Starting /dee2/code/volunteer_pipeline.sh SRR12671678 current disk space = 3049052577792 free memory = 1561656112 SRR12671678 SRAfilesize 2c4941e05cdb871cd6541040275a0e72 SRR12671678.sra SRR12671678.sra file validated SRR12671678 is paired end SRR12671678 is conventional basespace SRR12671678 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671678_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.45 37.0 37.0 37.0 37.0 37.0 2 36.243 37.0 37.0 37.0 37.0 37.0 3 36.5235 37.0 37.0 37.0 37.0 37.0 4 36.536 37.0 37.0 37.0 37.0 37.0 5 36.6085 37.0 37.0 37.0 37.0 37.0 6 36.5665 37.0 37.0 37.0 37.0 37.0 7 36.589 37.0 37.0 37.0 37.0 37.0 8 36.5625 37.0 37.0 37.0 37.0 37.0 9 36.648 37.0 37.0 37.0 37.0 37.0 10-14 36.5988 37.0 37.0 37.0 37.0 37.0 15-19 36.5236 37.0 37.0 37.0 37.0 37.0 20-24 36.5142 37.0 37.0 37.0 37.0 37.0 25-29 36.51859999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.499 37.0 37.0 37.0 37.0 37.0 35-39 36.5138 37.0 37.0 37.0 37.0 37.0 40-44 36.5028 37.0 37.0 37.0 37.0 37.0 45-49 36.433800000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.4673 37.0 37.0 37.0 37.0 37.0 55-59 36.3959 37.0 37.0 37.0 37.0 37.0 60-64 36.414 37.0 37.0 37.0 37.0 37.0 65-69 36.407 37.0 37.0 37.0 37.0 37.0 70-74 36.357299999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.3369 37.0 37.0 37.0 37.0 37.0 80-84 36.337999999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.3233 37.0 37.0 37.0 37.0 37.0 90-94 36.288599999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.2387 37.0 37.0 37.0 37.0 37.0 100-104 36.3209 37.0 37.0 37.0 37.0 37.0 105-109 36.1687 37.0 37.0 37.0 37.0 37.0 110-114 36.2216 37.0 37.0 37.0 37.0 37.0 115-119 36.2195 37.0 37.0 37.0 37.0 37.0 120-124 36.0874 37.0 37.0 37.0 37.0 37.0 125-129 36.111599999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.027499999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.035799999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.9985 37.0 37.0 37.0 37.0 37.0 145-149 35.935300000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.521 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 1.0 26 2.0 27 5.0 28 12.0 29 15.0 30 21.0 31 38.0 32 49.0 33 63.0 34 122.0 35 282.0 36 2946.0 37 442.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.425 13.275 12.049999999999999 46.25 2 19.107321965897693 18.154463390170513 38.515546639919755 24.222668004012036 3 17.8 23.9 27.925 30.375000000000004 4 21.25 32.35 22.05 24.349999999999998 5 23.474999999999998 35.675000000000004 23.849999999999998 17.0 6 18.825 33.6 25.75 21.825 7 14.325 23.225 44.775 17.675 8 18.85 23.474999999999998 31.55 26.125 9 16.900000000000002 22.675 34.050000000000004 26.375 10-14 18.975 30.769999999999996 27.33 22.925 15-19 19.3 28.555000000000003 28.12 24.025 20-24 19.685 28.444999999999997 28.105000000000004 23.765 25-29 19.2 29.59 27.6 23.61 30-34 19.24 28.895 28.03 23.835 35-39 20.369999999999997 27.48 27.860000000000003 24.29 40-44 20.125 28.835 27.595 23.445 45-49 19.575 28.575 27.095000000000002 24.755 50-54 19.5 28.365000000000002 28.249999999999996 23.885 55-59 19.825 29.13 27.115000000000002 23.93 60-64 19.88 28.804999999999996 27.07 24.245 65-69 20.07 28.76 27.54 23.630000000000003 70-74 19.6 29.235 27.51 23.655 