Starting /dee2/code/volunteer_pipeline.sh SRR12671683 current disk space = 3048976449536 free memory = 1429330892 SRR12671683 SRAfilesize 0d60ffec1d88a7300a05828c82b74308 SRR12671683.sra SRR12671683.sra file validated SRR12671683 is paired end SRR12671683 is conventional basespace SRR12671683 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671683_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.425 37.0 37.0 37.0 37.0 37.0 2 36.314 37.0 37.0 37.0 37.0 37.0 3 36.5365 37.0 37.0 37.0 37.0 37.0 4 36.5385 37.0 37.0 37.0 37.0 37.0 5 36.646 37.0 37.0 37.0 37.0 37.0 6 36.487 37.0 37.0 37.0 37.0 37.0 7 36.5025 37.0 37.0 37.0 37.0 37.0 8 36.5365 37.0 37.0 37.0 37.0 37.0 9 36.5825 37.0 37.0 37.0 37.0 37.0 10-14 36.564499999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5766 37.0 37.0 37.0 37.0 37.0 20-24 36.53320000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.489700000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.5 37.0 37.0 37.0 37.0 37.0 35-39 36.4505 37.0 37.0 37.0 37.0 37.0 40-44 36.443799999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3989 37.0 37.0 37.0 37.0 37.0 50-54 36.3962 37.0 37.0 37.0 37.0 37.0 55-59 36.3566 37.0 37.0 37.0 37.0 37.0 60-64 36.3836 37.0 37.0 37.0 37.0 37.0 65-69 36.3019 37.0 37.0 37.0 37.0 37.0 70-74 36.2959 37.0 37.0 37.0 37.0 37.0 75-79 36.240300000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.31420000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.2617 37.0 37.0 37.0 37.0 37.0 90-94 36.2386 37.0 37.0 37.0 37.0 37.0 95-99 36.1244 37.0 37.0 37.0 37.0 37.0 100-104 36.1881 37.0 37.0 37.0 37.0 37.0 105-109 36.119600000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.150099999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.154999999999994 37.0 37.0 37.0 37.0 37.0 120-124 36.0561 37.0 37.0 37.0 37.0 37.0 125-129 36.0307 37.0 37.0 37.0 37.0 37.0 130-134 35.9762 37.0 37.0 37.0 37.0 37.0 135-139 35.9646 37.0 37.0 37.0 37.0 37.0 140-144 35.8575 37.0 37.0 37.0 37.0 37.0 145-149 35.7884 37.0 37.0 37.0 37.0 37.0 150-151 35.258250000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 1.0 26 3.0 27 8.0 28 10.0 29 28.0 30 21.0 31 39.0 32 36.0 33 81.0 34 118.0 35 321.0 36 2966.0 37 366.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.35 15.75 7.6 40.300000000000004 2 18.778167250876315 20.681021532298445 41.08662994491738 19.45418127190786 3 16.900000000000002 26.700000000000003 28.375 28.025 4 22.2 33.7 22.825 21.275 5 20.25 37.35 24.425 17.974999999999998 6 16.575 36.5 25.974999999999998 20.95 7 13.05 19.875 46.650000000000006 20.424999999999997 8 17.224999999999998 21.099999999999998 31.85 29.825000000000003 9 16.900000000000002 21.45 33.375 28.275 10-14 19.785 28.235 27.655 24.325 15-19 19.56 27.805000000000003 28.355000000000004 24.279999999999998 20-24 20.015 28.175 28.435 23.375 25-29 19.945 28.685 27.589999999999996 23.78 30-34 20.13 28.425 28.07 23.375 35-39 19.825 28.87 27.794999999999998 23.51 40-44 19.99 28.88 27.345000000000002 23.785 45-49 19.905 28.425 27.765 23.905 50-54 19.395 29.099999999999998 27.82 23.685000000000002 55-59 19.925 28.725 27.700000000000003 23.65 60-64 20.11 28.075 28.189999999999998 23.625 65-69 20.03 28.065 28.044999999999998 23.86 70-74 19.93 28.62 27.63 23.82 75-79 20.474999999999998 28.044999999999998 27.744999999999997 