Starting /dee2/code/volunteer_pipeline.sh SRR12671680 current disk space = 3048932270080 free memory = 1581477328 SRR12671680 SRAfilesize 7b681c379c6ad687ba43ee2ff9de7cf7 SRR12671680.sra SRR12671680.sra file validated SRR12671680 is paired end SRR12671680 is conventional basespace SRR12671680 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671680_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.435 37.0 37.0 37.0 37.0 37.0 2 36.244 37.0 37.0 37.0 37.0 37.0 3 36.549 37.0 37.0 37.0 37.0 37.0 4 36.568 37.0 37.0 37.0 37.0 37.0 5 36.5405 37.0 37.0 37.0 37.0 37.0 6 36.4825 37.0 37.0 37.0 37.0 37.0 7 36.416 37.0 37.0 37.0 37.0 37.0 8 36.5775 37.0 37.0 37.0 37.0 37.0 9 36.621 37.0 37.0 37.0 37.0 37.0 10-14 36.54720000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.5284 37.0 37.0 37.0 37.0 37.0 20-24 36.4988 37.0 37.0 37.0 37.0 37.0 25-29 36.4607 37.0 37.0 37.0 37.0 37.0 30-34 36.4233 37.0 37.0 37.0 37.0 37.0 35-39 36.4269 37.0 37.0 37.0 37.0 37.0 40-44 36.35770000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.4007 37.0 37.0 37.0 37.0 37.0 50-54 36.374399999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.324 37.0 37.0 37.0 37.0 37.0 60-64 36.31570000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2769 37.0 37.0 37.0 37.0 37.0 70-74 36.3137 37.0 37.0 37.0 37.0 37.0 75-79 36.1963 37.0 37.0 37.0 37.0 37.0 80-84 36.2856 37.0 37.0 37.0 37.0 37.0 85-89 36.24929999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.228300000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.1454 37.0 37.0 37.0 37.0 37.0 100-104 36.2395 37.0 37.0 37.0 37.0 37.0 105-109 36.1426 37.0 37.0 37.0 37.0 37.0 110-114 36.136199999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1398 37.0 37.0 37.0 37.0 37.0 120-124 36.067099999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.0751 37.0 37.0 37.0 37.0 37.0 130-134 35.945100000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.9098 37.0 37.0 37.0 37.0 37.0 140-144 35.835300000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.8513 37.0 37.0 37.0 37.0 37.0 150-151 35.4415 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 3.0 27 10.0 28 10.0 29 16.0 30 26.0 31 44.0 32 49.0 33 81.0 34 118.0 35 338.0 36 2959.0 37 344.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.475 14.174999999999999 12.45 42.9 2 20.275689223057643 19.849624060150376 39.34837092731829 20.526315789473685 3 18.725 26.3 27.400000000000002 27.575 4 21.75 33.2 22.525000000000002 22.525000000000002 5 21.65 35.9 24.55 17.9 6 18.125 35.25 26.674999999999997 19.950000000000003 7 12.925 20.8 45.525 20.75 8 17.849999999999998 22.0 29.799999999999997 30.349999999999998 9 17.025000000000002 22.900000000000002 32.2 27.875 10-14 19.68 28.78 27.245 24.295 15-19 19.835 28.544999999999998 27.700000000000003 23.919999999999998 20-24 19.735 28.470000000000002 28.095 23.7 25-29 19.985 28.185 28.355000000000004 23.474999999999998 30-34 20.01 28.34 28.475 23.175 35-39 19.89 28.185 28.12 23.805 40-44 19.67 29.375 27.389999999999997 23.565 45-49 20.165 28.58 27.255000000000003 24.0 50-54 20.055 28.735 28.02 23.189999999999998 55-59 20.21 28.749999999999996 27.245 23.794999999999998 60-64 20.185 28.62 27.584999999999997 23.61 65-69 20.549999999999997 27.625 28.235 23.59 70-74 20.075000000000003 