Starting /dee2/code/volunteer_pipeline.sh SRR12671681 current disk space = 3049026334720 free memory = 1491225196 SRR12671681 SRAfilesize 42066e47f35358594f22e0c312d4eb4b SRR12671681.sra SRR12671681.sra file validated SRR12671681 is paired end SRR12671681 is conventional basespace SRR12671681 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671681_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4215 37.0 37.0 37.0 37.0 37.0 2 36.26975 37.0 37.0 37.0 37.0 37.0 3 36.506 37.0 37.0 37.0 37.0 37.0 4 36.5655 37.0 37.0 37.0 37.0 37.0 5 36.5495 37.0 37.0 37.0 37.0 37.0 6 36.5395 37.0 37.0 37.0 37.0 37.0 7 36.504 37.0 37.0 37.0 37.0 37.0 8 36.5445 37.0 37.0 37.0 37.0 37.0 9 36.5615 37.0 37.0 37.0 37.0 37.0 10-14 36.5635 37.0 37.0 37.0 37.0 37.0 15-19 36.5136 37.0 37.0 37.0 37.0 37.0 20-24 36.5236 37.0 37.0 37.0 37.0 37.0 25-29 36.498900000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.4811 37.0 37.0 37.0 37.0 37.0 35-39 36.4485 37.0 37.0 37.0 37.0 37.0 40-44 36.39959999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.3768 37.0 37.0 37.0 37.0 37.0 50-54 36.3658 37.0 37.0 37.0 37.0 37.0 55-59 36.3403 37.0 37.0 37.0 37.0 37.0 60-64 36.3376 37.0 37.0 37.0 37.0 37.0 65-69 36.3578 37.0 37.0 37.0 37.0 37.0 70-74 36.312599999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.275800000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2655 37.0 37.0 37.0 37.0 37.0 85-89 36.254599999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2567 37.0 37.0 37.0 37.0 37.0 95-99 36.1958 37.0 37.0 37.0 37.0 37.0 100-104 36.2161 37.0 37.0 37.0 37.0 37.0 105-109 36.12339999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.1259 37.0 37.0 37.0 37.0 37.0 115-119 36.1297 37.0 37.0 37.0 37.0 37.0 120-124 36.0797 37.0 37.0 37.0 37.0 37.0 125-129 36.0623 37.0 37.0 37.0 37.0 37.0 130-134 35.970800000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.937400000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.891799999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.8026 37.0 37.0 37.0 37.0 37.0 150-151 35.39275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 1.0 26 2.0 27 5.0 28 12.0 29 11.0 30 29.0 31 45.0 32 49.0 33 72.0 34 134.0 35 304.0 36 2969.0 37 364.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.275000000000002 15.950000000000001 11.95 41.825 2 19.29736511919699 21.3801756587202 40.2258469259724 19.09661229611041 3 18.45 25.7 28.125 27.725 4 21.0 33.725 22.85 22.425 5 20.25 37.125 24.349999999999998 18.275 6 17.025000000000002 34.75 26.625 21.6 7 13.350000000000001 21.95 45.475 19.225 8 17.7 21.75 28.95 31.6 9 16.5 23.400000000000002 33.324999999999996 26.775 10-14 19.255 28.88 27.57 24.295 15-19 19.605 28.43 27.87 24.095 20-24 19.77 28.595 27.529999999999998 24.104999999999997 25-29 20.150000000000002 29.17 27.134999999999998 23.544999999999998 30-34 20.14 28.645 27.55 23.665 35-39 19.88 28.57 27.595 23.955000000000002 40-44 20.064999999999998 28.854999999999997 27.6 23.48 45-49 20.244999999999997 28.73 27.52 23.505000000000003 50-54 20.055 28.405 27.73 23.810000000000002 55-59 19.53 28.265 28.155 24.05 60-64 19.955000000000002 28.139999999999997 27.74 24.165 65-69 20.315 27.98 27.82 23.885 70-74 