23.735 80-84 20.1 28.09 27.965 23.845 85-89 20.880000000000003 28.27 27.365000000000002 23.485 90-94 20.23 28.305000000000003 28.065 23.400000000000002 95-99 20.580000000000002 28.310000000000002 27.544999999999998 23.565 100-104 20.815 27.63 28.215 23.34 105-109 21.044999999999998 27.700000000000003 28.275 22.98 110-114 21.385 28.384999999999998 27.084999999999997 23.145 115-119 20.945 29.085 26.75 23.22 120-124 20.32 28.389999999999997 27.595 23.695 125-129 21.09 28.415000000000003 27.24 23.255 130-134 21.38 28.67 26.810000000000002 23.14 135-139 21.535 28.749999999999996 26.47 23.244999999999997 140-144 20.915 28.27 26.995 23.82 145-149 21.490000000000002 28.76 26.115 23.635 150-151 20.974999999999998 28.675 26.137500000000003 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 2.0 24 2.5 25 2.5 26 5.0 27 7.0 28 10.0 29 16.5 30 25.0 31 31.0 32 34.5 33 48.5 34 65.5 35 73.5 36 81.5 37 106.5 38 145.5 39 169.0 40 192.5 41 225.5 42 245.5 43 259.5 44 271.0 45 269.0 46 249.0 47 244.0 48 230.0 49 199.5 50 172.0 51 137.0 52 110.0 53 87.0 54 66.0 55 47.0 56 39.0 57 38.5 58 30.5 59 19.5 60 11.5 61 8.5 62 6.0 63 4.5 64 3.5 65 2.0 66 1.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.90630773291106 89.9 2 4.697809448403273 8.9 3 0.3167062549485352 0.8999999999999999 4 0.0791765637371338 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.6125 0.0 0.0 0.0 0.0 112-113 3.05 0.0 0.0 0.0 0.0 114-115 3.45 0.0 0.0 0.0 0.0 116-117 3.8499999999999996 0.0 0.0 0.0 0.0 118-119 4.1875 0.0 0.0 0.0 0.0 120-121 4.5375 0.0 0.0 0.0 0.0 122-123 5.0625 0.0 0.0 0.0 0.0 124-125 5.625 0.0 0.0 0.0 0.0 126-127 6.0625 0.0 0.0 0.0 0.0 128-129 6.8125 0.0 0.0 0.0 0.0 130-131 7.5875 0.0 0.0 0.0 0.0 132-133 8.1625 0.0 0.0 0.0 0.0 134-135 8.825 0.0 0.0 0.0 0.0 136-137 9.5125 0.0 0.0 0.0 0.0 138-139 10.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACTC 10 0.006830828 145.0 9 AATGCCT 10 0.006830828 145.0 3 CTACATT 10 0.006830828 145.0 1 >>END_MODULE SRR12671683 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671683_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3565 37.0 37.0 37.0 37.0 37.0 2 36.3245 37.0 37.0 37.0 37.0 37.0 3 36.386 37.0 37.0 37.0 37.0 37.0 4 36.294 37.0 37.0 37.0 37.0 37.0 5 36.4815 37.0 37.0 37.0 37.0 37.0 6 36.3915 37.0 37.0 37.0 37.0 37.0 7 36.4445 37.0 37.0 37.0 37.0 37.0 8 36.4385 37.0 37.0 37.0 37.0 37.0 9 36.433 37.0 37.0 37.0 37.0 37.0 10-14 36.4397 37.0 37.0 37.0 37.0 37.0 15-19 36.412699999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.370000000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.333999999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.294200000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.298500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.3008 37.0 37.0 37.0 37.0 37.0 45-49 36.245 37.0 37.0 37.0 37.0 37.0 50-54 36.2293 37.0 37.0 37.0 37.0 37.0 55-59 36.2512 37.0 37.0 37.0 37.0 37.0 60-64 36.1672 37.0 37.0 37.0 37.0 37.0 65-69 36.0978 37.0 37.0 37.0 37.0 37.0 70-74 36.1611 37.0 37.0 37.0 37.0 37.0 75-79 36.042 37.0 37.0 37.0 37.0 37.0 80-84 36.1066 37.0 37.0 37.0 37.0 37.0 85-89 36.05 37.0 37.0 37.0 37.0 37.0 90-94 36.0396 37.0 37.0 37.0 37.0 37.0 95-99 36.0704 37.0 37.0 37.0 37.0 37.0 100-104 35.948 37.0 37.0 37.0 37.0 37.0 105-109 