28.189999999999998 27.865000000000002 23.87 75-79 20.49 28.59 27.115000000000002 23.805 80-84 20.380000000000003 28.660000000000004 27.73 23.23 85-89 20.02 28.499999999999996 27.52 23.96 90-94 20.150000000000002 28.13 28.17 23.549999999999997 95-99 20.05 27.41 28.455000000000002 24.085 100-104 20.7 27.794999999999998 28.09 23.415 105-109 20.275000000000002 28.28 27.644999999999996 23.799999999999997 110-114 20.865000000000002 27.975 27.889999999999997 23.27 115-119 21.22 28.065 27.505000000000003 23.21 120-124 20.805 28.02 27.775 23.400000000000002 125-129 20.355 28.23 27.105 24.310000000000002 130-134 20.685000000000002 28.125 27.935 23.255 135-139 21.05 28.110000000000003 26.979999999999997 23.86 140-144 20.735 28.175 27.325 23.765 145-149 20.7 27.900000000000002 27.805000000000003 23.595 150-151 20.5375 28.125 27.462500000000002 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 3.0 25 5.0 26 7.5 27 9.5 28 10.0 29 17.0 30 21.0 31 24.0 32 35.0 33 43.0 34 58.5 35 77.0 36 100.0 37 113.0 38 133.5 39 164.5 40 178.0 41 212.5 42 245.0 43 249.0 44 260.0 45 277.5 46 271.0 47 249.5 48 237.5 49 203.5 50 162.0 51 144.5 52 114.0 53 94.0 54 73.5 55 51.5 56 46.0 57 35.5 58 25.5 59 16.5 60 13.5 61 8.0 62 2.5 63 1.0 64 1.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.86830178619034 88.02499999999999 2 5.678485737136763 10.65 3 0.4265529192215409 1.2 4 0.0 0.0 5 0.026659557451346308 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGCCTTTTTCCTTCTTAGAGCACTGACCAGTAAGACTTATTGCACTCCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.9624999999999999 0.0 0.0 0.0 0.0 114-115 1.0499999999999998 0.0 0.0 0.0 0.0 116-117 1.2000000000000002 0.0 0.0 0.0 0.0 118-119 1.2999999999999998 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.3625 0.0 0.0 0.0 0.0 130-131 2.5250000000000004 0.0 0.0 0.0 0.0 132-133 2.7249999999999996 0.0 0.0 0.0 0.0 134-135 3.1125 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138-139 3.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCTC 10 0.006830828 145.0 5 >>END_MODULE SRR12671680 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671680_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.121 37.0 37.0 37.0 37.0 37.0 2 36.1165 37.0 37.0 37.0 37.0 37.0 3 36.1795 37.0 37.0 37.0 37.0 37.0 4 36.199 37.0 37.0 37.0 37.0 37.0 5 36.2405 37.0 37.0 37.0 37.0 37.0 6 36.2165 37.0 37.0 37.0 37.0 37.0 7 36.2365 37.0 37.0 37.0 37.0 37.0 8 36.374 37.0 37.0 37.0 37.0 37.0 9 36.328 37.0 37.0 37.0 37.0 37.0 10-14 36.2955 37.0 37.0 37.0 37.0 37.0 15-19 36.2877 37.0 37.0 37.0 37.0 37.0 20-24 36.2407 37.0 37.0 37.0 37.0 37.0 25-29 36.1797 37.0 37.0 37.0 37.0 37.0 30-34 36.1922 37.0 37.0 37.0 37.0 37.0 35-39 36.1796 37.0 37.0 37.0 37.0 37.0 40-44 36.1543 37.0 37.0 37.0 37.0 37.0 45-49 36.1151 37.0 37.0 37.0 37.0 37.0 50-54 36.084199999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.0766 37.0 37.0 37.0 37.0 37.0 60-64 35.951 37.0 37.0 37.0 37.0 37.0 65-69 35.932199999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.9495 37.0 37.0 37.0 37.0 37.0 75-79 35.9416 37.0 37.0 37.0 37.0 37.0 80-84 35.9497 37.0 37.0 37.0 37.0 37.0 85-89 35.8832 37.0 37.0 37.0 37.0 37.0 90-94 35.8392 37.0 37.0 37.0 37.0 37.0 95-99 35.884499999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.80329999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.7504 