Starting /dee2/code/volunteer_pipeline.sh SRR12671685 current disk space = 3048995856384 free memory = 1581804928 SRR12671685 SRAfilesize 73454135396d2bcbc5dd7d43471b281a SRR12671685.sra SRR12671685.sra file validated SRR12671685 is paired end SRR12671685 is conventional basespace SRR12671685 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671685_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5315 37.0 37.0 37.0 37.0 37.0 2 36.29375 37.0 37.0 37.0 37.0 37.0 3 36.5525 37.0 37.0 37.0 37.0 37.0 4 36.524 37.0 37.0 37.0 37.0 37.0 5 36.546 37.0 37.0 37.0 37.0 37.0 6 36.529 37.0 37.0 37.0 37.0 37.0 7 36.531 37.0 37.0 37.0 37.0 37.0 8 36.5155 37.0 37.0 37.0 37.0 37.0 9 36.6115 37.0 37.0 37.0 37.0 37.0 10-14 36.5606 37.0 37.0 37.0 37.0 37.0 15-19 36.556200000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.513600000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4765 37.0 37.0 37.0 37.0 37.0 30-34 36.5164 37.0 37.0 37.0 37.0 37.0 35-39 36.4589 37.0 37.0 37.0 37.0 37.0 40-44 36.4371 37.0 37.0 37.0 37.0 37.0 45-49 36.4156 37.0 37.0 37.0 37.0 37.0 50-54 36.403499999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.418099999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.40069999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.32340000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.287400000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.2929 37.0 37.0 37.0 37.0 37.0 80-84 36.287699999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.306799999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.22580000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1519 37.0 37.0 37.0 37.0 37.0 100-104 36.1589 37.0 37.0 37.0 37.0 37.0 105-109 36.190000000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.1257 37.0 37.0 37.0 37.0 37.0 115-119 36.10529999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.0237 37.0 37.0 37.0 37.0 37.0 125-129 36.026599999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.9422 37.0 37.0 37.0 37.0 37.0 135-139 35.9293 37.0 37.0 37.0 37.0 37.0 140-144 35.9051 37.0 37.0 37.0 37.0 37.0 145-149 35.8423 37.0 37.0 37.0 37.0 37.0 150-151 35.45925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 3.0 27 11.0 28 10.0 29 20.0 30 24.0 31 36.0 32 50.0 33 69.0 34 126.0 35 303.0 36 2992.0 37 354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.4 15.049999999999999 11.825 43.725 2 19.337848006019563 22.397792826686732 39.65387509405568 18.610484073238023 3 19.2 25.8 26.5 28.499999999999996 4 22.375 34.65 21.575 21.4 5 20.525 36.25 24.925 18.3 6 17.775 36.925000000000004 24.925 20.375 7 13.100000000000001 22.0 45.300000000000004 19.6 8 18.475 22.650000000000002 30.45 28.425 9 16.85 21.875 33.900000000000006 27.375 10-14 19.35 29.56 27.29 23.799999999999997 15-19 19.675 27.985 28.105000000000004 24.235 20-24 19.744999999999997 28.025 28.315 23.915 25-29 19.77 28.4 27.92 23.91 30-34 19.39 29.43 27.04 24.14 35-39 19.7 28.575 27.425 24.3 40-44 20.005 28.499999999999996 27.339999999999996 24.154999999999998 45-49 20.29 28.415000000000003 27.905 23.39 50-54 19.715 28.515 27.715 24.055 55-59 19.72 28.189999999999998 28.13 23.96 60-64 20.1 28.07 27.634999999999998 24.195 65-69 19.855 28.525 27.815 23.805 70-74 19.98 28.645 28.060000000000002 23.315 75-79 20.44 27.565 28.03 23.965 80-84 20.205000000000002 28.155 27.584999999999997 24.055 85-89 20.0 28.449999999999996 27.92 23.630000000000003 90-94 19.82 28.455000000000002 28.055000000000003 23.669999999999998 95-99 20.044999999999998 28.505000000000003 27.650000000000002 23.799999999999997 100-104 20.5 28.410000000000004 27.939999999999998 23.150000000000002 105-109 20.325 27.865000000000002 28.33 23.48 110-114 21.125 28.199999999999996 27.815 22.86 115-119 20.66 28.645 27.13 23.565 120-124 20.3 28.52 27.105 24.075 125-129 20.48 28.560000000000002 27.325 23.635 130-134 20.549999999999997 28.33 27.825 23.294999999999998 135-139 21.38 27.775 27.345000000000002 23.5 140-144 21.529999999999998 28.04 26.845000000000002 23.585 145-149 21.43 28.21 26.83 23.53 150-151 21.4375 28.7 26.400000000000002 23.