Starting /dee2/code/volunteer_pipeline.sh SRR12671684 current disk space = 3049154318336 free memory = 1489472808 SRR12671684 SRAfilesize c3a3fbd20d062ce1e968b5afbf426729 SRR12671684.sra SRR12671684.sra file validated SRR12671684 is paired end SRR12671684 is conventional basespace SRR12671684 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671684_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.301 37.0 37.0 37.0 37.0 37.0 2 36.12475 37.0 37.0 37.0 37.0 37.0 3 36.4345 37.0 37.0 37.0 37.0 37.0 4 36.515 37.0 37.0 37.0 37.0 37.0 5 36.476 37.0 37.0 37.0 37.0 37.0 6 36.488 37.0 37.0 37.0 37.0 37.0 7 36.4745 37.0 37.0 37.0 37.0 37.0 8 36.536 37.0 37.0 37.0 37.0 37.0 9 36.6085 37.0 37.0 37.0 37.0 37.0 10-14 36.5253 37.0 37.0 37.0 37.0 37.0 15-19 36.509699999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5076 37.0 37.0 37.0 37.0 37.0 25-29 36.490199999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.482299999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.431 37.0 37.0 37.0 37.0 37.0 40-44 36.4172 37.0 37.0 37.0 37.0 37.0 45-49 36.3713 37.0 37.0 37.0 37.0 37.0 50-54 36.332499999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.354200000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.3914 37.0 37.0 37.0 37.0 37.0 65-69 36.328599999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.2945 37.0 37.0 37.0 37.0 37.0 75-79 36.2693 37.0 37.0 37.0 37.0 37.0 80-84 36.2685 37.0 37.0 37.0 37.0 37.0 85-89 36.267799999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.2473 37.0 37.0 37.0 37.0 37.0 95-99 36.143 37.0 37.0 37.0 37.0 37.0 100-104 36.1841 37.0 37.0 37.0 37.0 37.0 105-109 36.082899999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.130399999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.086 37.0 37.0 37.0 37.0 37.0 120-124 36.0278 37.0 37.0 37.0 37.0 37.0 125-129 35.9964 37.0 37.0 37.0 37.0 37.0 130-134 35.9058 37.0 37.0 37.0 37.0 37.0 135-139 35.9323 37.0 37.0 37.0 37.0 37.0 140-144 35.879400000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.7716 37.0 37.0 37.0 37.0 37.0 150-151 35.283500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 0.0 25 0.0 26 4.0 27 5.0 28 11.0 29 19.0 30 27.0 31 35.0 32 45.0 33 88.0 34 134.0 35 365.0 36 2919.0 37 347.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.474999999999998 14.399999999999999 12.725 41.4 2 19.51770911831198 21.15046470735996 38.33207736749561 20.999748806832454 3 17.75 25.6 27.450000000000003 29.2 4 21.7 34.125 22.5 21.675 5 20.65 36.725 23.974999999999998 18.65 6 15.9 37.45 26.325 20.325 7 12.625 20.875 45.875 20.625 8 19.075 22.775000000000002 29.25 28.9 9 17.375 23.25 33.625 25.75 10-14 19.395 28.675 26.979999999999997 24.95 15-19 18.755 28.07 28.48 24.695 20-24 19.275000000000002 28.625 28.615000000000002 23.485 25-29 19.72 28.705000000000002 27.87 23.705000000000002 30-34 19.535 28.660000000000004 27.855 23.95 35-39 19.7 28.000000000000004 28.52 23.78 40-44 19.45 28.884999999999998 28.22 23.445 45-49 19.515 28.52 27.555000000000003 24.41 50-54 19.685 28.51 28.095 23.71 55-59 19.645000000000003 29.21 27.005000000000003 24.14 60-64 20.09 28.205000000000002 27.675 24.03 65-69 20.47 28.595 27.38 23.555 70-74 19.86 28.815 27.35 23.974999999999998 75-79 20.119999999999997 28.884999999999998 27.74 23.255 80-84 20.565 28.455000000000002 27.525 23.455000000000002 85-89 20.685000000000002 27.775 28.055000000000003 23.485 90-94 19.655 28.73 28.225 