20.36 27.93 28.1 23.61 75-79 19.759999999999998 28.050000000000004 28.365000000000002 23.825 80-84 20.544999999999998 27.71 27.99 23.755000000000003 85-89 19.900000000000002 28.24 27.245 24.615000000000002 90-94 19.900000000000002 28.825 27.750000000000004 23.525 95-99 20.605 28.249999999999996 27.305 23.84 100-104 20.155 28.65 27.255000000000003 23.94 105-109 20.66 27.839999999999996 28.095 23.405 110-114 20.355 28.33 27.900000000000002 23.415 115-119 20.715 28.225 27.715 23.345 120-124 20.76 28.000000000000004 27.229999999999997 24.01 125-129 20.435 28.005000000000003 28.17 23.39 130-134 21.099999999999998 27.785 27.750000000000004 23.365 135-139 21.01 27.500000000000004 28.000000000000004 23.49 140-144 20.61 27.755000000000003 27.57 24.065 145-149 21.345 28.28 27.05 23.325000000000003 150-151 21.025 27.737499999999997 27.6 23.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 2.0 22 2.5 23 3.5 24 5.5 25 5.0 26 3.0 27 6.0 28 9.5 29 12.5 30 20.0 31 29.0 32 42.0 33 40.5 34 45.5 35 74.5 36 101.0 37 120.0 38 144.0 39 167.5 40 194.0 41 217.0 42 231.5 43 253.0 44 269.5 45 261.0 46 241.5 47 240.0 48 235.0 49 203.0 50 160.0 51 138.0 52 124.0 53 102.0 54 72.5 55 52.0 56 45.0 57 40.5 58 29.0 59 16.0 60 12.5 61 7.0 62 2.5 63 4.5 64 5.5 65 2.0 66 0.5 67 1.0 68 2.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.40836012861736 87.15 2 6.055734190782423 11.3 3 0.482315112540193 1.35 4 0.05359056806002144 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.1749999999999998 0.0 0.0 0.0 0.0 126-127 1.3 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.65 0.0 0.0 0.0 0.0 132-133 1.875 0.0 0.0 0.0 0.0 134-135 2.1125 0.0 0.0 0.0 0.0 136-137 2.3 0.0 0.0 0.0 0.0 138-139 2.5250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671681 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671681_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.132 37.0 37.0 37.0 37.0 37.0 2 36.0415 37.0 37.0 37.0 37.0 37.0 3 36.0535 37.0 37.0 37.0 37.0 37.0 4 36.043 37.0 37.0 37.0 37.0 37.0 5 36.1795 37.0 37.0 37.0 37.0 37.0 6 36.2355 37.0 37.0 37.0 37.0 37.0 7 36.159 37.0 37.0 37.0 37.0 37.0 8 36.215 37.0 37.0 37.0 37.0 37.0 9 36.1215 37.0 37.0 37.0 37.0 37.0 10-14 36.249399999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.1852 37.0 37.0 37.0 37.0 37.0 20-24 36.153800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.1476 37.0 37.0 37.0 37.0 37.0 30-34 36.086499999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.1001 37.0 37.0 37.0 37.0 37.0 40-44 36.0326 37.0 37.0 37.0 37.0 37.0 45-49 36.0526 37.0 37.0 37.0 37.0 37.0 50-54 35.9938 37.0 37.0 37.0 37.0 37.0 55-59 35.98 37.0 37.0 37.0 37.0 37.0 60-64 35.9269 37.0 37.0 37.0 37.0 37.0 65-69 35.9049 37.0 37.0 37.0 37.0 37.0 70-74 35.9272 37.0 37.0 37.0 37.0 37.0 75-79 35.758900000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.8776 37.0 37.0 37.0 37.0 37.0 85-89 35.793 37.0 37.0 37.0 37.0 37.0 90-94 35.7589 37.0 37.0 37.0 37.0 37.0 95-99 35.756600000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.712199999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.6365 37.0 37.0 37.0 37.0 37.0 110-114 35.6241 37.0 37.0 37.0 37.0 37.0 115-119 35.5584 37.0 37.0 37.0 37.0 37.0 