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 1.0 23 3.0 24 3.5 25 3.5 26 8.0 27 9.5 28 8.0 29 11.5 30 20.5 31 31.0 32 35.5 33 43.0 34 56.0 35 83.0 36 105.0 37 119.5 38 138.0 39 149.0 40 192.5 41 220.0 42 224.0 43 250.0 44 277.5 45 283.5 46 255.0 47 252.0 48 246.5 49 203.0 50 165.0 51 126.0 52 98.0 53 85.0 54 72.5 55 57.0 56 39.0 57 32.0 58 25.0 59 15.0 60 15.5 61 13.5 62 8.0 63 4.0 64 1.5 65 3.5 66 2.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.3 #Duplication Level Percentage of deduplicated Percentage of total 1 94.22057264050902 88.85 2 5.514316012725344 10.4 3 0.2651113467656416 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5249999999999999 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.2625 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.5875 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 2.0125 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.525 0.0 0.0 0.0 0.0 124-125 2.8125 0.0 0.0 0.0 0.0 126-127 3.15 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.7125000000000004 0.0 0.0 0.0 0.0 132-133 4.2125 0.0 0.0 0.0 0.0 134-135 4.5 0.0 0.0 0.0 0.0 136-137 4.9 0.0 0.0 0.0 0.0 138-139 5.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTACC 10 0.006830828 145.0 9 >>END_MODULE SRR12671685 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671685_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3475 37.0 37.0 37.0 37.0 37.0 2 36.1945 37.0 37.0 37.0 37.0 37.0 3 36.3175 37.0 37.0 37.0 37.0 37.0 4 36.293 37.0 37.0 37.0 37.0 37.0 5 36.3235 37.0 37.0 37.0 37.0 37.0 6 36.342 37.0 37.0 37.0 37.0 37.0 7 36.3675 37.0 37.0 37.0 37.0 37.0 8 36.4245 37.0 37.0 37.0 37.0 37.0 9 36.324 37.0 37.0 37.0 37.0 37.0 10-14 36.394 37.0 37.0 37.0 37.0 37.0 15-19 36.351800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.325900000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.2872 37.0 37.0 37.0 37.0 37.0 30-34 36.259699999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.217600000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.2292 37.0 37.0 37.0 37.0 37.0 45-49 36.172999999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.219100000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.153 37.0 37.0 37.0 37.0 37.0 60-64 36.1579 37.0 37.0 37.0 37.0 37.0 65-69 36.1173 37.0 37.0 37.0 37.0 37.0 70-74 36.124100000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.9734 37.0 37.0 37.0 37.0 37.0 80-84 36.0266 37.0 37.0 37.0 37.0 37.0 85-89 35.9628 37.0 37.0 37.0 37.0 37.0 90-94 35.9212 37.0 37.0 37.0 37.0 37.0 95-99 35.95569999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.9481 37.0 37.0 37.0 37.0 37.0 105-109 35.8375 37.0 37.0 37.0 37.0 37.0 110-114 35.8285 37.0 37.0 37.0 37.0 37.0 115-119 35.852999999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.774800000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.714000000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.6777 37.0 37.0 37.0 37.0 37.0 135-139 35.637299999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.421400000000006 37.0 37.0 37.0 34.6 37.0 145-149 35.5272 37.0 37.0 37.0 37.0 37.0 150-151 35.0745 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 1.0 21 4.0 22 3.0 23 6.0 24 4.0 25 7.0 26 8.0 27 3.0 28 13.0 29 15.0 30 25.0 31 47.0 32 56.0 33 86.0 34 184.0 35 492.0 36 2780.0 37 263.