35.881099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.879900000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.8663 37.0 37.0 37.0 37.0 37.0 120-124 35.8471 37.0 37.0 37.0 37.0 37.0 125-129 35.7162 37.0 37.0 37.0 37.0 37.0 130-134 35.736900000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.5941 37.0 37.0 37.0 37.0 37.0 140-144 35.4418 37.0 37.0 37.0 37.0 37.0 145-149 35.4208 37.0 37.0 37.0 34.6 37.0 150-151 34.914249999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 3.0 21 0.0 22 0.0 23 3.0 24 4.0 25 8.0 26 9.0 27 8.0 28 11.0 29 16.0 30 24.0 31 35.0 32 51.0 33 85.0 34 167.0 35 509.0 36 2760.0 37 303.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.275 19.35 11.275 31.1 2 22.8 26.05 36.199999999999996 14.95 3 19.45 26.700000000000003 32.074999999999996 21.775 4 24.075 36.025 21.25 18.65 5 24.275 37.275000000000006 21.05 17.4 6 17.95 39.900000000000006 23.45 18.7 7 18.175 17.849999999999998 42.8 21.175 8 19.625 21.7 29.349999999999998 29.325000000000003 9 20.875 23.825 29.099999999999998 26.200000000000003 10-14 22.27 28.470000000000002 26.895000000000003 22.365 15-19 22.05 28.32 28.175 21.455 20-24 22.03 28.38 28.615000000000002 20.974999999999998 25-29 23.01 28.000000000000004 27.975 21.015 30-34 22.31 28.33 28.115000000000002 21.245 35-39 22.02 28.144999999999996 28.720000000000002 21.115000000000002 40-44 21.990000000000002 28.835 28.16 21.015 45-49 22.685 28.67 28.084999999999997 20.560000000000002 50-54 22.0 28.29 28.065 21.645 55-59 22.355 28.360000000000003 28.115000000000002 21.17 60-64 22.225 27.529999999999998 28.389999999999997 21.855 65-69 23.215 28.000000000000004 27.97 20.815 70-74 23.305 28.29 27.29 21.115000000000002 75-79 23.16 27.735 27.700000000000003 21.404999999999998 80-84 23.175 27.689999999999998 27.525 21.61 85-89 22.735 27.725 27.875 21.665 90-94 23.275000000000002 27.900000000000002 27.655 21.17 95-99 22.78 28.28 27.565 21.375 100-104 23.53 28.16 27.76 20.549999999999997 105-109 23.91 27.68 28.185 20.225 110-114 23.955000000000002 28.395 26.950000000000003 20.7 115-119 24.095 28.144999999999996 27.689999999999998 20.07 120-124 24.154999999999998 27.575 27.51 20.76 125-129 24.785 27.61 27.700000000000003 19.905 130-134 25.435000000000002 27.450000000000003 27.250000000000004 19.865 135-139 25.545 28.375 26.35 19.73 140-144 25.790000000000003 28.299999999999997 26.009999999999998 19.900000000000002 145-149 27.0 27.800000000000004 26.13 19.07 150-151 27.400000000000002 27.35 25.8625 19.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 1.5 22 0.0 23 1.0 24 4.5 25 7.5 26 9.0 27 8.5 28 9.5 29 11.5 30 12.0 31 23.0 32 35.5 33 39.0 34 47.5 35 66.5 36 98.5 37 111.5 38 120.0 39 153.5 40 195.5 41 220.5 42 247.0 43 268.5 44 283.5 45 294.5 46 264.0 47 242.0 48 229.0 49 210.0 50 174.5 51 129.0 52 103.0 53 91.5 54 74.0 55 53.0 56 43.0 57 34.0 58 23.5 59 16.5 60 11.0 61 6.0 62 5.0 63 2.5 64 1.0 65 2.5 66 3.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.625 #Duplication Level Percentage of deduplicated Percentage of total 1 94.92734478203435 89.825 2 4.597093791281374 8.7 3 0.3963011889035667 1.125 4 0.05284015852047556 0.2 5 0.0 0.0 6 0.02642007926023778 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.8625 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.6624999999999996 0.0 0.0 0.0 0.0 112-113 3.1 0.0 0.0 0.0 0.0 114-115 3.5250000000000004 0.0 0.0 0.0 0.0 116-117 3.925 0.0 0.0 0.0 0.0 118-119 4.2625 0.0 0.0 0.0 0.0 120-121 4.625 0.0 0.0 0.0 0.0 122-123 5.2125 0.0 0.0 0.0 0.0 124-125 5.7875 0.0 0.0 0.0 0.0 126-127 6.25 0.0 0.0 0.0 0.0 128-129 7.0 0.0 0.0 0.0 0.0 130-131 7.7375 0.0 0.0 0.0 0.0 132-133 8.2875 0.0 0.0 0.0 0.0 134-135 8.9625 0.0 0.0 0.0 0.0 136-137 9.6375 0.0 0.0 0.0 0.0 138-139 10.