120-124 35.5434 37.0 37.0 37.0 37.0 37.0 125-129 35.5162 37.0 37.0 37.0 37.0 37.0 130-134 35.4745 37.0 37.0 37.0 37.0 37.0 135-139 35.48309999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.2573 37.0 37.0 37.0 27.4 37.0 145-149 35.377599999999994 37.0 37.0 37.0 34.6 37.0 150-151 34.922 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 3.0 20 3.0 21 2.0 22 1.0 23 4.0 24 11.0 25 6.0 26 5.0 27 13.0 28 21.0 29 22.0 30 35.0 31 46.0 32 65.0 33 101.0 34 235.0 35 569.0 36 2644.0 37 208.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.725 18.2 14.399999999999999 32.675 2 25.275 23.775 34.925 16.025 3 18.85 28.275 31.900000000000002 20.974999999999998 4 22.625 35.725 21.05 20.599999999999998 5 23.5 36.475 22.45 17.575 6 18.975 37.25 24.0 19.775000000000002 7 18.4 17.375 43.375 20.849999999999998 8 21.525 22.125 26.875 29.475 9 20.925 24.675 30.049999999999997 24.349999999999998 10-14 22.5 28.799999999999997 26.229999999999997 22.470000000000002 15-19 22.725 28.050000000000004 28.03 21.195 20-24 22.3 28.425 28.095 21.18 25-29 22.685 28.055000000000003 28.345 20.915 30-34 22.16 27.36 28.62 21.86 35-39 22.285 28.055000000000003 28.09 21.57 40-44 22.615 27.744999999999997 28.225 21.415 45-49 23.115 27.860000000000003 27.61 21.415 50-54 23.13 28.02 28.000000000000004 20.849999999999998 55-59 22.495 28.125 27.700000000000003 21.68 60-64 23.14 27.750000000000004 27.955000000000002 21.154999999999998 65-69 22.869999999999997 27.584999999999997 28.28 21.265 70-74 22.52 27.365000000000002 27.92 22.195 75-79 23.22 28.194999999999997 27.615000000000002 20.97 80-84 22.665 28.075 27.389999999999997 21.87 85-89 23.135 28.055000000000003 27.450000000000003 21.36 90-94 23.635 27.785 27.075 21.505 95-99 23.13 28.055000000000003 28.005000000000003 20.810000000000002 100-104 23.055 27.405 28.249999999999996 21.29 105-109 23.48 27.634999999999998 28.015 20.87 110-114 23.61 27.284999999999997 28.199999999999996 20.905 115-119 23.39 28.08 27.55 20.979999999999997 120-124 23.599999999999998 28.575 27.145000000000003 20.68 125-129 23.915 27.865000000000002 27.195000000000004 21.025 130-134 24.185000000000002 28.165000000000003 27.455000000000002 20.195 135-139 23.815 27.825 27.889999999999997 20.47 140-144 22.99 27.91 28.025 21.075 145-149 24.2 27.355 27.675 20.77 150-151 24.887500000000003 27.0625 27.85 20.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 0.5 13 0.5 14 1.0 15 1.0 16 0.5 17 0.5 18 1.5 19 1.0 20 0.0 21 0.5 22 2.0 23 3.5 24 4.5 25 5.0 26 4.5 27 5.0 28 8.0 29 11.5 30 16.5 31 22.0 32 27.5 33 37.5 34 48.5 35 67.0 36 91.0 37 120.0 38 143.5 39 158.5 40 184.5 41 209.0 42 240.0 43 265.5 44 253.0 45 260.0 46 254.5 47 243.0 48 235.5 49 203.0 50 169.5 51 127.0 52 112.5 53 102.0 54 77.0 55 61.0 56 55.0 57 38.5 58 28.5 59 27.0 60 22.5 61 18.0 62 9.0 63 5.5 64 3.0 65 0.5 66 0.5 67 0.5 68 1.5 69 1.