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.0 16.05 15.15 36.8 2 24.474999999999998 22.7 37.25 15.575 3 19.950000000000003 26.075 31.0 22.975 4 22.5 36.05 21.95 19.5 5 23.775 36.25 21.95 18.025 6 17.375 37.65 24.25 20.724999999999998 7 16.125 16.7 45.0 22.175 8 20.150000000000002 22.325 27.625 29.9 9 21.95 23.425 29.825000000000003 24.8 10-14 22.384999999999998 28.73 26.740000000000002 22.145 15-19 22.29 28.199999999999996 27.884999999999998 21.625 20-24 21.790000000000003 28.62 28.355000000000004 21.235 25-29 22.245 28.16 28.28 21.315 30-34 21.97 27.51 28.575 21.945 35-39 22.634999999999998 28.16 27.815 21.39 40-44 22.255 28.405 27.58 21.759999999999998 45-49 21.64 28.365000000000002 28.345 21.65 50-54 22.82 27.845 27.634999999999998 21.7 55-59 22.05 28.04 28.28 21.63 60-64 22.605 28.125 27.52 21.75 65-69 22.73 27.74 27.634999999999998 21.895 70-74 22.745 28.29 27.694999999999997 21.27 75-79 23.200000000000003 28.395 27.450000000000003 20.955 80-84 22.775000000000002 27.855 27.325 22.045 85-89 22.775000000000002 27.54 28.115000000000002 21.57 90-94 22.485 27.639999999999997 28.689999999999998 21.185000000000002 95-99 23.064999999999998 27.99 27.48 21.465 100-104 23.189999999999998 27.455000000000002 27.83 21.525 105-109 22.965 27.845 28.355000000000004 20.835 110-114 23.330000000000002 28.27 27.589999999999996 20.810000000000002 115-119 23.544999999999998 27.76 27.639999999999997 21.055 120-124 23.515 27.11 28.1 21.275 125-129 24.33 27.894999999999996 27.255000000000003 20.52 130-134 24.075 27.595 27.325 21.005 135-139 24.415 27.735 27.105 20.745 140-144 25.145 27.54 27.224999999999998 20.09 145-149 25.624999999999996 27.785 26.484999999999996 20.105 150-151 25.9875 28.012500000000003 27.125 18.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 1.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 2.0 19 2.5 20 1.5 21 1.0 22 1.0 23 3.0 24 3.0 25 2.5 26 4.0 27 5.5 28 8.5 29 14.0 30 14.5 31 18.0 32 28.0 33 44.5 34 60.0 35 71.0 36 84.5 37 98.0 38 130.0 39 173.5 40 199.0 41 212.0 42 236.0 43 262.5 44 271.0 45 265.0 46 253.0 47 237.0 48 218.5 49 201.5 50 172.5 51 140.0 52 118.0 53 92.5 54 76.0 55 67.5 56 52.0 57 43.5 58 33.0 59 22.5 60 21.0 61 12.0 62 6.0 63 5.5 64 2.5 65 1.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.06283280085196 88.325 2 5.617678381256656 10.549999999999999 3 0.26624068157614483 0.75 4 0.0 0.0 5 0.0 0.0 6 0.026624068157614485 0.15 7 0.0 0.0 8 0.0 0.0 9 0.026624068157614485 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 9 0.22499999999999998 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5249999999999999 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.2625 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.5750000000000002 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 1.9875 0.0 0.0 0.0 0.0 120-121 2.35 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.7875 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.3375 0.0 0.0 0.0 0.0 130-131 3.6875 0.0 0.0 0.0 0.0 132-133 4.15 0.0 0.0 0.0 0.0 134-135 4.425000000000001 0.0 0.0 0.0 0.0 136-137 4.825 0.0 0.0 0.0 0.0 138-139 5.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATGCC 10 0.006830828 145.0 6 TGAAGCT 10 0.006830828 145.0 145 >>END_MODULE Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872976 spots for SRR12671685.sra Written 872976 spots for SRR12671685.sra Read 872979 spots for SRR12671685.sra Written 872979 spots for SRR12671685.sra SRR ids: ['SRR12671685.