37.0 37.0 37.0 37.0 37.0 110-114 35.7259 37.0 37.0 37.0 37.0 37.0 115-119 35.697799999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.7284 37.0 37.0 37.0 37.0 37.0 125-129 35.563900000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.5561 37.0 37.0 37.0 37.0 37.0 135-139 35.545300000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.3815 37.0 37.0 37.0 32.2 37.0 145-149 35.4024 37.0 37.0 37.0 34.6 37.0 150-151 35.044 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 0.0 15 1.0 16 0.0 17 1.0 18 0.0 19 0.0 20 1.0 21 1.0 22 2.0 23 3.0 24 1.0 25 7.0 26 7.0 27 14.0 28 11.0 29 19.0 30 24.0 31 41.0 32 74.0 33 105.0 34 233.0 35 590.0 36 2672.0 37 190.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.925 17.424999999999997 17.325 32.324999999999996 2 25.05 23.5 36.75 14.7 3 20.45 25.924999999999997 32.775 20.849999999999998 4 23.125 34.575 21.85 20.45 5 24.349999999999998 38.224999999999994 20.974999999999998 16.45 6 17.825 38.875 23.025000000000002 20.275000000000002 7 17.224999999999998 17.125 44.05 21.6 8 21.75 22.55 28.499999999999996 27.200000000000003 9 22.400000000000002 24.6 28.225 24.775 10-14 22.15 29.080000000000002 26.83 21.94 15-19 22.375 27.97 28.305000000000003 21.349999999999998 20-24 22.28 28.48 27.72 21.52 25-29 22.259999999999998 28.205000000000002 27.889999999999997 21.645 30-34 22.145 28.595 27.900000000000002 21.36 35-39 22.495 28.165000000000003 28.015 21.325 40-44 22.400000000000002 28.255000000000003 28.03 21.315 45-49 22.975 27.534999999999997 28.43 21.060000000000002 50-54 22.14 28.095 27.975 21.790000000000003 55-59 22.825 27.025 28.439999999999998 21.709999999999997 60-64 22.455 27.089999999999996 28.355000000000004 22.1 65-69 22.455 28.21 27.415 21.92 70-74 22.939999999999998 28.075 27.450000000000003 21.535 75-79 22.64 27.3 28.139999999999997 21.92 80-84 22.88 28.194999999999997 27.05 21.875 85-89 23.01 28.035 27.855 21.099999999999998 90-94 23.625 28.375 27.055 20.945 95-99 23.54 27.605 27.625 21.23 100-104 23.27 28.275 27.084999999999997 21.37 105-109 23.5 27.41 28.415000000000003 20.674999999999997 110-114 23.169999999999998 27.529999999999998 28.08 21.22 115-119 23.674999999999997 28.055000000000003 27.355 20.915 120-124 23.48 27.529999999999998 27.900000000000002 21.09 125-129 24.005000000000003 27.825 27.889999999999997 20.28 130-134 23.825 27.905 27.42 20.849999999999998 135-139 23.625 27.650000000000002 27.560000000000002 21.165 140-144 24.02 28.115000000000002 27.26 20.605 145-149 23.985 27.91 27.334999999999997 20.77 150-151 24.474999999999998 28.3875 27.0875 20.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 1.0 21 1.5 22 1.5 23 0.5 24 2.5 25 4.0 26 5.5 27 8.5 28 11.5 29 15.0 30 18.0 31 20.5 32 33.5 33 44.5 34 44.5 35 61.0 36 89.5 37 108.5 38 130.5 39 161.0 40 183.0 41 216.5 42 238.0 43 246.5 44 265.0 45 278.0 46 273.5 47 257.0 48 231.5 49 198.0 50 177.0 51 153.0 52 110.5 53 77.5 54 63.0 55 54.0 56 53.5 57 43.0 58 34.0 59 27.5 60 17.0 61 12.0 62 7.0 63 3.5 64 1.5 65 1.5 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.35 #Duplication Level Percentage of deduplicated Percentage of total 1 93.81360471344404 87.575 2 5.570433851098018 10.4 3 0.48205677557579 1.35 4 0.02678093197643278 