Starting /dee2/code/volunteer_pipeline.sh SRR12671679 current disk space = 3048918810624 free memory = 1579471360 SRR12671679 SRAfilesize 3d6fa94be3d1fc5b70f0d24d8e7b2eb1 SRR12671679.sra SRR12671679.sra file validated SRR12671679 is paired end SRR12671679 is conventional basespace SRR12671679 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671679_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4055 37.0 37.0 37.0 37.0 37.0 2 36.3125 37.0 37.0 37.0 37.0 37.0 3 36.4715 37.0 37.0 37.0 37.0 37.0 4 36.5635 37.0 37.0 37.0 37.0 37.0 5 36.5105 37.0 37.0 37.0 37.0 37.0 6 36.5675 37.0 37.0 37.0 37.0 37.0 7 36.4495 37.0 37.0 37.0 37.0 37.0 8 36.5405 37.0 37.0 37.0 37.0 37.0 9 36.5515 37.0 37.0 37.0 37.0 37.0 10-14 36.5575 37.0 37.0 37.0 37.0 37.0 15-19 36.5372 37.0 37.0 37.0 37.0 37.0 20-24 36.5 37.0 37.0 37.0 37.0 37.0 25-29 36.4743 37.0 37.0 37.0 37.0 37.0 30-34 36.5196 37.0 37.0 37.0 37.0 37.0 35-39 36.4683 37.0 37.0 37.0 37.0 37.0 40-44 36.48120000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.41 37.0 37.0 37.0 37.0 37.0 50-54 36.3809 37.0 37.0 37.0 37.0 37.0 55-59 36.3554 37.0 37.0 37.0 37.0 37.0 60-64 36.4083 37.0 37.0 37.0 37.0 37.0 65-69 36.339600000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.3078 37.0 37.0 37.0 37.0 37.0 75-79 36.3206 37.0 37.0 37.0 37.0 37.0 80-84 36.303399999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.2774 37.0 37.0 37.0 37.0 37.0 90-94 36.2331 37.0 37.0 37.0 37.0 37.0 95-99 36.17550000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.223699999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.1791 37.0 37.0 37.0 37.0 37.0 110-114 36.1699 37.0 37.0 37.0 37.0 37.0 115-119 36.1416 37.0 37.0 37.0 37.0 37.0 120-124 36.0722 37.0 37.0 37.0 37.0 37.0 125-129 36.005700000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.0024 37.0 37.0 37.0 37.0 37.0 135-139 35.952200000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.924899999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.8113 37.0 37.0 37.0 37.0 37.0 150-151 35.284 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 3.0 27 8.0 28 5.0 29 23.0 30 24.0 31 33.0 32 46.0 33 73.0 34 120.0 35 343.0 36 2953.0 37 367.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.425 14.174999999999999 11.85 46.550000000000004 2 20.486459378134402 19.55867602808425 38.44032096288866 21.51454363089268 3 18.65 25.650000000000002 26.224999999999998 29.475 4 20.925 33.975 21.9 23.200000000000003 5 22.45 35.9 23.225 18.425 6 18.625 35.3 25.6 20.474999999999998 7 13.675 21.349999999999998 44.75 20.225 8 18.2 22.55 30.4 28.849999999999998 9 17.8 21.625 33.925 26.650000000000002 10-14 19.935 28.765 27.395000000000003 23.905 15-19 19.885 28.189999999999998 28.01 23.915 20-24 20.105 27.82 28.09 23.985 25-29 19.59 28.625 28.055000000000003 23.73 30-34 20.07 28.660000000000004 27.605 23.665 35-39 19.285 28.51 27.6 24.605 40-44 19.72 29.075 27.205000000000002 24.0 45-49 19.869999999999997 28.299999999999997 27.615000000000002 24.215 50-54 19.985 28.665000000000003 27.55 23.799999999999997 55-59 19.98 28.249999999999996 28.015 23.755000000000003 60-64 20.075000000000003 28.405 27.800000000000004 23.72 65-69 20.29 28.18 27.884999999999998 23.645 70-74 20.465 28.185 27.51 