75-79 19.725 28.585 28.110000000000003 23.580000000000002 80-84 19.75 27.58 28.144999999999996 24.525 85-89 20.985 28.475 27.245 23.294999999999998 90-94 19.74 28.410000000000004 27.694999999999997 24.154999999999998 95-99 19.615 28.000000000000004 27.955000000000002 24.43 100-104 20.325 28.165000000000003 27.46 24.05 105-109 20.175 28.07 28.075 23.68 110-114 20.18 28.005000000000003 27.544999999999998 24.27 115-119 19.865 28.675 27.500000000000004 23.96 120-124 20.315 28.58 27.839999999999996 23.265 125-129 19.994999999999997 28.51 27.875 23.62 130-134 20.135 28.235 27.655 23.974999999999998 135-139 20.365 27.939999999999998 27.855 23.84 140-144 21.065 27.834999999999997 27.095000000000002 24.005000000000003 145-149 20.195 28.505000000000003 27.189999999999998 24.11 150-151 19.6 27.950000000000003 28.299999999999997 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 3.5 23 4.0 24 2.5 25 2.5 26 4.5 27 6.5 28 8.0 29 14.5 30 19.5 31 26.5 32 37.0 33 51.5 34 63.0 35 74.0 36 90.5 37 111.5 38 144.5 39 172.0 40 193.0 41 226.5 42 252.0 43 259.5 44 270.5 45 276.5 46 255.0 47 237.0 48 210.0 49 184.0 50 174.5 51 143.5 52 101.5 53 75.5 54 73.5 55 62.0 56 45.0 57 35.5 58 27.5 59 19.5 60 12.5 61 8.5 62 5.5 63 3.5 64 2.0 65 2.0 66 2.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.3441317047265 88.825 2 5.25756771109931 9.9 3 0.3186404673393521 0.8999999999999999 4 0.05310674455655868 0.2 5 0.0 0.0 6 0.0 0.0 7 0.02655337227827934 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.7875 0.0 0.0 0.0 0.0 122-123 0.9 0.0 0.0 0.0 0.0 124-125 1.075 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.325 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.6749999999999998 0.0 0.0 0.0 0.0 134-135 1.775 0.0 0.0 0.0 0.0 136-137 1.8875 0.0 0.0 0.0 0.0 138-139 2.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671678 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671678_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2005 37.0 37.0 37.0 37.0 37.0 2 36.104 37.0 37.0 37.0 37.0 37.0 3 36.1145 37.0 37.0 37.0 37.0 37.0 4 36.217 37.0 37.0 37.0 37.0 37.0 5 36.18 37.0 37.0 37.0 37.0 37.0 6 36.169 37.0 37.0 37.0 37.0 37.0 7 36.2585 37.0 37.0 37.0 37.0 37.0 8 36.2565 37.0 37.0 37.0 37.0 37.0 9 36.2485 37.0 37.0 37.0 37.0 37.0 10-14 36.2599 37.0 37.0 37.0 37.0 37.0 15-19 36.2536 37.0 37.0 37.0 37.0 37.0 20-24 36.1917 37.0 37.0 37.0 37.0 37.0 25-29 36.2136 37.0 37.0 37.0 37.0 37.0 30-34 36.2033 37.0 37.0 37.0 37.0 37.0 35-39 36.1392 37.0 37.0 37.0 37.0 37.0 40-44 36.1347 37.0 37.0 37.0 37.0 37.0 45-49 36.106 37.0 37.0 37.0 37.0 37.0 50-54 36.105599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.1114 37.0 37.0 37.0 37.0 37.0 60-64 36.0631 37.0 37.0 37.0 37.0 37.0 65-69 35.957499999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.0125 37.0 37.0 37.0 37.0 37.0 75-79 35.937599999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.9809 37.0 37.0 37.0 37.0 37.0 85-89 35.9009 37.0 37.0 37.0 37.0 37.0 90-94 35.861200000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.872 37.0 37.0 37.0 37.0 37.0 100-104 35.7936 37.0 37.0 37.0 37.0 37.0 105-109 35.715900000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.7411 37.0 37.0 37.0 37.0 37.0 115-119 35.6977 37.0 37.0 