Starting /dee2/code/volunteer_pipeline.sh SRR12671682 current disk space = 3048883752960 free memory = 1576633896 SRR12671682 SRAfilesize 748fb1d373b3f74647322501c50dfe3c SRR12671682.sra SRR12671682.sra file validated SRR12671682 is paired end SRR12671682 is conventional basespace SRR12671682 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671682_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2465 37.0 37.0 37.0 37.0 37.0 2 36.29375 37.0 37.0 37.0 37.0 37.0 3 36.457 37.0 37.0 37.0 37.0 37.0 4 36.5635 37.0 37.0 37.0 37.0 37.0 5 36.4975 37.0 37.0 37.0 37.0 37.0 6 36.4755 37.0 37.0 37.0 37.0 37.0 7 36.4925 37.0 37.0 37.0 37.0 37.0 8 36.5385 37.0 37.0 37.0 37.0 37.0 9 36.5685 37.0 37.0 37.0 37.0 37.0 10-14 36.5316 37.0 37.0 37.0 37.0 37.0 15-19 36.509499999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.507099999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.4216 37.0 37.0 37.0 37.0 37.0 30-34 36.448899999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4021 37.0 37.0 37.0 37.0 37.0 40-44 36.3697 37.0 37.0 37.0 37.0 37.0 45-49 36.352199999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3553 37.0 37.0 37.0 37.0 37.0 55-59 36.314499999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.2753 37.0 37.0 37.0 37.0 37.0 65-69 36.36409999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.2351 37.0 37.0 37.0 37.0 37.0 75-79 36.2282 37.0 37.0 37.0 37.0 37.0 80-84 36.252700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2767 37.0 37.0 37.0 37.0 37.0 90-94 36.1786 37.0 37.0 37.0 37.0 37.0 95-99 36.1762 37.0 37.0 37.0 37.0 37.0 100-104 36.185 37.0 37.0 37.0 37.0 37.0 105-109 36.1332 37.0 37.0 37.0 37.0 37.0 110-114 36.1072 37.0 37.0 37.0 37.0 37.0 115-119 36.075700000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0664 37.0 37.0 37.0 37.0 37.0 125-129 36.0672 37.0 37.0 37.0 37.0 37.0 130-134 35.9754 37.0 37.0 37.0 37.0 37.0 135-139 35.9317 37.0 37.0 37.0 37.0 37.0 140-144 35.922 37.0 37.0 37.0 37.0 37.0 145-149 35.7653 37.0 37.0 37.0 37.0 37.0 150-151 35.34 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 3.0 27 11.0 28 13.0 29 15.0 30 22.0 31 47.0 32 48.0 33 82.0 34 123.0 35 330.0 36 2966.0 37 338.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.724999999999998 17.65 10.85 39.775 2 20.621398145828113 22.575795539964922 37.785016286644954 19.017790027562015 3 16.675 28.675 29.849999999999998 24.8 4 20.05 35.3 24.5 20.150000000000002 5 20.525 37.025000000000006 24.45 18.0 6 16.650000000000002 35.325 27.150000000000002 20.875 7 13.475000000000001 21.325 44.775 20.424999999999997 8 18.125 22.875 28.7 30.3 9 17.424999999999997 22.025 33.575 26.974999999999998 10-14 19.97 28.565 26.765 24.7 15-19 20.119999999999997 28.095 28.134999999999998 23.65 20-24 19.82 28.060000000000002 28.095 24.025 25-29 19.73 28.470000000000002 27.965 23.835 30-34 19.439999999999998 28.915000000000003 27.744999999999997 23.9 35-39 19.75 28.84 27.6 23.810000000000002 40-44 19.61 28.815 27.85 23.724999999999998 45-49 20.349999999999998 28.349999999999998 27.765 23.535 50-54 19.950000000000003 28.475 28.01 23.565 55-59 19.455 28.560000000000002 27.939999999999998 24.044999999999998 60-64 20.0 28.525 27.905 23.57 65-69 19.845 27.985 28.044999999999998 24.125 70-74 20.22 