23.84 75-79 20.03 28.67 27.455000000000002 23.845 80-84 20.105 28.12 27.865000000000002 23.91 85-89 20.330000000000002 28.525 27.450000000000003 23.695 90-94 20.71 28.125 27.584999999999997 23.580000000000002 95-99 20.69 28.4 27.525 23.385 100-104 20.71 28.634999999999998 27.435 23.22 105-109 20.495 28.76 27.865000000000002 22.88 110-114 20.794999999999998 27.79 27.639999999999997 23.775 115-119 20.674999999999997 28.615000000000002 27.189999999999998 23.52 120-124 20.765 27.794999999999998 27.165 24.275 125-129 21.08 27.92 26.884999999999998 24.115000000000002 130-134 21.25 28.535 27.060000000000002 23.155 135-139 21.02 28.349999999999998 27.62 23.01 140-144 20.755000000000003 28.139999999999997 27.644999999999996 23.46 145-149 21.41 27.925 26.93 23.735 150-151 20.200000000000003 28.237499999999997 27.1125 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.0 23 2.0 24 2.5 25 3.0 26 3.0 27 7.5 28 9.0 29 8.0 30 15.5 31 22.5 32 34.0 33 46.0 34 50.5 35 67.0 36 81.5 37 102.0 38 146.0 39 177.0 40 185.0 41 209.5 42 250.5 43 273.0 44 283.5 45 268.0 46 269.0 47 260.5 48 229.0 49 205.0 50 157.0 51 125.0 52 113.5 53 91.5 54 70.0 55 51.0 56 47.5 57 46.0 58 27.5 59 20.5 60 17.0 61 9.5 62 3.0 63 2.0 64 1.5 65 0.5 66 0.5 67 0.0 68 0.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.625 #Duplication Level Percentage of deduplicated Percentage of total 1 94.63672391017172 89.55 2 5.072655217965654 9.6 3 0.26420079260237783 0.75 4 0.02642007926023778 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.1124999999999998 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.7625000000000002 0.0 0.0 0.0 0.0 120-121 1.9249999999999998 0.0 0.0 0.0 0.0 122-123 2.025 0.0 0.0 0.0 0.0 124-125 2.2375 0.0 0.0 0.0 0.0 126-127 2.4125 0.0 0.0 0.0 0.0 128-129 2.675 0.0 0.0 0.0 0.0 130-131 3.0625 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.7874999999999996 0.0 0.0 0.0 0.0 136-137 4.1 0.0 0.0 0.0 0.0 138-139 4.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTTCC 10 0.006830828 145.0 3 >>END_MODULE SRR12671679 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671679_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0025 37.0 37.0 37.0 37.0 37.0 2 35.8435 37.0 37.0 37.0 37.0 37.0 3 35.9575 37.0 37.0 37.0 37.0 37.0 4 35.995 37.0 37.0 37.0 37.0 37.0 5 36.118 37.0 37.0 37.0 37.0 37.0 6 36.179 37.0 37.0 37.0 37.0 37.0 7 36.065 37.0 37.0 37.0 37.0 37.0 8 36.2515 37.0 37.0 37.0 37.0 37.0 9 36.2265 37.0 37.0 37.0 37.0 37.0 10-14 36.1732 37.0 37.0 37.0 37.0 37.0 15-19 36.1132 37.0 37.0 37.0 37.0 37.0 20-24 36.15220000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.0433 37.0 37.0 37.0 37.0 37.0 30-34 36.06250000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.9967 37.0 37.0 37.0 37.0 37.0 40-44 36.0075 37.0 37.0 37.0 37.0 37.0 45-49 35.96289999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.950300000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.8626 37.0 37.0 37.0 37.0 37.0 60-64 35.8386 37.0 37.0 37.0 37.0 37.0 65-69 35.7966 37.0 37.0 37.0 37.0 37.0 70-74 35.7812 37.0 37.0 37.0 37.0 37.0 75-79 35.7008 37.0 37.0 37.0 37.0 37.0 80-84 35.753299999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.711999999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.6928 