37.0 37.0 37.0 120-124 35.650400000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.660000000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.700100000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.60889999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.3768 37.0 37.0 37.0 34.6 37.0 145-149 35.5764 37.0 37.0 37.0 37.0 37.0 150-151 35.10625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 1.0 22 5.0 23 2.0 24 6.0 25 9.0 26 12.0 27 7.0 28 18.0 29 18.0 30 24.0 31 30.0 32 50.0 33 97.0 34 213.0 35 538.0 36 2770.0 37 192.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.25 18.9 17.349999999999998 32.5 2 26.0 22.7 35.625 15.675 3 20.075000000000003 26.85 32.05 21.025 4 24.3 33.75 22.400000000000002 19.55 5 24.425 36.025 21.95 17.599999999999998 6 19.675 39.825 22.675 17.825 7 18.0 18.0 41.975 22.025 8 21.075 24.3 26.424999999999997 28.199999999999996 9 21.425 24.775 30.175 23.625 10-14 22.655 29.125 27.04 21.18 15-19 22.645 27.76 28.310000000000002 21.285 20-24 22.645 28.275 27.339999999999996 21.740000000000002 25-29 23.215 28.685 27.595 20.505000000000003 30-34 22.770000000000003 28.715000000000003 27.765 20.75 35-39 22.495 29.015 28.04 20.45 40-44 22.735 28.415000000000003 27.875 20.974999999999998 45-49 23.155 28.515 27.91 20.419999999999998 50-54 22.905 27.900000000000002 28.305000000000003 20.89 55-59 23.335 27.685 28.060000000000002 20.919999999999998 60-64 22.900000000000002 27.334999999999997 27.985 21.78 65-69 23.91 27.655 27.49 20.945 70-74 23.365 28.425 27.034999999999997 21.175 75-79 22.52 27.42 28.03 22.03 80-84 23.400000000000002 28.29 27.195000000000004 21.115000000000002 85-89 23.25 27.389999999999997 28.060000000000002 21.3 90-94 23.330000000000002 27.894999999999996 28.244999999999997 20.53 95-99 24.14 27.6 27.865000000000002 20.395 100-104 24.38 27.755000000000003 27.355 20.51 105-109 23.785 27.965 28.105000000000004 20.145 110-114 23.735 28.005000000000003 27.605 20.655 115-119 23.505000000000003 28.42 27.57 20.505000000000003 120-124 24.404999999999998 28.335 27.224999999999998 20.035 125-129 24.11 27.750000000000004 27.41 20.73 130-134 24.535 27.985 27.575 19.905 135-139 24.205 27.515 27.689999999999998 20.59 140-144 24.83 26.555 28.37 20.244999999999997 145-149 24.46 28.09 27.150000000000002 20.3 150-151 25.0625 27.487499999999997 27.8625 19.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 1.0 12 1.5 13 1.5 14 0.5 15 0.0 16 0.0 17 0.5 18 2.5 19 2.5 20 0.5 21 0.5 22 2.0 23 1.5 24 0.0 25 1.0 26 3.5 27 4.5 28 7.5 29 10.5 30 12.5 31 19.5 32 27.0 33 33.0 34 44.5 35 62.5 36 83.0 37 110.5 38 140.0 39 159.5 40 186.5 41 228.0 42 257.5 43 271.0 44 292.5 45 291.0 46 268.0 47 246.0 48 226.0 49 194.5 50 156.0 51 130.0 52 110.0 53 89.5 54 72.5 55 62.5 56 44.5 57 34.0 58 25.0 59 22.0 60 21.0 61 11.5 62 8.5 63 7.5 64 3.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.8 #Duplication Level Percentage of deduplicated Percentage of total 1 94.37633262260128 88.52499999999999 2 5.143923240938166 9.65 3 0.26652452025586354 0.75 4 0.10660980810234541 0.4 5 0.053304904051172705 0.25 6 0.0 0.0 7 0.026652452025586353 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026652452025586353 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 10 0.25 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.7875 0.0 0.0 0.0 0.0 122-123 0.9 0.0 0.0 0.0 0.0 124-125 1.075 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.325 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.6749999999999998 0.0 0.0 0.0 0.0 134-135 1.775 0.0 0.0 0.0 0.0 136-137 1.8875 0.0 0.0 0.0 0.0 138-139 2.