29.189999999999998 27.145000000000003 23.445 75-79 20.44 28.03 27.834999999999997 23.695 80-84 20.169999999999998 28.449999999999996 27.11 24.27 85-89 20.435 27.74 28.384999999999998 23.44 90-94 20.0 28.449999999999996 27.345000000000002 24.205 95-99 20.419999999999998 28.24 27.57 23.77 100-104 20.28 28.194999999999997 27.88 23.645 105-109 20.615 28.375 27.515 23.494999999999997 110-114 20.485 28.349999999999998 27.675 23.49 115-119 20.669999999999998 28.970000000000002 27.47 22.89 120-124 20.495 28.42 27.92 23.165 125-129 20.895 28.999999999999996 26.945000000000004 23.16 130-134 20.48 28.49 27.175 23.855 135-139 21.01 28.48 26.935 23.575 140-144 20.485 27.639999999999997 27.439999999999998 24.435000000000002 145-149 20.04 28.57 27.725 23.665 150-151 21.4 28.299999999999997 26.087500000000002 24.212500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.5 20 2.5 21 1.0 22 3.5 23 5.5 24 4.5 25 5.0 26 3.5 27 6.5 28 12.0 29 16.0 30 20.5 31 28.5 32 38.0 33 51.5 34 65.5 35 77.5 36 92.5 37 105.0 38 130.0 39 168.0 40 189.5 41 209.0 42 227.0 43 236.5 44 261.5 45 288.0 46 281.0 47 264.0 48 239.0 49 191.5 50 151.5 51 128.0 52 113.0 53 90.0 54 73.5 55 60.5 56 44.5 57 34.5 58 24.5 59 15.0 60 10.0 61 9.0 62 6.5 63 4.0 64 4.5 65 3.0 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.625 #Duplication Level Percentage of deduplicated Percentage of total 1 94.61030383091149 89.525 2 5.125495376486129 9.700000000000001 3 0.23778071334214002 0.675 4 0.02642007926023778 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.0499999999999998 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.3 0.0 0.0 0.0 0.0 122-123 1.4500000000000002 0.0 0.0 0.0 0.0 124-125 1.5499999999999998 0.0 0.0 0.0 0.0 126-127 1.7375 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.4125 0.0 0.0 0.0 0.0 134-135 2.5999999999999996 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138-139 3.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTGAA 10 0.006830828 145.0 9 >>END_MODULE SRR12671682 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671682_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.21 37.0 37.0 37.0 37.0 37.0 2 36.037 37.0 37.0 37.0 37.0 37.0 3 36.1825 37.0 37.0 37.0 37.0 37.0 4 36.099 37.0 37.0 37.0 37.0 37.0 5 36.2165 37.0 37.0 37.0 37.0 37.0 6 36.1255 37.0 37.0 37.0 37.0 37.0 7 36.1585 37.0 37.0 37.0 37.0 37.0 8 36.2445 37.0 37.0 37.0 37.0 37.0 9 36.223 37.0 37.0 37.0 37.0 37.0 10-14 36.2401 37.0 37.0 37.0 37.0 37.0 15-19 36.208600000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.15749999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.10170000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.1357 37.0 37.0 37.0 37.0 37.0 35-39 36.0915 37.0 37.0 37.0 37.0 37.0 40-44 36.044399999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.035900000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.0588 37.0 37.0 37.0 37.0 37.0 55-59 35.9964 37.0 37.0 37.0 37.0 37.0 60-64 35.92099999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.9316 37.0 37.0 37.0 37.0 37.0 70-74 35.9562 37.0 37.0 37.0 37.0 37.0 75-79 35.896 37.0 37.0 37.0 37.0 37.0 80-84 35.8881 37.0 37.0 37.0 37.0 37.0 85-89 35.7858 37.0 37.0 37.0 37.0 37.0 90-94 35.761900000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.8052 