37.0 37.0 37.0 37.0 37.0 95-99 35.731100000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.6551 37.0 37.0 37.0 37.0 37.0 105-109 35.5719 37.0 37.0 37.0 37.0 37.0 110-114 35.5681 37.0 37.0 37.0 37.0 37.0 115-119 35.4998 37.0 37.0 37.0 37.0 37.0 120-124 35.5066 37.0 37.0 37.0 37.0 37.0 125-129 35.4139 37.0 37.0 37.0 37.0 37.0 130-134 35.414100000000005 37.0 37.0 37.0 34.6 37.0 135-139 35.3043 37.0 37.0 37.0 34.6 37.0 140-144 35.10360000000001 37.0 37.0 37.0 25.0 37.0 145-149 35.2118 37.0 37.0 37.0 29.8 37.0 150-151 34.728 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 2.0 22 5.0 23 4.0 24 5.0 25 13.0 26 9.0 27 11.0 28 18.0 29 20.0 30 35.0 31 45.0 32 74.0 33 144.0 34 250.0 35 688.0 36 2500.0 37 169.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.550000000000004 15.925 17.125 34.4 2 24.325 23.200000000000003 36.3 16.175 3 19.950000000000003 26.200000000000003 31.374999999999996 22.475 4 21.45 36.875 22.325 19.35 5 24.65 34.65 22.650000000000002 18.05 6 18.6 37.275000000000006 24.075 20.05 7 17.775 16.725 43.65 21.85 8 20.599999999999998 22.425 26.75 30.225 9 21.375 25.55 28.799999999999997 24.275 10-14 22.055 28.565 27.08 22.3 15-19 21.795 28.375 28.050000000000004 21.78 20-24 22.68 28.125 27.900000000000002 21.295 25-29 22.28 28.415000000000003 27.975 21.33 30-34 22.405 28.439999999999998 27.725 21.43 35-39 22.455 28.389999999999997 28.02 21.135 40-44 22.125 28.410000000000004 27.98 21.485000000000003 45-49 22.065 27.900000000000002 27.87 22.165000000000003 50-54 22.634999999999998 27.805000000000003 28.105000000000004 21.455 55-59 22.56 27.57 27.88 21.990000000000002 60-64 23.095 27.639999999999997 27.800000000000004 21.465 65-69 22.7 27.224999999999998 28.24 21.834999999999997 70-74 23.27 27.35 28.075 21.305 75-79 22.655 27.810000000000002 28.000000000000004 21.535 80-84 23.715 27.74 27.279999999999998 21.265 85-89 23.485 27.994999999999997 27.435 21.085 90-94 23.06 27.6 28.055000000000003 21.285 95-99 23.705000000000002 27.46 27.650000000000002 21.185000000000002 100-104 23.669999999999998 27.389999999999997 27.534999999999997 21.404999999999998 105-109 23.150000000000002 27.544999999999998 28.24 21.065 110-114 23.365 27.474999999999998 27.96 21.2 115-119 23.555 27.589999999999996 27.944999999999997 20.91 120-124 23.805 27.595 27.485 21.115000000000002 125-129 24.27 27.55 27.655 20.525 130-134 24.09 27.455000000000002 27.63 20.825 135-139 24.305 27.700000000000003 27.37 20.625 140-144 24.85 27.889999999999997 26.935 20.325 145-149 24.95 27.42 27.810000000000002 19.82 150-151 25.525 27.3875 26.5125 20.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 2.5 20 2.0 21 1.5 22 1.0 23 1.0 24 3.0 25 3.5 26 3.0 27 6.0 28 8.0 29 10.5 30 15.0 31 16.0 32 22.0 33 36.5 34 54.0 35 63.0 36 73.5 37 105.0 38 131.5 39 161.0 40 196.0 41 222.0 42 241.0 43 249.0 44 278.5 45 290.0 46 270.5 47 249.0 48 232.0 49 207.5 50 167.5 51 138.0 52 123.0 53 104.0 54 74.5 55 58.0 56 45.5 57 35.5 58 25.0 59 18.0 60 16.5 61 10.0 62 8.0 63 5.5 64 2.5 65 4.5 66 3.