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.75 #Duplication Level Percentage of deduplicated Percentage of total 1 93.94666666666667 88.075 2 5.546666666666667 10.4 3 0.4266666666666667 1.2 4 0.05333333333333334 0.2 5 0.02666666666666667 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.9625 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.2000000000000002 0.0 0.0 0.0 0.0 126-127 1.325 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.65 0.0 0.0 0.0 0.0 132-133 1.875 0.0 0.0 0.0 0.0 134-135 2.1125 0.0 0.0 0.0 0.0 136-137 2.3 0.0 0.0 0.0 0.0 138-139 2.5250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTAGTG 10 0.006830828 145.0 1 CTGCATT 10 0.006830828 145.0 8 >>END_MODULE Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004186 spots for SRR12671681.sra Written 1004186 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra Read 1004181 spots for SRR12671681.sra Written 1004181 spots for SRR12671681.sra SRR ids: ['SRR12671681.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wmz1lbdk SRR12671681.sra spots: 20083625 blocks: [[1, 1004181], [1004182, 2008362], [2008363, 3012543], [3012544, 4016724], [4016725, 5020905], [5020906, 6025086], [6025087, 7029267], [7029268, 8033448], [8033449, 9037629], [9037630, 10041810], [10041811, 11045991], [11045992, 12050172], [12050173, 13054353], [13054354, 14058534], [14058535, 15062715], [15062716, 16066896], [16066897, 17071077], [17071078, 18075258], [18075259, 19079439], [19079440, 20083625]] SRR12671681 file size 6803594 SRR12671681 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671681 SRR12671681_1.fastq SRR12671681_2.fastq Input file: SRR12671681_1.fastq Paired file: SRR12671681_2.fastq trimmed: SRR12671681-trimmed-pair1.fastq, SRR12671681-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:56:23 2025 >> started Wed Feb 12 02:56:44 2025 >> done (21.029s) 20083625 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 2003 ( 0.01%) empty read pairs filtered out after trimming by size control 20081602 (99.99%) read pairs available; of these: 1012801 ( 5.04%) trimmed read pairs available after processing 19068801 (94.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 5 0.00% 22 1 0.00% 23 2 0.00% 24 2 0.00% 25 4 0.00% 26 4 0.00% 27 2 0.00% 28 2 0.00% 29 5 0.00% 30 7 0.00% 31 10 0.00% 32 9 0.00% 33 19 0.00% 34 19 0.00% 35 17 0.00% 36 19 0.00% 37 12 0.00% 38 16 0.00% 39 10 0.00% 40 23 0.00% 41 22 0.00% 42 25 0.00% 43 21 0.00% 44 32 0.00% 45 38 0.00% 46 27 0.00% 47 42 0.00% 48 39 0.00% 49 49 0.00% 50 68 0.00% 51 64 0.00% 52 66 0.00% 53 53 0.00% 54 65 0.00% 55 71 0.00% 56 84 0.00% 57 92 0.00% 58 98 0.00% 59 116 0.00% 60 100 0.00% 61 129 0.00% 62 153 0.00% 63 172 0.00% 64 165 0.00% 65 196 0.00% 66 180 0.00% 67 209 0.00% 68 255 0.00% 69 276 0.00% 70 295 0.00% 71 273 0.00% 72 383 0.00% 73 476 0.00% 74 474 0.00% 75 538 0.00% 76 577 0.00% 77 631 0.00% 78 749 0.00% 79 744 0.00% 80 850 0.00% 81 1000 0.00% 82 1138 0.01% 83 1260 0.01% 84 1465 0.01% 85 1582 0.01% 86 1686 0.01% 87 1887 0.01% 88 1935 0.01% 89 2167 0.01% 90 2352 0.01% 91 2599 0.01% 92 2830 0.01% 93 3171 0.02% 94 3556 0.02% 95 3752 0.02% 96 4007 0.02% 97 4304 0.02% 98 4461 0.02% 99 4843 0.02% 100 4965 0.02% 101 5339 0.03% 102 6019 0.03% 103 6456 0.03% 104 6780 0.03% 105 7327 0.04% 106 7690 0.04% 107 8096 0.04% 108 8208 0.04% 109 8708 0.04% 110 9092 0.05% 111 9550 0.05% 112 10200 0.05% 113 10725 0.05% 114 11272 0.06% 115 12090 0.06% 116 12830 0.06% 117 12956 0.06% 118 13784 0.07% 119 13796 0.07% 120 14402 0.07% 121 14929 0.07% 