37.0 37.0 37.0 37.0 37.0 100-104 35.7248 37.0 37.0 37.0 37.0 37.0 105-109 35.7096 37.0 37.0 37.0 37.0 37.0 110-114 35.5961 37.0 37.0 37.0 37.0 37.0 115-119 35.668 37.0 37.0 37.0 37.0 37.0 120-124 35.6277 37.0 37.0 37.0 37.0 37.0 125-129 35.6222 37.0 37.0 37.0 37.0 37.0 130-134 35.5901 37.0 37.0 37.0 37.0 37.0 135-139 35.5343 37.0 37.0 37.0 37.0 37.0 140-144 35.2822 37.0 37.0 37.0 32.2 37.0 145-149 35.354499999999994 37.0 37.0 37.0 37.0 37.0 150-151 34.84025 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 3.0 21 4.0 22 0.0 23 3.0 24 6.0 25 8.0 26 5.0 27 14.0 28 18.0 29 21.0 30 35.0 31 58.0 32 76.0 33 107.0 34 212.0 35 586.0 36 2645.0 37 195.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.375 19.75 13.775 33.1 2 25.8 24.0 35.825 14.374999999999998 3 18.099999999999998 28.625 32.5 20.775 4 21.175 36.85 22.3 19.675 5 22.85 37.9 21.85 17.4 6 19.125 38.2 22.3 20.375 7 17.474999999999998 18.175 43.8 20.549999999999997 8 19.975 23.65 28.199999999999996 28.175 9 20.775 23.525 30.025000000000002 25.674999999999997 10-14 22.36 27.66 27.35 22.63 15-19 22.925 28.465 27.92 20.69 20-24 21.945 29.104999999999997 27.565 21.385 25-29 22.42 28.560000000000002 28.249999999999996 20.77 30-34 22.545 28.075 28.49 20.89 35-39 22.865 27.794999999999998 28.389999999999997 20.95 40-44 22.48 28.23 28.360000000000003 20.93 45-49 22.62 28.105000000000004 27.875 21.4 50-54 22.49 27.77 28.42 21.32 55-59 22.625 28.27 27.99 21.115000000000002 60-64 22.41 27.750000000000004 28.199999999999996 21.64 65-69 22.84 27.939999999999998 27.595 21.625 70-74 22.32 27.82 28.27 21.59 75-79 23.275000000000002 27.88 27.33 21.515 80-84 23.14 28.4 27.625 20.835 85-89 23.49 27.72 28.384999999999998 20.405 90-94 22.84 27.950000000000003 28.22 20.990000000000002 95-99 23.415 27.765 27.67 21.15 100-104 23.32 27.97 27.61 21.099999999999998 105-109 23.605 27.815 27.93 20.65 110-114 23.325000000000003 28.22 27.29 21.165 115-119 23.775 27.79 28.044999999999998 20.39 120-124 23.525 28.155 27.529999999999998 20.79 125-129 23.59 28.43 27.82 20.16 130-134 24.52 27.384999999999998 27.6 20.495 135-139 23.945 27.150000000000002 28.21 20.695 140-144 23.815 27.525 27.465 21.195 145-149 23.86 27.655 27.72 20.765 150-151 23.9875 28.000000000000004 27.6 20.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.5 20 1.0 21 2.0 22 2.0 23 1.0 24 2.5 25 4.5 26 4.5 27 4.5 28 6.0 29 15.0 30 22.5 31 22.0 32 28.0 33 45.5 34 57.0 35 69.5 36 94.0 37 112.5 38 146.0 39 174.5 40 198.5 41 221.5 42 231.0 43 262.5 44 271.5 45 263.0 46 272.0 47 248.0 48 213.0 49 201.0 50 169.5 51 125.0 52 103.0 53 88.5 54 76.5 55 57.5 56 48.5 57 44.5 58 25.5 59 17.0 60 12.0 61 9.5 62 8.0 63 4.0 64 1.5 65 0.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.65 #Duplication Level Percentage of deduplicated Percentage of total 1 94.77020602218701 89.7 2 4.886423666138405 9.25 3 0.29054410987849977 0.8250000000000001 4 0.02641310089804543 0.1 5 0.02641310089804543 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.0499999999999998 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.3 0.0 0.0 0.0 0.0 122-123 1.4500000000000002 0.0 0.0 0.0 0.0 124-125 1.5499999999999998 0.0 0.0 0.0 0.0 126-127 1.7625 0.0 0.0 0.0 0.0 128-129 1.9375 0.0 0.0 0.0 0.0 130-131 2.225 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.625 0.0 0.0 0.0 0.0 136-137 2.8375 0.0 0.0 0.0 0.0 138-139 3.