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.45 #Duplication Level Percentage of deduplicated Percentage of total 1 94.6003176283748 89.35 2 5.05558496559026 9.55 3 0.2382212811011117 0.675 4 0.07940709370037057 0.3 5 0.02646903123345686 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.1124999999999998 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.7625000000000002 0.0 0.0 0.0 0.0 120-121 1.9249999999999998 0.0 0.0 0.0 0.0 122-123 2.025 0.0 0.0 0.0 0.0 124-125 2.2375 0.0 0.0 0.0 0.0 126-127 2.3875 0.0 0.0 0.0 0.0 128-129 2.6500000000000004 0.0 0.0 0.0 0.0 130-131 3.0375 0.0 0.0 0.0 0.0 132-133 3.375 0.0 0.0 0.0 0.0 134-135 3.7375 0.0 0.0 0.0 0.0 136-137 4.025 0.0 0.0 0.0 0.0 138-139 4.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985612 spots for SRR12671679.sra Written 985612 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra Read 985598 spots for SRR12671679.sra Written 985598 spots for SRR12671679.sra SRR ids: ['SRR12671679.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sxyxf_5j SRR12671679.sra spots: 19711974 blocks: [[1, 985598], [985599, 1971196], [1971197, 2956794], [2956795, 3942392], [3942393, 4927990], [4927991, 5913588], [5913589, 6899186], [6899187, 7884784], [7884785, 8870382], [8870383, 9855980], [9855981, 10841578], [10841579, 11827176], [11827177, 12812774], [12812775, 13798372], [13798373, 14783970], [14783971, 15769568], [15769569, 16755166], [16755167, 17740764], [17740765, 18726362], [18726363, 19711974]] SRR12671679 file size 6677290 SRR12671679 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671679 SRR12671679_1.fastq SRR12671679_2.fastq Input file: SRR12671679_1.fastq Paired file: SRR12671679_2.fastq trimmed: SRR12671679-trimmed-pair1.fastq, SRR12671679-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:56:52 2025 >> started Wed Feb 12 02:57:15 2025 >> done (22.773s) 19711974 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 1683 ( 0.01%) empty read pairs filtered out after trimming by size control 19710276 (99.99%) read pairs available; of these: 1480401 ( 7.51%) trimmed read pairs available after processing 18229875 (92.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 6 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 1 0.00% 25 0 0.00% 26 6 0.00% 27 1 0.00% 28 3 0.00% 29 2 0.00% 30 5 0.00% 31 7 0.00% 32 8 0.00% 33 10 0.00% 34 11 0.00% 35 17 0.00% 36 10 0.00% 37 20 0.00% 38 21 0.00% 39 24 0.00% 40 23 0.00% 41 25 0.00% 42 22 0.00% 43 33 0.00% 44 29 0.00% 45 38 0.00% 46 30 0.00% 47 46 0.00% 48 53 0.00% 49 45 0.00% 50 49 0.00% 51 56 0.00% 52 70 0.00% 53 70 0.00% 54 90 0.00% 55 90 0.00% 56 91 0.00% 57 118 0.00% 58 120 0.00% 59 132 0.00% 60 173 0.00% 61 184 0.00% 62 215 0.00% 63 233 0.00% 64 251 0.00% 65 276 0.00% 66 265 0.00% 67 328 0.00% 68 382 0.00% 69 401 0.00% 70 470 0.00% 71 536 0.00% 72 654 0.00% 73 649 0.00% 74 790 0.00% 75 850 0.00% 76 935 0.00% 77 989 0.01% 78 1081 0.01% 79 1343 0.01% 80 1428 0.01% 81 1660 0.01% 82 1937 0.01% 83 2037 0.01% 84 2376 0.01% 85 2586 0.01% 86 2844 0.01% 87 3174 0.02% 88 3350 0.02% 89 3695 0.02% 90 3892 0.02% 91 4364 0.02% 92 4875 0.02% 93 5409 0.03% 94 5723 0.03% 95 6265 0.03% 96 6642 0.03% 97 7286 0.04% 98 7739 0.04% 99 8171 0.04% 100 8861 0.04% 101 9357 0.05% 102 10091 0.05% 103 10789 0.05% 104 11239 0.06% 105 11830 0.06% 106 12779 0.06% 107 13159 0.07% 108 13875 0.07% 109 14524 0.07% 110 15086 0.08% 111 15634 0.08% 112 16647 0.08% 113 17284 