169999999999998 70-74 20.485 27.755000000000003 27.584999999999997 24.175 75-79 20.31 27.689999999999998 28.4 23.599999999999998 80-84 21.075 27.655 27.33 23.94 85-89 20.375 28.165000000000003 27.015 24.445 90-94 20.09 28.660000000000004 27.565 23.685000000000002 95-99 20.86 27.76 27.49 23.89 100-104 20.94 28.51 27.01 23.54 105-109 21.395 27.985 27.21 23.41 110-114 20.485 27.46 28.065 23.990000000000002 115-119 21.305 27.74 27.575 23.380000000000003 120-124 20.86 28.27 26.919999999999998 23.95 125-129 20.8 27.975 26.99 24.235 130-134 21.224999999999998 27.87 27.52 23.385 135-139 21.415 27.37 27.66 23.555 140-144 21.09 27.589999999999996 27.205000000000002 24.115000000000002 145-149 21.59 27.66 27.125 23.625 150-151 21.075 28.449999999999996 26.5125 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.5 22 2.0 23 1.0 24 2.0 25 2.0 26 1.5 27 4.0 28 9.5 29 13.5 30 15.5 31 18.0 32 26.5 33 34.0 34 50.5 35 69.5 36 88.0 37 117.0 38 124.5 39 132.5 40 177.5 41 214.5 42 233.5 43 247.0 44 268.5 45 273.5 46 258.0 47 256.0 48 244.0 49 217.5 50 193.5 51 153.0 52 122.0 53 107.5 54 74.0 55 62.5 56 53.0 57 36.5 58 25.5 59 18.5 60 18.5 61 10.5 62 5.5 63 5.0 64 3.0 65 2.0 66 0.5 67 1.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.85 #Duplication Level Percentage of deduplicated Percentage of total 1 93.87320191795419 88.1 2 5.8071390516782095 10.9 3 0.26638252530633993 0.75 4 0.02663825253063399 0.1 5 0.0 0.0 6 0.02663825253063399 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.3875 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 1.9874999999999998 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.2625 0.0 0.0 0.0 0.0 124-125 2.4375 0.0 0.0 0.0 0.0 126-127 2.675 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.2 0.0 0.0 0.0 0.0 132-133 3.375 0.0 0.0 0.0 0.0 134-135 3.6625 0.0 0.0 0.0 0.0 136-137 4.0375 0.0 0.0 0.0 0.0 138-139 4.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACAAT 10 0.006830828 145.0 2 >>END_MODULE SRR12671677 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671677_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3415 37.0 37.0 37.0 37.0 37.0 2 36.1245 37.0 37.0 37.0 37.0 37.0 3 36.205 37.0 37.0 37.0 37.0 37.0 4 36.2405 37.0 37.0 37.0 37.0 37.0 5 36.3715 37.0 37.0 37.0 37.0 37.0 6 36.3945 37.0 37.0 37.0 37.0 37.0 7 36.3435 37.0 37.0 37.0 37.0 37.0 8 36.4335 37.0 37.0 37.0 37.0 37.0 9 36.3405 37.0 37.0 37.0 37.0 37.0 10-14 36.3888 37.0 37.0 37.0 37.0 37.0 15-19 36.357299999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.3552 37.0 37.0 37.0 37.0 37.0 25-29 36.270799999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.2779 37.0 37.0 37.0 37.0 37.0 35-39 36.2217 37.0 37.0 37.0 37.0 37.0 40-44 36.2122 37.0 37.0 37.0 37.0 37.0 45-49 36.226800000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.1834 37.0 37.0 37.0 37.0 37.0 55-59 36.12409999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.0938 37.0 37.0 37.0 37.0 37.0 65-69 36.1004 37.0 37.0 37.0 37.0 37.0 70-74 36.0945 37.0 37.0 37.0 37.0 37.0 75-79 35.9779 37.0 37.0 37.0 37.0 37.0 80-84 36.0616 37.0 37.0 37.0 37.0 37.0 85-89 36.01690000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.9585 37.0 37.0 37.0 37.0 37.0 95-99 36.037800000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.9692 