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATTC 10 0.006830828 145.0 5 GAACACA 10 0.006830828 145.0 2 ATCACAG 10 0.006830828 145.0 3 ATTCATA 10 0.006830828 145.0 8 >>END_MODULE Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757320 spots for SRR12671678.sra Written 757320 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra Read 757307 spots for SRR12671678.sra Written 757307 spots for SRR12671678.sra SRR ids: ['SRR12671678.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ur2z3gs2 SRR12671678.sra spots: 15146153 blocks: [[1, 757307], [757308, 1514614], [1514615, 2271921], [2271922, 3029228], [3029229, 3786535], [3786536, 4543842], [4543843, 5301149], [5301150, 6058456], [6058457, 6815763], [6815764, 7573070], [7573071, 8330377], [8330378, 9087684], [9087685, 9844991], [9844992, 10602298], [10602299, 11359605], [11359606, 12116912], [12116913, 12874219], [12874220, 13631526], [13631527, 14388833], [14388834, 15146153]] SRR12671678 file size 5125625 SRR12671678 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671678 SRR12671678_1.fastq SRR12671678_2.fastq Input file: SRR12671678_1.fastq Paired file: SRR12671678_2.fastq trimmed: SRR12671678-trimmed-pair1.fastq, SRR12671678-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:43:17 2025 >> started Wed Feb 12 02:43:33 2025 >> done (15.555s) 15146153 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 412 ( 0.00%) empty read pairs filtered out after trimming by size control 15145738 (100.00%) read pairs available; of these: 581666 ( 3.84%) trimmed read pairs available after processing 14564072 (96.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 3 0.00% 21 0 0.00% 22 1 0.00% 23 4 0.00% 24 1 0.00% 25 3 0.00% 26 1 0.00% 27 0 0.00% 28 3 0.00% 29 3 0.00% 30 5 0.00% 31 1 0.00% 32 4 0.00% 33 2 0.00% 34 2 0.00% 35 2 0.00% 36 7 0.00% 37 7 0.00% 38 7 0.00% 39 2 0.00% 40 4 0.00% 41 4 0.00% 42 10 0.00% 43 11 0.00% 44 12 0.00% 45 8 0.00% 46 17 0.00% 47 10 0.00% 48 18 0.00% 49 20 0.00% 50 15 0.00% 51 22 0.00% 52 25 0.00% 53 26 0.00% 54 26 0.00% 55 16 0.00% 56 33 0.00% 57 20 0.00% 58 32 0.00% 59 40 0.00% 60 44 0.00% 61 49 0.00% 62 54 0.00% 63 71 0.00% 64 62 0.00% 65 75 0.00% 66 96 0.00% 67 72 0.00% 68 96 0.00% 69 109 0.00% 70 116 0.00% 71 176 0.00% 72 163 0.00% 73 201 0.00% 74 205 0.00% 75 253 0.00% 76 244 0.00% 77 280 0.00% 78 298 0.00% 79 337 0.00% 80 399 0.00% 81 441 0.00% 82 534 0.00% 83 572 0.00% 84 631 0.00% 85 723 0.00% 86 778 0.01% 87 833 0.01% 88 939 0.01% 89 1112 0.01% 90 1144 0.01% 91 1271 0.01% 92 1383 0.01% 93 1529 0.01% 94 1644 0.01% 95 1861 0.01% 96 1953 0.01% 97 2114 0.01% 98 2274 0.02% 99 2458 0.02% 100 2685 0.02% 101 2781 0.02% 102 2943 0.02% 103 3283 0.02% 104 3437 0.02% 105 3624 0.02% 106 3933 0.03% 107 4064 0.03% 108 4302 0.03% 109 4676 0.03% 110 4950 0.03% 111 4870 0.03% 112 5375 0.04% 113 5785 0.04% 114 5984 0.04% 115 6339 0.04% 