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895730 spots for SRR12671682.sra Written 895730 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra Read 895725 spots for SRR12671682.sra Written 895725 spots for SRR12671682.sra SRR ids: ['SRR12671682.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nd3mcczy SRR12671682.sra spots: 17914505 blocks: [[1, 895725], [895726, 1791450], [1791451, 2687175], [2687176, 3582900], [3582901, 4478625], [4478626, 5374350], [5374351, 6270075], [6270076, 7165800], [7165801, 8061525], [8061526, 8957250], [8957251, 9852975], [9852976, 10748700], [10748701, 11644425], [11644426, 12540150], [12540151, 13435875], [13435876, 14331600], [14331601, 15227325], [15227326, 16123050], [16123051, 17018775], [17018776, 17914505]] SRR12671682 file size 6066432 SRR12671682 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671682 SRR12671682_1.fastq SRR12671682_2.fastq Input file: SRR12671682_1.fastq Paired file: SRR12671682_2.fastq trimmed: SRR12671682-trimmed-pair1.fastq, SRR12671682-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:59:13 2025 >> started Wed Feb 12 02:59:32 2025 >> done (19.536s) 17914505 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 1704 ( 0.01%) empty read pairs filtered out after trimming by size control 17912782 (99.99%) read pairs available; of these: 805620 ( 4.50%) trimmed read pairs available after processing 17107162 (95.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 2 0.00% 25 8 0.00% 26 5 0.00% 27 6 0.00% 28 9 0.00% 29 6 0.00% 30 13 0.00% 31 8 0.00% 32 6 0.00% 33 10 0.00% 34 11 0.00% 35 14 0.00% 36 12 0.00% 37 12 0.00% 38 14 0.00% 39 19 0.00% 40 18 0.00% 41 20 0.00% 42 32 0.00% 43 34 0.00% 44 25 0.00% 45 22 0.00% 46 40 0.00% 47 55 0.00% 48 32 0.00% 49 36 0.00% 50 44 0.00% 51 53 0.00% 52 63 0.00% 53 57 0.00% 54 63 0.00% 55 61 0.00% 56 58 0.00% 57 82 0.00% 58 87 0.00% 59 105 0.00% 60 128 0.00% 61 123 0.00% 62 127 0.00% 63 156 0.00% 64 179 0.00% 65 149 0.00% 66 174 0.00% 67 166 0.00% 68 184 0.00% 69 212 0.00% 70 291 0.00% 71 309 0.00% 72 351 0.00% 73 409 0.00% 74 460 0.00% 75 500 0.00% 76 528 0.00% 77 564 0.00% 78 599 0.00% 79 645 0.00% 80 697 0.00% 81 855 0.00% 82 988 0.01% 83 1139 0.01% 84 1280 0.01% 85 1259 0.01% 86 1434 0.01% 87 1595 0.01% 88 1575 0.01% 89 1792 0.01% 90 1907 0.01% 91 2137 0.01% 92 2423 0.01% 93 2785 0.02% 94 2956 0.02% 95 3189 0.02% 96 3430 0.02% 97 3411 0.02% 98 3597 0.02% 99 3764 0.02% 100 3993 0.02% 101 4479 0.03% 102 4761 0.03% 103 5270 0.03% 104 5634 0.03% 105 6030 0.03% 106 6160 0.03% 107 6461 0.04% 108 6610 0.04% 109 6710 0.04% 110 7081 0.04% 111 7592 0.04% 112 8055 0.04% 113 8660 0.05% 114 9437 0.05% 115 9965 0.06% 116 10091 0.06% 117 10540 0.06% 118 10531 0.06% 119 10990 0.06% 120 11051 0.06% 121 11677 0.07% 122 12129 0.07% 123 13378 0.07% 124 13710 0.08% 125 14312 0.08% 126 15136 0.08% 127 15350 0.09% 128 15522 0.09% 129 15629 0.09% 130 15736 0.09% 131 16477 0.09% 132 17488 0.10% 133 18250 0.10% 134 19173 0.11% 135 19990 0.11% 136 20419 0.11% 137 20915 0.12% 138 21056 0.12% 139 21328 0.12% 140 21278 0.12% 141 21809 0.12% 142 22887 0.13% 143 23792 0.13% 144 24937 0.14% 