37.0 37.0 37.0 37.0 37.0 105-109 35.8977 37.0 37.0 37.0 37.0 37.0 110-114 35.7803 37.0 37.0 37.0 37.0 37.0 115-119 35.8148 37.0 37.0 37.0 37.0 37.0 120-124 35.8215 37.0 37.0 37.0 37.0 37.0 125-129 35.7544 37.0 37.0 37.0 37.0 37.0 130-134 35.777300000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.685100000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.4865 37.0 37.0 37.0 37.0 37.0 145-149 35.5228 37.0 37.0 37.0 34.6 37.0 150-151 35.072 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 3.0 21 1.0 22 3.0 23 5.0 24 0.0 25 3.0 26 8.0 27 7.0 28 19.0 29 15.0 30 26.0 31 43.0 32 60.0 33 84.0 34 143.0 35 481.0 36 2787.0 37 304.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.75 19.6 11.425 29.225 2 24.125 23.95 35.675000000000004 16.25 3 19.35 27.650000000000002 33.225 19.775000000000002 4 22.775000000000002 35.449999999999996 22.3 19.475 5 22.85 38.525 21.825 16.8 6 19.3 37.275000000000006 23.775 19.650000000000002 7 19.0 18.3 42.199999999999996 20.5 8 20.025000000000002 23.599999999999998 28.050000000000004 28.325 9 20.724999999999998 24.9 29.275000000000002 25.1 10-14 22.994999999999997 28.645 26.35 22.009999999999998 15-19 22.71 27.065 27.92 22.305 20-24 22.49 28.215 27.925 21.37 25-29 23.035 28.105000000000004 27.67 21.19 30-34 22.08 27.97 28.12 21.83 35-39 22.884999999999998 27.075 27.935 22.105 40-44 22.755 27.775 27.57 21.9 45-49 22.02 28.27 28.125 21.584999999999997 50-54 22.400000000000002 27.700000000000003 28.095 21.805 55-59 23.3 27.215 27.435 22.05 60-64 22.975 27.544999999999998 27.72 21.759999999999998 65-69 23.47 28.13 27.215 21.185000000000002 70-74 23.61 28.349999999999998 26.46 21.58 75-79 22.665 28.12 27.485 21.73 80-84 23.125 27.97 27.11 21.795 85-89 23.885 28.28 26.57 21.265 90-94 23.05 27.42 27.935 21.595 95-99 23.29 27.865000000000002 27.47 21.375 100-104 23.275000000000002 27.46 27.73 21.535 105-109 23.5 27.735 27.295 21.47 110-114 24.05 27.860000000000003 27.115000000000002 20.974999999999998 115-119 24.325 27.96 26.88 20.835 120-124 23.68 27.755000000000003 27.415 21.15 125-129 24.62 27.589999999999996 27.21 20.580000000000002 130-134 24.060000000000002 27.35 27.58 21.01 135-139 24.255 28.249999999999996 26.625 20.87 140-144 24.195 28.205000000000002 26.625 20.974999999999998 145-149 24.94 27.900000000000002 26.740000000000002 20.419999999999998 150-151 25.275 27.85 26.6 20.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 2.0 20 1.5 21 0.5 22 0.5 23 2.0 24 4.5 25 4.0 26 3.5 27 3.0 28 5.5 29 11.0 30 15.0 31 14.5 32 23.0 33 37.0 34 45.0 35 60.0 36 82.0 37 110.0 38 131.0 39 148.5 40 173.5 41 211.0 42 234.5 43 252.5 44 282.5 45 265.5 46 262.5 47 263.0 48 237.0 49 219.0 50 172.0 51 138.5 52 124.5 53 98.0 54 80.0 55 63.5 56 47.5 57 46.0 58 35.5 59 26.0 60 18.0 61 10.5 62 11.0 63 5.5 64 2.0 65 1.0 66 0.0 67 0.5 68 0.5 69 0.5 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.94505201387037 88.05 2 5.548146172312617 10.4 3 0.40010669511869834 1.125 4 0.08002133902373967 0.3 5 0.026673779674579887 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.3875 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.2625 0.0 0.0 0.0 0.0 124-125 2.4125 0.0 0.0 0.0 0.0 126-127 2.6500000000000004 0.0 0.0 0.0 0.0 128-129 2.9000000000000004 0.0 0.0 0.0 0.0 130-131 3.15 0.0 0.0 0.0 0.0 132-133 3.325 0.0 0.0 0.0 0.0 134-135 3.6375 0.0 0.0 0.0 0.0 136-137 3.9875000000000003 0.0 0.0 0.0 0.0 138-139 4.