23.39 95-99 20.125 27.715 28.485 23.674999999999997 100-104 19.900000000000002 28.345 28.310000000000002 23.445 105-109 20.05 27.834999999999997 28.15 23.965 110-114 20.685000000000002 28.455000000000002 27.655 23.205000000000002 115-119 19.75 28.470000000000002 27.894999999999996 23.885 120-124 20.235 28.110000000000003 27.725 23.93 125-129 20.615 28.055000000000003 28.134999999999998 23.195 130-134 20.14 28.939999999999998 27.389999999999997 23.53 135-139 20.605 28.294999999999998 27.445000000000004 23.655 140-144 20.955 27.74 27.6 23.705000000000002 145-149 20.255000000000003 28.655 27.560000000000002 23.53 150-151 21.087500000000002 27.2625 27.8875 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 2.0 22 2.5 23 2.0 24 2.0 25 3.5 26 6.5 27 6.5 28 4.5 29 7.5 30 17.0 31 29.0 32 37.0 33 45.5 34 55.5 35 76.5 36 108.0 37 131.0 38 151.0 39 173.5 40 201.5 41 219.0 42 236.5 43 257.5 44 280.5 45 287.0 46 257.0 47 225.5 48 208.5 49 196.0 50 171.0 51 148.5 52 115.0 53 79.5 54 65.5 55 51.5 56 35.0 57 24.0 58 19.0 59 15.5 60 14.0 61 8.5 62 4.0 63 4.5 64 4.0 65 2.0 66 0.5 67 2.5 68 2.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.375 #Duplication Level Percentage of deduplicated Percentage of total 1 93.52074966532797 87.325 2 5.943775100401607 11.1 3 0.48192771084337355 1.35 4 0.02677376171352075 0.1 5 0.02677376171352075 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.025 0.025 0.0 0.0 0.0 78-79 0.025 0.025 0.0 0.0 0.0 80-81 0.025 0.025 0.0 0.0 0.0 82-83 0.075 0.025 0.0 0.0 0.0 84-85 0.075 0.025 0.0 0.0 0.0 86-87 0.0875 0.025 0.0 0.0 0.0 88-89 0.1125 0.025 0.0 0.0 0.0 90-91 0.125 0.025 0.0 0.0 0.0 92-93 0.15 0.025 0.0 0.0 0.0 94-95 0.175 0.025 0.0 0.0 0.0 96-97 0.225 0.025 0.0 0.0 0.0 98-99 0.25 0.025 0.0 0.0 0.0 100-101 0.25 0.025 0.0 0.0 0.0 102-103 0.275 0.025 0.0 0.0 0.0 104-105 0.2875 0.025 0.0 0.0 0.0 106-107 0.3125 0.025 0.0 0.0 0.0 108-109 0.425 0.025 0.0 0.0 0.0 110-111 0.45 0.025 0.0 0.0 0.0 112-113 0.4625 0.025 0.0 0.0 0.0 114-115 0.475 0.025 0.0 0.0 0.0 116-117 0.5249999999999999 0.025 0.0 0.0 0.0 118-119 0.6125 0.025 0.0 0.0 0.0 120-121 0.675 0.025 0.0 0.0 0.0 122-123 0.725 0.025 0.0 0.0 0.0 124-125 0.7625 0.025 0.0 0.0 0.0 126-127 0.7875000000000001 0.025 0.0 0.0 0.0 128-129 0.9375 0.025 0.0 0.0 0.0 130-131 1.125 0.025 0.0 0.0 0.0 132-133 1.3875000000000002 0.025 0.0 0.0 0.0 134-135 1.525 0.025 0.0 0.0 0.0 136-137 1.6 0.025 0.0 0.0 0.0 138-139 1.7374999999999998 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCCCG 10 0.006830828 145.0 9 ATTGGTC 10 0.006830828 145.0 6 AAGAAAG 10 0.006830828 145.0 145 TTGGTCC 10 0.006830828 145.0 7 GTGGAAT 10 0.006830828 145.0 1 >>END_MODULE SRR12671684 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671684_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9415 37.0 37.0 37.0 37.0 37.0 2 35.8365 37.0 37.0 37.0 37.0 37.0 3 36.048 37.0 37.0 37.0 37.0 37.0 4 36.096 37.0 37.0 37.0 37.0 37.0 5 36.159 37.0 37.0 37.0 37.0 37.0 6 36.1615 37.0 37.0 37.0 37.0 37.0 7 36.0885 37.0 37.0 37.0 37.0 37.0 8 36.1685 37.0 37.0 37.0 37.0 37.0 9 36.156 37.0 37.0 37.0 37.0 37.0 10-14 36.1847 37.0 37.0 37.0 37.0 37.0 15-19 36.1452 37.0 37.0 37.0 37.0 37.0 20-24 36.1308 37.0 37.0 37.0 37.0 37.0 25-29 36.039699999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.0524 37.0 37.0 37.0 37.0 37.0 35-39 35.9811 37.0 37.0 37.0 37.0 37.0 40-44 35.964 37.0 37.0 37.0 37.0 37.0 45-49 35.9955 37.0 37.0 37.0 37.0 