122 15520 0.08% 123 16481 0.08% 124 17249 0.09% 125 18045 0.09% 126 18506 0.09% 127 18952 0.09% 128 19540 0.10% 129 20048 0.10% 130 20423 0.10% 131 20853 0.10% 132 21730 0.11% 133 23131 0.12% 134 24108 0.12% 135 25086 0.12% 136 25650 0.13% 137 26470 0.13% 138 26429 0.13% 139 27607 0.14% 140 27478 0.14% 141 28162 0.14% 142 29305 0.15% 143 30342 0.15% 144 31912 0.16% 145 32439 0.16% 146 33977 0.17% 147 34297 0.17% 148 35044 0.17% 149 34506 0.17% 150 35211 0.18% 151 19068801 94.96% 20081602 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=34 prefix-density=0.55 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCATGTTGGCTTGTGCCGGGGTGCGGTTGACGGTGGCAACGGCTGCCGATGAGATCATAGAGGAGGAAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=89.41 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.6 sequence=CAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=27 prefix-density=0.73 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=41.75 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.7 sequence=AACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR12671681 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:57:27 Started mapping on | Feb 12 02:57:27 Finished on | Feb 12 02:59:32 Mapping speed, Million of reads per hour | 578.35 Number of input reads | 20081602 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18799558 Uniquely mapped reads % | 93.62% Average mapped length | 298.58 Number of splices: Total | 19179590 Number of splices: Annotated (sjdb) | 18801527 Number of splices: GT/AG | 18790483 Number of splices: GC/AG | 326882 Number of splices: AT/AC | 11154 Number of splices: Non-canonical | 51071 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463643 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 103303 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.44% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 818401 818401 818401 N_multimapping 463643 463643 463643 N_noFeature 688299 18558629 776012 N_ambiguous 275959 1254 121926 UnstrandedReadsAssigned:17835300 PositiveStrandReadsAssigned:239675 NegativeStrandReadsAssigned:17901620 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671681 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671681-trimmed-pair1.fastq SRR12671681-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,081,602 reads, 17,925,633 reads pseudoaligned [quant] estimated average fragment length: 303.851 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,257 rounds 52401 SRR12671681.ke.tsv 34699 SRR12671681.se.tsv 87100 total ==> SRR12671681.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1715.15 667 21.7663 Potri.005G024800.1.v4.1 1035 732.149 268 20.4878 Potri.004G059700.1.v4.1 961 658.625 15 1.27472 Potri.007G009000.2.v4.1 1416 1113.15 0 0 Potri.003G141000.2.v4.1 2943 2640.15 1019.88 21.6214 Potri.016G087400.1.v4.1 270 73.5511 659 501.483 Potri.015G069301.1.v4.1 564 288.743 0 0 Potri.010G195200.1.v4.1 1773 1470.15 50 1.90357 Potri.012G127500.1.v4.1 977 674.384 39 3.23681 ==> SRR12671681.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 162 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12671681 completed mapping pipeline successfully