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGGGAG 10 0.006830828 145.0 145 >>END_MODULE Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra Read 881539 spots for SRR12671677.sra Written 881539 spots for SRR12671677.sra Read 881523 spots for SRR12671677.sra Written 881523 spots for SRR12671677.sra SRR ids: ['SRR12671677.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2tx6bldl SRR12671677.sra spots: 17630476 blocks: [[1, 881523], [881524, 1763046], [1763047, 2644569], [2644570, 3526092], [3526093, 4407615], [4407616, 5289138], [5289139, 6170661], [6170662, 7052184], [7052185, 7933707], [7933708, 8815230], [8815231, 9696753], [9696754, 10578276], [10578277, 11459799], [11459800, 12341322], [12341323, 13222845], [13222846, 14104368], [14104369, 14985891], [14985892, 15867414], [15867415, 16748937], [16748938, 17630476]] SRR12671677 file size 5969906 SRR12671677 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671677 SRR12671677_1.fastq SRR12671677_2.fastq Input file: SRR12671677_1.fastq Paired file: SRR12671677_2.fastq trimmed: SRR12671677-trimmed-pair1.fastq, SRR12671677-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:14:27 2025 >> started Wed Feb 12 02:14:47 2025 >> done (20.620s) 17630476 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 1631 ( 0.01%) empty read pairs filtered out after trimming by size control 17628823 (99.99%) read pairs available; of these: 1307439 ( 7.42%) trimmed read pairs available after processing 16321384 (92.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 1 0.00% 21 1 0.00% 22 5 0.00% 23 1 0.00% 24 4 0.00% 25 3 0.00% 26 4 0.00% 27 0 0.00% 28 3 0.00% 29 4 0.00% 30 4 0.00% 31 5 0.00% 32 4 0.00% 33 16 0.00% 34 11 0.00% 35 10 0.00% 36 11 0.00% 37 14 0.00% 38 11 0.00% 39 14 0.00% 40 18 0.00% 41 14 0.00% 42 18 0.00% 43 28 0.00% 44 18 0.00% 45 22 0.00% 46 28 0.00% 47 28 0.00% 48 30 0.00% 49 38 0.00% 50 36 0.00% 51 60 0.00% 52 53 0.00% 53 69 0.00% 54 68 0.00% 55 73 0.00% 56 70 0.00% 57 77 0.00% 58 103 0.00% 59 119 0.00% 60 139 0.00% 61 160 0.00% 62 167 0.00% 63 174 0.00% 64 203 0.00% 65 206 0.00% 66 249 0.00% 67 256 0.00% 68 294 0.00% 69 336 0.00% 70 360 0.00% 71 456 0.00% 72 492 0.00% 73 589 0.00% 74 690 0.00% 75 723 0.00% 76 825 0.00% 77 814 0.00% 78 938 0.01% 79 1045 0.01% 80 1235 0.01% 81 1412 0.01% 82 1566 0.01% 83 1787 0.01% 84 2009 0.01% 85 2177 0.01% 86 2267 0.01% 87 2511 0.01% 88 2809 0.02% 89 3049 0.02% 90 3273 0.02% 91 3625 0.02% 92 3835 0.02% 93 4571 0.03% 94 5025 0.03% 95 5465 0.03% 96 5796 0.03% 97 6012 0.03% 98 6328 0.04% 99 6674 0.04% 100 7362 0.04% 101 7698 0.04% 102 8352 0.05% 103 8955 0.05% 104 9601 0.05% 105 10412 0.06% 106 10888 0.06% 107 11223 0.06% 108 11335 0.06% 109 12033 0.07% 110 12271 0.07% 111 13516 0.08% 112 13910 0.08% 113 14582 0.08% 114 15715 0.09% 115 16541 0.09% 116 16938 0.10% 117 17443 0.10% 118 17962 0.10% 119 18438 0.10% 120 19304 0.11% 121 20084 0.11% 122 20495 0.12% 123 22062 0.13% 124 23002 0.13% 125 23546 0.13% 126 24315 0.14% 127 25050 0.14% 128 25770 0.15% 129 26173 0.15% 130 26693 