0.1 5 0.02678093197643278 0.125 6 0.08034279592929834 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAGGATAAGATATTGGCAGCACACCGCTATGGCATCAAGAGAGTGATTCT 6 0.15 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 6 0.15 No Hit CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.4249999999999998 0.0 0.0 0.0 0.0 122-123 1.6375 0.0 0.0 0.0 0.0 124-125 1.825 0.0 0.0 0.0 0.0 126-127 2.025 0.0 0.0 0.0 0.0 128-129 2.325 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.7 0.0 0.0 0.0 0.0 134-135 3.075 0.0 0.0 0.0 0.0 136-137 3.4375 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCATGAT 10 0.006830828 145.0 7 >>END_MODULE Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926529 spots for SRR12671680.sra Written 926529 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra Read 926517 spots for SRR12671680.sra Written 926517 spots for SRR12671680.sra SRR ids: ['SRR12671680.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c_v_06bd SRR12671680.sra spots: 18530352 blocks: [[1, 926517], [926518, 1853034], [1853035, 2779551], [2779552, 3706068], [3706069, 4632585], [4632586, 5559102], [5559103, 6485619], [6485620, 7412136], [7412137, 8338653], [8338654, 9265170], [9265171, 10191687], [10191688, 11118204], [11118205, 12044721], [12044722, 12971238], [12971239, 13897755], [13897756, 14824272], [14824273, 15750789], [15750790, 16677306], [16677307, 17603823], [17603824, 18530352]] SRR12671680 file size 6275723 SRR12671680 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671680 SRR12671680_1.fastq SRR12671680_2.fastq Input file: SRR12671680_1.fastq Paired file: SRR12671680_2.fastq trimmed: SRR12671680-trimmed-pair1.fastq, SRR12671680-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:54:37 2025 >> started Wed Feb 12 02:54:57 2025 >> done (19.368s) 18530352 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 2918 ( 0.02%) empty read pairs filtered out after trimming by size control 18527419 (99.98%) read pairs available; of these: 1023969 ( 5.53%) trimmed read pairs available after processing 17503450 (94.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 4 0.00% 23 2 0.00% 24 4 0.00% 25 4 0.00% 26 2 0.00% 27 6 0.00% 28 4 0.00% 29 6 0.00% 30 7 0.00% 31 5 0.00% 32 7 0.00% 33 10 0.00% 34 9 0.00% 35 5 0.00% 36 8 0.00% 37 21 0.00% 38 17 0.00% 39 14 0.00% 40 23 0.00% 41 24 0.00% 42 31 0.00% 43 21 0.00% 44 32 0.00% 45 27 0.00% 46 26 0.00% 47 44 0.00% 48 36 0.00% 49 43 0.00% 50 42 0.00% 51 49 0.00% 52 41 0.00% 53 63 0.00% 54 64 0.00% 55 65 0.00% 56 67 0.00% 57 75 0.00% 58 84 0.00% 59 92 0.00% 60 103 0.00% 61 124 0.00% 62 127 0.00% 63 155 0.00% 64 151 0.00% 65 167 0.00% 66 204 0.00% 67 206 0.00% 68 209 0.00% 69 227 0.00% 70 291 0.00% 71 327 0.00% 72 372 0.00% 73 390 0.00% 74 455 0.00% 75 509 0.00% 76 563 0.00% 77 620 0.00% 78 676 0.00% 79 763 0.00% 80 809 0.00% 81 900 0.00% 82 1072 0.01% 83 1213 0.01% 84 1361 0.01% 85 1475 0.01% 86 1663 0.01% 87 1771 0.01% 88 1895 0.01% 89 2088 0.01% 90 2414 0.01% 91 2487 0.01% 92 2849 0.02% 93 3071 0.02% 94 3499 0.02% 95 3704 0.02% 96 3853 0.02% 97 4198 0.02% 98 4600 0.02% 99 4730 0.03% 100 5034 0.03% 101 5497 0.03% 102 5932 0.03% 103 6356 0.03% 104 6887 0.04% 105 7263 0.04% 106 7711 0.04% 107 8010 0.04% 108 8513 0.05% 109 8983 0.05% 110 9431 0.05% 