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTAGTC 10 0.006830828 145.0 9 GAAACAT 10 0.006830828 145.0 1 TGATCTG 10 0.006830828 145.0 3 ACATTGC 10 0.006830828 145.0 4 ATTGCTA 10 0.006830828 145.0 6 GTCTCAT 10 0.006830828 145.0 1 TGCTAGT 10 0.006830828 145.0 8 TTGCTAG 10 0.006830828 145.0 7 GCCCTGA 10 0.006830828 145.0 145 TTTTTTT 65 0.0076375785 13.384615 100-104 >>END_MODULE Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra Read 1081094 spots for SRR12671683.sra Written 1081094 spots for SRR12671683.sra Read 1081082 spots for SRR12671683.sra Written 1081082 spots for SRR12671683.sra SRR ids: ['SRR12671683.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kwabippu SRR12671683.sra spots: 21621652 blocks: [[1, 1081082], [1081083, 2162164], [2162165, 3243246], [3243247, 4324328], [4324329, 5405410], [5405411, 6486492], [6486493, 7567574], [7567575, 8648656], [8648657, 9729738], [9729739, 10810820], [10810821, 11891902], [11891903, 12972984], [12972985, 14054066], [14054067, 15135148], [15135149, 16216230], [16216231, 17297312], [17297313, 18378394], [18378395, 19459476], [19459477, 20540558], [20540559, 21621652]] SRR12671683 file size 7326282 SRR12671683 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671683 SRR12671683_1.fastq SRR12671683_2.fastq Input file: SRR12671683_1.fastq Paired file: SRR12671683_2.fastq trimmed: SRR12671683-trimmed-pair1.fastq, SRR12671683-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:50:56 2025 >> started Wed Feb 12 02:51:30 2025 >> done (33.599s) 21621652 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 5183 ( 0.02%) empty read pairs filtered out after trimming by size control 21616446 (99.98%) read pairs available; of these: 2885544 (13.35%) trimmed read pairs available after processing 18730902 (86.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 4 0.00% 24 6 0.00% 25 8 0.00% 26 3 0.00% 27 6 0.00% 28 10 0.00% 29 10 0.00% 30 8 0.00% 31 11 0.00% 32 22 0.00% 33 21 0.00% 34 21 0.00% 35 20 0.00% 36 18 0.00% 37 26 0.00% 38 35 0.00% 39 45 0.00% 40 46 0.00% 41 42 0.00% 42 61 0.00% 43 69 0.00% 44 67 0.00% 45 63 0.00% 46 59 0.00% 47 75 0.00% 48 95 0.00% 49 119 0.00% 50 135 0.00% 51 140 0.00% 52 161 0.00% 53 167 0.00% 54 181 0.00% 55 183 0.00% 56 238 0.00% 57 246 0.00% 58 257 0.00% 59 284 0.00% 60 369 0.00% 61 407 0.00% 62 492 0.00% 63 567 0.00% 64 576 0.00% 65 624 0.00% 66 621 0.00% 67 738 0.00% 68 865 0.00% 69 1030 0.00% 70 1120 0.01% 71 1303 0.01% 72 1474 0.01% 73 1759 0.01% 74 1892 0.01% 75 2156 0.01% 76 2487 0.01% 77 2563 0.01% 78 2881 0.01% 79 3335 0.02% 80 3636 0.02% 81 4152 0.02% 82 4685 0.02% 83 5163 0.02% 84 6006 0.03% 85 6492 0.03% 86 7186 0.03% 87 7655 0.04% 88 8377 0.04% 89 9107 0.04% 90 10027 0.05% 91 10798 0.05% 92 11782 0.05% 93 13318 0.06% 94 14535 0.07% 95 15522 0.07% 96 16712 0.08% 97 17551 0.08% 98 18398 0.09% 99 19470 0.09% 100 20532 0.09% 101 21931 0.10% 102 23489 0.11% 103 24880 