0.15% 131 27266 0.15% 132 28076 0.16% 133 30071 0.17% 134 30869 0.18% 135 31739 0.18% 136 32664 0.19% 137 32997 0.19% 138 33791 0.19% 139 34702 0.20% 140 34233 0.19% 141 34789 0.20% 142 36060 0.20% 143 37404 0.21% 144 39488 0.22% 145 39998 0.23% 146 41383 0.23% 147 41440 0.24% 148 42669 0.24% 149 42103 0.24% 150 42386 0.24% 151 16321384 92.58% 17628823 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=17 prefix-density=0.65 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=10.33 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=1.7 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=15 prefix-density=0.90 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=11.14 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=3.1 sequence=AACAGAAAAAAGAAAGATGGCCTCGGCATCATTTCTCAAGTCATCACCAGTTCTAGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTGTCCGGTGCCGCTCCACCGCCCCTTCTGCTCTTACCGTTCGTGCTGGTTCCTATGCTGAGGAGCTTGTCAAAACCGCGAAAACTATTGCATCTCCTGGCCGAGGTATTTTGGCCATGGATGAGTCTAACGCTACCTGTGGAAAACGTCTCGCCTCAATCGGGCTAGAGAACACCGAGGCTAACCGCCAGGCATACCGTACCCTTCTTGTGACAGTCCCTGGCCTTGGTGATTACGTCTCTGGTGCCATCCTTTTTGAGGAGACTCTCTACCAATCCAC SRR12671677 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:15:36 Started mapping on | Feb 12 02:15:37 Finished on | Feb 12 02:18:39 Mapping speed, Million of reads per hour | 348.70 Number of input reads | 17628823 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16496068 Uniquely mapped reads % | 93.57% Average mapped length | 297.51 Number of splices: Total | 16946852 Number of splices: Annotated (sjdb) | 16618945 Number of splices: GT/AG | 16608703 Number of splices: GC/AG | 283016 Number of splices: AT/AC | 9657 Number of splices: Non-canonical | 45476 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383408 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 112597 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.48% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 749347 749347 749347 N_multimapping 383408 383408 383408 N_noFeature 598521 16232919 680954 N_ambiguous 283674 1100 102256 UnstrandedReadsAssigned:15613873 PositiveStrandReadsAssigned:262049 NegativeStrandReadsAssigned:15712858 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671677 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671677-trimmed-pair1.fastq SRR12671677-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,628,823 reads, 15,743,049 reads pseudoaligned [quant] estimated average fragment length: 280.758 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR12671677.ke.tsv 34699 SRR12671677.se.tsv 87100 total ==> SRR12671677.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.24 624 20.8468 Potri.005G024800.1.v4.1 1035 755.242 193 14.8401 Potri.004G059700.1.v4.1 961 681.653 3 0.255578 Potri.007G009000.2.v4.1 1416 1136.24 0 0 Potri.003G141000.2.v4.1 2943 2663.24 1312.31 28.6149 Potri.016G087400.1.v4.1 270 78.9273 825 607.004 Potri.015G069301.1.v4.1 564 304.987 0 0 Potri.010G195200.1.v4.1 1773 1493.24 71 2.76117 Potri.012G127500.1.v4.1 977 697.461 101 8.40943 ==> SRR12671677.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 152 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR12671677 completed mapping pipeline successfully