145 26590 0.15% 146 26992 0.15% 147 27084 0.15% 148 27648 0.15% 149 27449 0.15% 150 27755 0.15% 151 17107162 95.50% 17912782 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=25 prefix-density=0.37 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=28.68 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.9 sequence=AATTTTATTGCGCATACAGAGATTACATAACTCCGAATAAAAAGACTACAAAACGTTCATAGGTAACATTTACAGGATTGCAATAGTACTAAAGGAAACCTGTAGCATATGCATATCTGCCATGGCTCACTCGGAGCTTTTATTTAATTTCCAACGACCATATAATTACATTGGTAATGGAAATGAAAGTAATAGATAGCCCTGGTGCTTTGAGCTCACAGCTTTTACCACTAGATAATGGACCCAAATCAAACTACTCTTTCATTTTCAAGGGCGATGGCAGCTACGCTTGTAAGGATTACAAGGTTTTTTCTTAGGACAATCTCGTTGGTAAATGCTACATCCACTGCCAGTTCGTGGGGCATAGGTAGGAGGCTGGCTTCTAGATGATACATCGCCAGTTGATGGGATATTGACGGTAACGCTATCTTTTCCATAGTCGACCAATTCTCGA criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=29 prefix-density=0.49 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=28.38 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=7.9 sequence=CAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR12671682 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:00:17 Started mapping on | Feb 12 03:00:17 Finished on | Feb 12 03:02:17 Mapping speed, Million of reads per hour | 537.38 Number of input reads | 17912782 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 16652020 Uniquely mapped reads % | 92.96% Average mapped length | 298.59 Number of splices: Total | 16755434 Number of splices: Annotated (sjdb) | 16380850 Number of splices: GT/AG | 16421370 Number of splices: GC/AG | 267871 Number of splices: AT/AC | 10911 Number of splices: Non-canonical | 55282 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 481066 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 62721 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.91% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 779696 779696 779696 N_multimapping 481066 481066 481066 N_noFeature 621105 16433254 691118 N_ambiguous 271357 960 122055 UnstrandedReadsAssigned:15759558 PositiveStrandReadsAssigned:217806 NegativeStrandReadsAssigned:15838847 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671682 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671682-trimmed-pair1.fastq SRR12671682-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,912,782 reads, 15,804,759 reads pseudoaligned [quant] estimated average fragment length: 312.761 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR12671682.ke.tsv 34699 SRR12671682.se.tsv 87100 total ==> SRR12671682.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1706.24 1022 37.9318 Potri.005G024800.1.v4.1 1035 723.239 453 39.6651 Potri.004G059700.1.v4.1 961 649.943 2 0.194871 Potri.007G009000.2.v4.1 1416 1104.24 0 0 Potri.003G141000.2.v4.1 2943 2631.24 984.782 23.7013 Potri.016G087400.1.v4.1 270 72.4705 873 762.86 Potri.015G069301.1.v4.1 564 284.144 0 0 Potri.010G195200.1.v4.1 1773 1461.24 505.732 21.9175 Potri.012G127500.1.v4.1 977 665.636 147 13.9853 ==> SRR12671682.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 204 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 181 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 39 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671682 completed mapping pipeline successfully