37.0 50-54 35.9212 37.0 37.0 37.0 37.0 37.0 55-59 35.9451 37.0 37.0 37.0 37.0 37.0 60-64 35.799099999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.7622 37.0 37.0 37.0 37.0 37.0 70-74 35.888400000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.6886 37.0 37.0 37.0 37.0 37.0 80-84 35.7411 37.0 37.0 37.0 37.0 37.0 85-89 35.7065 37.0 37.0 37.0 37.0 37.0 90-94 35.6409 37.0 37.0 37.0 37.0 37.0 95-99 35.7145 37.0 37.0 37.0 37.0 37.0 100-104 35.6306 37.0 37.0 37.0 37.0 37.0 105-109 35.546 37.0 37.0 37.0 37.0 37.0 110-114 35.5433 37.0 37.0 37.0 37.0 37.0 115-119 35.4653 37.0 37.0 37.0 37.0 37.0 120-124 35.519400000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.398 37.0 37.0 37.0 37.0 37.0 130-134 35.4692 37.0 37.0 37.0 37.0 37.0 135-139 35.41420000000001 37.0 37.0 37.0 34.6 37.0 140-144 35.1065 37.0 37.0 37.0 27.4 37.0 145-149 35.277 37.0 37.0 37.0 32.2 37.0 150-151 34.85925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 0.0 19 2.0 20 1.0 21 2.0 22 1.0 23 4.0 24 3.0 25 10.0 26 15.0 27 15.0 28 19.0 29 22.0 30 41.0 31 58.0 32 79.0 33 117.0 34 259.0 35 649.0 36 2509.0 37 190.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.075 18.0 14.875 32.05 2 24.375 24.375 35.425000000000004 15.825 3 20.7 27.05 30.7 21.55 4 21.825 35.75 22.5 19.925 5 22.175 37.7 23.425 16.7 6 18.575 37.4 24.05 19.975 7 17.175 17.224999999999998 43.075 22.525000000000002 8 19.925 23.225 27.575 29.275000000000002 9 20.3 25.05 30.2 24.45 10-14 22.45 28.610000000000003 26.88 22.06 15-19 22.314999999999998 28.4 27.834999999999997 21.45 20-24 22.415 27.915 28.23 21.44 25-29 22.41 28.235 28.084999999999997 21.27 30-34 21.545 27.965 28.78 21.709999999999997 35-39 22.465 28.345 28.384999999999998 20.805 40-44 22.59 28.194999999999997 28.050000000000004 21.165 45-49 22.065 27.939999999999998 28.895 21.099999999999998 50-54 23.32 27.3 27.775 21.605 55-59 22.235 27.505000000000003 28.33 21.93 60-64 22.435 27.655 28.565 21.345 65-69 23.119999999999997 27.845 27.735 21.3 70-74 23.355 27.37 27.965 21.310000000000002 75-79 22.95 28.21 27.46 21.38 80-84 23.165 27.92 27.805000000000003 21.11 85-89 23.34 27.900000000000002 27.68 21.08 90-94 23.29 27.810000000000002 27.705000000000002 21.195 95-99 22.825 27.845 27.735 21.595 100-104 23.21 27.96 27.73 21.099999999999998 105-109 22.46 28.12 28.02 21.4 110-114 22.955000000000002 28.12 27.925 21.0 115-119 23.205000000000002 28.315 27.279999999999998 21.2 120-124 24.099999999999998 27.839999999999996 27.395000000000003 20.665 125-129 23.275000000000002 27.99 27.639999999999997 21.095 130-134 23.400000000000002 28.084999999999997 27.58 20.935000000000002 135-139 23.785 27.175 28.15 20.89 140-144 23.34 28.389999999999997 28.03 20.24 145-149 24.065 28.044999999999998 27.43 20.46 150-151 25.074999999999996 27.825 27.425 19.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 2.5 26 4.0 27 7.0 28 8.5 29 11.0 30 17.5 31 22.5 32 27.0 33 37.0 34 52.0 35 64.0 36 78.0 37 98.5 38 127.0 39 168.5 40 202.5 41 236.0 42 262.5 43 271.0 44 280.0 45 278.5 46 280.5 47 263.0 48 218.0 49 192.5 50 168.0 51 135.5 52 105.5 53 84.0 54 66.0 55 50.0 56 46.5 57 39.0 58 25.0 59 18.5 60 14.0 61 5.0 62 3.5 63 5.5 64 2.5 65 3.0 66 4.