111 9809 0.05% 112 10171 0.05% 113 11021 0.06% 114 11467 0.06% 115 12130 0.07% 116 12889 0.07% 117 13137 0.07% 118 13775 0.07% 119 14136 0.08% 120 14697 0.08% 121 15209 0.08% 122 15777 0.09% 123 16930 0.09% 124 17736 0.10% 125 17891 0.10% 126 19059 0.10% 127 19037 0.10% 128 19611 0.11% 129 20337 0.11% 130 21190 0.11% 131 21732 0.12% 132 22460 0.12% 133 23370 0.13% 134 24452 0.13% 135 25102 0.14% 136 25603 0.14% 137 26091 0.14% 138 26897 0.15% 139 27805 0.15% 140 28233 0.15% 141 29110 0.16% 142 29962 0.16% 143 30872 0.17% 144 32403 0.17% 145 33240 0.18% 146 33762 0.18% 147 34352 0.19% 148 34678 0.19% 149 34972 0.19% 150 35867 0.19% 151 17503450 94.47% 18527419 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=26 prefix-density=0.57 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCATGTTGGCTTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=13.15 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.2 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=25 prefix-density=0.79 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=22.57 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAA SRR12671680 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:55:38 Started mapping on | Feb 12 02:55:38 Finished on | Feb 12 02:57:33 Mapping speed, Million of reads per hour | 579.99 Number of input reads | 18527419 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17597031 Uniquely mapped reads % | 94.98% Average mapped length | 298.49 Number of splices: Total | 18259682 Number of splices: Annotated (sjdb) | 17915042 Number of splices: GT/AG | 17889965 Number of splices: GC/AG | 309283 Number of splices: AT/AC | 10150 Number of splices: Non-canonical | 50284 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418265 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 100491 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.10% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 512123 512123 512123 N_multimapping 418265 418265 418265 N_noFeature 615357 17343821 706050 N_ambiguous 271896 1334 108482 UnstrandedReadsAssigned:16709778 PositiveStrandReadsAssigned:251876 NegativeStrandReadsAssigned:16782499 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671680 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671680-trimmed-pair1.fastq SRR12671680-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,527,419 reads, 16,751,906 reads pseudoaligned [quant] estimated average fragment length: 298.397 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR12671680.ke.tsv 34699 SRR12671680.se.tsv 87100 total ==> SRR12671680.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1720.6 627 20.7054 Potri.005G024800.1.v4.1 1035 737.603 178 13.7118 Potri.004G059700.1.v4.1 961 664.14 1 0.0855532 Potri.007G009000.2.v4.1 1416 1118.6 0 0 Potri.003G141000.2.v4.1 2943 2645.6 1133.08 24.3351 Potri.016G087400.1.v4.1 270 74.9831 984 745.637 Potri.015G069301.1.v4.1 564 293.296 0 0 Potri.010G195200.1.v4.1 1773 1475.6 85 3.27299 Potri.012G127500.1.v4.1 977 679.835 159 13.2889 ==> SRR12671680.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 122 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 193 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12671680 completed mapping pipeline successfully