116 6555 0.04% 117 6864 0.05% 118 7319 0.05% 119 7626 0.05% 120 7983 0.05% 121 8337 0.06% 122 8499 0.06% 123 8884 0.06% 124 9656 0.06% 125 9854 0.07% 126 10310 0.07% 127 10477 0.07% 128 10906 0.07% 129 11275 0.07% 130 11704 0.08% 131 12251 0.08% 132 12598 0.08% 133 13342 0.09% 134 13899 0.09% 135 14594 0.10% 136 14932 0.10% 137 15616 0.10% 138 15845 0.10% 139 16539 0.11% 140 16657 0.11% 141 16893 0.11% 142 17787 0.12% 143 18555 0.12% 144 19986 0.13% 145 20147 0.13% 146 20817 0.14% 147 21320 0.14% 148 21895 0.14% 149 22012 0.15% 150 22679 0.15% 151 14564072 96.16% 15145738 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.41 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=408.48 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=16.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=22 prefix-density=1.39 prefix-fanout=1.0 sequence=ATCGTCGAGACCGAGAAGAACTA criterion=fanout-score sequence-density=0.14 sequence-density-rank=26 fanout-score=11.33 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=5.8 sequence=GATCTTGATGCCGGAGCTGG SRR12671678 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:44:20 Started mapping on | Feb 12 02:44:20 Finished on | Feb 12 02:46:14 Mapping speed, Million of reads per hour | 478.29 Number of input reads | 15145738 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 14157707 Uniquely mapped reads % | 93.48% Average mapped length | 299.23 Number of splices: Total | 14605409 Number of splices: Annotated (sjdb) | 14291169 Number of splices: GT/AG | 14322739 Number of splices: GC/AG | 226951 Number of splices: AT/AC | 9690 Number of splices: Non-canonical | 46029 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 375524 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 26210 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.79% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 612507 612507 612507 N_multimapping 375524 375524 375524 N_noFeature 447645 13834832 515698 N_ambiguous 357350 883 102046 UnstrandedReadsAssigned:13352712 PositiveStrandReadsAssigned:321992 NegativeStrandReadsAssigned:13539963 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671678 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671678-trimmed-pair1.fastq SRR12671678-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,145,738 reads, 13,383,099 reads pseudoaligned [quant] estimated average fragment length: 307.585 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR12671678.ke.tsv 34699 SRR12671678.se.tsv 87100 total ==> SRR12671678.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1711.42 1043 37.4595 Potri.005G024800.1.v4.1 1035 728.415 231 19.4924 Potri.004G059700.1.v4.1 961 654.857 2 0.187723 Potri.007G009000.2.v4.1 1416 1109.42 0 0 Potri.003G141000.2.v4.1 2943 2636.42 817 19.0476 Potri.016G087400.1.v4.1 270 68.5474 709 635.753 Potri.015G069301.1.v4.1 564 282.346 0 0 Potri.010G195200.1.v4.1 1773 1466.42 266 11.1496 Potri.012G127500.1.v4.1 977 670.642 157 14.3894 ==> SRR12671678.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 80 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 260 Potri.001G212900.v4.1 82 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12671678 completed mapping pipeline successfully