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.05 #Duplication Level Percentage of deduplicated Percentage of total 1 93.44438473938743 86.95 2 5.830198817839872 10.85 3 0.6179473401397099 1.725 4 0.05373455131649651 0.2 5 0.026867275658248254 0.125 6 0.026867275658248254 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8 0.0 0.0 0.0 0.0 126-127 0.8374999999999999 0.0 0.0 0.0 0.0 128-129 0.9874999999999999 0.0 0.0 0.0 0.0 130-131 1.175 0.0 0.0 0.0 0.0 132-133 1.475 0.0 0.0 0.0 0.0 134-135 1.625 0.0 0.0 0.0 0.0 136-137 1.7 0.0 0.0 0.0 0.0 138-139 1.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACGAAG 10 0.006830828 145.0 145 GGACCGA 10 0.006830828 145.0 4 ACCGATT 10 0.006830828 145.0 6 TGGACCG 10 0.006830828 145.0 3 AAGGAGG 10 0.006830828 145.0 9 GATTAAC 10 0.006830828 145.0 9 TTGGACC 15 1.1411342E-4 145.0 2 CCGATTA 10 0.006830828 145.0 7 CGATTAA 10 0.006830828 145.0 8 AGGAGGA 30 0.0014437955 24.166668 10-14 >>END_MODULE Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113358 spots for SRR12671684.sra Written 1113358 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra Read 1113349 spots for SRR12671684.sra Written 1113349 spots for SRR12671684.sra SRR ids: ['SRR12671684.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5m8c9o60 SRR12671684.sra spots: 22266989 blocks: [[1, 1113349], [1113350, 2226698], [2226699, 3340047], [3340048, 4453396], [4453397, 5566745], [5566746, 6680094], [6680095, 7793443], [7793444, 8906792], [8906793, 10020141], [10020142, 11133490], [11133491, 12246839], [12246840, 13360188], [13360189, 14473537], [14473538, 15586886], [15586887, 16700235], [16700236, 17813584], [17813585, 18926933], [18926934, 20040282], [20040283, 21153631], [21153632, 22266989]] SRR12671684 file size 7545596 SRR12671684 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671684 SRR12671684_1.fastq SRR12671684_2.fastq Input file: SRR12671684_1.fastq Paired file: SRR12671684_2.fastq trimmed: SRR12671684-trimmed-pair1.fastq, SRR12671684-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:47:48 2025 >> started Wed Feb 12 02:48:18 2025 >> done (29.519s) 22266989 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 1797 ( 0.01%) empty read pairs filtered out after trimming by size control 22265174 (99.99%) read pairs available; of these: 745863 ( 3.35%) trimmed read pairs available after processing 21519311 (96.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 6 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 2 0.00% 25 6 0.00% 26 5 0.00% 27 9 0.00% 28 12 0.00% 29 10 0.00% 30 6 0.00% 31 12 0.00% 32 16 0.00% 33 18 0.00% 34 21 0.00% 35 15 0.00% 36 17 0.00% 37 16 0.00% 38 26 0.00% 39 24 0.00% 40 31 0.00% 41 26 0.00% 42 30 0.00% 43 40 0.00% 44 23 0.00% 45 26 0.00% 46 37 0.00% 47 47 0.00% 48 36 0.00% 49 55 0.00% 50 53 0.00% 51 54 0.00% 52 59 0.00% 53 69 0.00% 54 61 0.00% 55 71 0.00% 56 93 0.00% 57 100 0.00% 58 103 0.00% 59 113 0.00% 60 103 0.00% 61 128 0.00% 62 128 0.00% 63 155 0.00% 64 152 0.00% 65 180 0.00% 66 208 0.00% 67 206 0.00% 68 219 0.00% 69 253 0.00% 70 267 0.00% 71 358 0.00% 72 387 0.00% 73 350 0.00% 74 433 0.00% 75 437 0.00% 76 525 0.00% 77 568 0.00% 78 590 0.00% 79 660 0.00% 80 703 0.00% 81 815 0.00% 82 919 0.00% 83 1026 0.00% 84 1171 0.01% 85 1176 0.01% 86 1313 0.01% 87 1416 0.01% 88 1558 0.01% 89 1731 0.01% 90 1744 0.01% 91 2023 0.01% 92 2086 0.01% 93 2435 0.01% 94 2501 0.01% 95 2818 0.01% 96 2972 0.01% 97 3209 0.01% 98 3400 0.02% 99 3523 0.02% 100 3737 0.02% 101 4002 0.02% 102 4291 0.02% 103 4679 0.02% 104 4819 0.02% 105 5219 0.02% 106 5518 0.02% 107 5776 0.03% 108 6004 0.03% 109 6285 0.03% 110 6576 0.03% 111 6840 0.03% 112 7259 0.03% 