0.09% 114 18224 0.09% 115 18914 0.10% 116 19696 0.10% 117 20266 0.10% 118 21211 0.11% 119 21893 0.11% 120 22785 0.12% 121 23503 0.12% 122 24434 0.12% 123 25453 0.13% 124 26132 0.13% 125 26865 0.14% 126 27714 0.14% 127 28796 0.15% 128 29101 0.15% 129 29998 0.15% 130 30449 0.15% 131 31192 0.16% 132 32012 0.16% 133 33725 0.17% 134 34025 0.17% 135 35553 0.18% 136 35523 0.18% 137 36533 0.19% 138 37269 0.19% 139 38191 0.19% 140 38501 0.20% 141 39063 0.20% 142 40610 0.21% 143 41211 0.21% 144 42906 0.22% 145 43395 0.22% 146 44167 0.22% 147 45130 0.23% 148 45547 0.23% 149 45394 0.23% 150 46016 0.23% 151 18229875 92.49% 19710276 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=26 prefix-density=0.48 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=21.27 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=8.5 sequence=ACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=26 prefix-density=0.65 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=13.50 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.9 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR12671679 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:58:01 Started mapping on | Feb 12 02:58:01 Finished on | Feb 12 02:59:53 Mapping speed, Million of reads per hour | 633.54 Number of input reads | 19710276 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18749957 Uniquely mapped reads % | 95.13% Average mapped length | 297.33 Number of splices: Total | 19126823 Number of splices: Annotated (sjdb) | 18757150 Number of splices: GT/AG | 18739536 Number of splices: GC/AG | 326280 Number of splices: AT/AC | 11138 Number of splices: Non-canonical | 49869 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463440 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 61801 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.12% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 496879 496879 496879 N_multimapping 463440 463440 463440 N_noFeature 650340 18497754 738591 N_ambiguous 282709 1138 118114 UnstrandedReadsAssigned:17816908 PositiveStrandReadsAssigned:251065 NegativeStrandReadsAssigned:17893252 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671679 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671679-trimmed-pair1.fastq SRR12671679-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,710,276 reads, 17,903,023 reads pseudoaligned [quant] estimated average fragment length: 287.047 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR12671679.ke.tsv 34699 SRR12671679.se.tsv 87100 total ==> SRR12671679.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1731.95 815 26.0478 Potri.005G024800.1.v4.1 1035 748.953 406 30.0069 Potri.004G059700.1.v4.1 961 675.507 1 0.0819446 Potri.007G009000.2.v4.1 1416 1129.95 0 0 Potri.003G141000.2.v4.1 2943 2656.95 1030.47 21.4686 Potri.016G087400.1.v4.1 270 79.3123 641 447.371 Potri.015G069301.1.v4.1 564 301.945 0 0 Potri.010G195200.1.v4.1 1773 1486.95 36 1.34016 Potri.012G127500.1.v4.1 977 691.239 89 7.12709 ==> SRR12671679.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 87 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 231 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12671679 completed mapping pipeline successfully