0.12% 104 26321 0.12% 105 27886 0.13% 106 28905 0.13% 107 30065 0.14% 108 31756 0.15% 109 32796 0.15% 110 33647 0.16% 111 35233 0.16% 112 37000 0.17% 113 37703 0.17% 114 39970 0.18% 115 41610 0.19% 116 42525 0.20% 117 43739 0.20% 118 44841 0.21% 119 45487 0.21% 120 47066 0.22% 121 48668 0.23% 122 49543 0.23% 123 51119 0.24% 124 53252 0.25% 125 54398 0.25% 126 55255 0.26% 127 56045 0.26% 128 56696 0.26% 129 57979 0.27% 130 58512 0.27% 131 59399 0.27% 132 61234 0.28% 133 63480 0.29% 134 63856 0.30% 135 65209 0.30% 136 65865 0.30% 137 65948 0.31% 138 67695 0.31% 139 68994 0.32% 140 67926 0.31% 141 69780 0.32% 142 71130 0.33% 143 71509 0.33% 144 74191 0.34% 145 74113 0.34% 146 74903 0.35% 147 75090 0.35% 148 75311 0.35% 149 74612 0.35% 150 75649 0.35% 151 18730902 86.65% 21616446 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=23 prefix-density=0.57 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=488.61 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=17.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=29 prefix-density=0.65 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=38.84 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=12.1 sequence=AAGGCCAAGATCCAGGACAAGGA SRR12671683 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:52:16 Started mapping on | Feb 12 02:52:16 Finished on | Feb 12 02:54:31 Mapping speed, Million of reads per hour | 576.44 Number of input reads | 21616446 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 20289721 Uniquely mapped reads % | 93.86% Average mapped length | 294.05 Number of splices: Total | 20238299 Number of splices: Annotated (sjdb) | 19772500 Number of splices: GT/AG | 19833643 Number of splices: GC/AG | 311052 Number of splices: AT/AC | 13120 Number of splices: Non-canonical | 80484 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 556140 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 72653 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 770585 770585 770585 N_multimapping 556140 556140 556140 N_noFeature 764498 19950158 885164 N_ambiguous 365292 1432 145537 UnstrandedReadsAssigned:19159931 PositiveStrandReadsAssigned:338131 NegativeStrandReadsAssigned:19259020 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671683 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671683-trimmed-pair1.fastq SRR12671683-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,616,446 reads, 19,175,390 reads pseudoaligned [quant] estimated average fragment length: 259.738 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR12671683.ke.tsv 34699 SRR12671683.se.tsv 87100 total ==> SRR12671683.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.26 1291 36.1652 Potri.005G024800.1.v4.1 1035 776.262 176 11.1738 Potri.004G059700.1.v4.1 961 702.702 0 0 Potri.007G009000.2.v4.1 1416 1157.26 0 0 Potri.003G141000.2.v4.1 2943 2684.26 813.343 14.9329 Potri.016G087400.1.v4.1 270 90.9609 944 511.461 Potri.015G069301.1.v4.1 564 325.52 0 0 Potri.010G195200.1.v4.1 1773 1514.26 168.938 5.49822 Potri.012G127500.1.v4.1 977 718.487 239 16.3936 ==> SRR12671683.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 297 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 136 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 16 SRR12671683 completed mapping pipeline successfully