113 7852 0.04% 114 8029 0.04% 115 8295 0.04% 116 8838 0.04% 117 9148 0.04% 118 9458 0.04% 119 10178 0.05% 120 10432 0.05% 121 10740 0.05% 122 11174 0.05% 123 11930 0.05% 124 12018 0.05% 125 12620 0.06% 126 13323 0.06% 127 13560 0.06% 128 13992 0.06% 129 14519 0.07% 130 14685 0.07% 131 15411 0.07% 132 15842 0.07% 133 17171 0.08% 134 17566 0.08% 135 18159 0.08% 136 18464 0.08% 137 18995 0.09% 138 19428 0.09% 139 20206 0.09% 140 20490 0.09% 141 21175 0.10% 142 22412 0.10% 143 22855 0.10% 144 24064 0.11% 145 24462 0.11% 146 25274 0.11% 147 25791 0.12% 148 26365 0.12% 149 26664 0.12% 150 27071 0.12% 151 21519311 96.65% 22265174 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=33 prefix-density=0.33 prefix-fanout=2.3 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=168.21 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=7.8 sequence=TCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGATATAGCTAGGGACACATCAAGTTCTGGGACGACTTAGACACCTTTCGGCTTGGCGGCAATAAAGCTGATGCACTGCACTTGACG criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=4.93 fanout-score-rank=17 prefix-density=0.68 prefix-fanout=2.2 sequence=ATGGCTTCCTCCTCTATGATCTCATCGGCAGCCGTTGCCACCGTCAACCGCACCCCGGCACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=84.62 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=3.6 sequence=CATCTCTTCAATCGTAAATCACAAATACATACACGTTTACTCATCAGCTCGAAAATGGCAGCAG SRR12671684 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:49:03 Started mapping on | Feb 12 02:49:04 Finished on | Feb 12 02:53:19 Mapping speed, Million of reads per hour | 314.33 Number of input reads | 22265174 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 20995625 Uniquely mapped reads % | 94.30% Average mapped length | 299.22 Number of splices: Total | 21164706 Number of splices: Annotated (sjdb) | 20724131 Number of splices: GT/AG | 20765392 Number of splices: GC/AG | 325752 Number of splices: AT/AC | 13321 Number of splices: Non-canonical | 60241 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 525776 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 27391 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 743773 743773 743773 N_multimapping 525776 525776 525776 N_noFeature 697446 20679051 794788 N_ambiguous 365262 1544 145263 UnstrandedReadsAssigned:19932917 PositiveStrandReadsAssigned:315030 NegativeStrandReadsAssigned:20055574 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671684 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671684-trimmed-pair1.fastq SRR12671684-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,265,174 reads, 19,973,384 reads pseudoaligned [quant] estimated average fragment length: 323.325 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR12671684.ke.tsv 34699 SRR12671684.se.tsv 87100 total ==> SRR12671684.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1695.67 1889 50.8644 Potri.005G024800.1.v4.1 1035 712.675 740 47.4095 Potri.004G059700.1.v4.1 961 639.468 2 0.142803 Potri.007G009000.2.v4.1 1416 1093.67 0 0 Potri.003G141000.2.v4.1 2943 2620.67 1199.83 20.9041 Potri.016G087400.1.v4.1 270 67.3444 1340 908.507 Potri.015G069301.1.v4.1 564 275.869 0 0 Potri.010G195200.1.v4.1 1773 1450.67 159 5.0044 Potri.012G127500.1.v4.1 977 655.009 171 11.9199 ==> SRR12671684.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 94 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR12671684 completed mapping pipeline successfully