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bmg3ynd0 SRR12671685.sra spots: 17459523 blocks: [[1, 872976], [872977, 1745952], [1745953, 2618928], [2618929, 3491904], [3491905, 4364880], [4364881, 5237856], [5237857, 6110832], [6110833, 6983808], [6983809, 7856784], [7856785, 8729760], [8729761, 9602736], [9602737, 10475712], [10475713, 11348688], [11348689, 12221664], [12221665, 13094640], [13094641, 13967616], [13967617, 14840592], [14840593, 15713568], [15713569, 16586544], [16586545, 17459523]] SRR12671685 file size 5911809 SRR12671685 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671685 SRR12671685_1.fastq SRR12671685_2.fastq Input file: SRR12671685_1.fastq Paired file: SRR12671685_2.fastq trimmed: SRR12671685-trimmed-pair1.fastq, SRR12671685-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:16:26 2025 >> started Wed Feb 12 03:16:46 2025 >> done (20.060s) 17459523 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 1663 ( 0.01%) empty read pairs filtered out after trimming by size control 17457843 (99.99%) read pairs available; of these: 1394225 ( 7.99%) trimmed read pairs available after processing 16063618 (92.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 5 0.00% 22 1 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 3 0.00% 27 9 0.00% 28 6 0.00% 29 8 0.00% 30 10 0.00% 31 10 0.00% 32 12 0.00% 33 12 0.00% 34 16 0.00% 35 15 0.00% 36 13 0.00% 37 23 0.00% 38 28 0.00% 39 28 0.00% 40 22 0.00% 41 33 0.00% 42 33 0.00% 43 38 0.00% 44 44 0.00% 45 33 0.00% 46 48 0.00% 47 55 0.00% 48 56 0.00% 49 67 0.00% 50 79 0.00% 51 109 0.00% 52 101 0.00% 53 78 0.00% 54 91 0.00% 55 101 0.00% 56 122 0.00% 57 145 0.00% 58 141 0.00% 59 163 0.00% 60 183 0.00% 61 221 0.00% 62 228 0.00% 63 249 0.00% 64 287 0.00% 65 357 0.00% 66 358 0.00% 67 395 0.00% 68 389 0.00% 69 448 0.00% 70 545 0.00% 71 612 0.00% 72 723 0.00% 73 821 0.00% 74 902 0.01% 75 1030 0.01% 76 1130 0.01% 77 1233 0.01% 78 1279 0.01% 79 1405 0.01% 80 1653 0.01% 81 1856 0.01% 82 2028 0.01% 83 2248 0.01% 84 2646 0.02% 85 2888 0.02% 86 3085 0.02% 87 3258 0.02% 88 3612 0.02% 89 3939 0.02% 90 4229 0.02% 91 4679 0.03% 92 5070 0.03% 93 5609 0.03% 94 6012 0.03% 95 6482 0.04% 96 6848 0.04% 97 7179 0.04% 98 7854 0.04% 99 8104 0.05% 100 8821 0.05% 101 9038 0.05% 102 9635 0.06% 103 10148 0.06% 104 11008 0.06% 105 11685 0.07% 106 12092 0.07% 107 12615 0.07% 108 13185 0.08% 109 13879 0.08% 110 14552 0.08% 111 14848 0.09% 112 15559 0.09% 113 16287 0.09% 114 17042 0.10% 115 17624 0.10% 116 18532 0.11% 117 19190 0.11% 118 19978 0.11% 119 20306 0.12% 120 21019 0.12% 121 21584 0.12% 122 22378 0.13% 123 23402 0.13% 124 24321 0.14% 125 25156 0.14% 126 25639 0.15% 127 26525 0.15% 128 27148 0.16% 129 27720 0.16% 130 28516 0.16% 131 29211 0.17% 132 30153 0.17% 133 30959 0.18% 134 31902 0.18% 135 32581 0.19% 136 33401 0.19% 137 33783 0.19% 138 34778 0.20% 139 35360 0.20% 140 35524 0.20% 141 36536 0.21% 142 37942 0.22% 143 38526 0.22% 144 40169 0.23% 145 40279 0.23% 146 41275 0.24% 147 41257 0.24% 148 42003 0.24% 149 42353 0.24% 150 42959 0.25% 151 16063618 92.01% 17457843 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=27 prefix-density=0.41 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=15.29 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=6.7 sequence=TTGATGAAGAGGCAGCACATCTTTCCCTTCTTCTTGATTATATCAGCCGCCTCACGGTACCTTTGCCTGATAAGCTTTGCGGGTTCACCAGCGTTCCCACTTTCCAATTCTCCAGCACTCATCATGATTGGGTTAATTCCCATCTTGGCAAAGACAAGTTCACACTGGAAGGATTTTCCTTGGCCTTTGCCTCCCCAAACACCCAAGATGAGAGGAACCTTGATATTAGGCAGGCTCATGAAGTTCTTGGAGATGTGAACAACAAGCTTGTCCATGAAAGCAGGAGCAATGTAGAAACCATCCATGTTGTTGTCCAAGTTGTACGTACGAAGACCTTGACTGAGATACTCATAAGAATTCAAAACGGGGTTGTGAGTTCCAGTTCCCTGGGGGGCTTGGAAAAGAGAGTCCACCATACCCTTTCCTCTGCTGATATCTTGTTGGTCATCAGACATGTCTGTAACAAGGCCTCCCCATCTGTCCTTGTCGGTCTGCTTCTTCTCATCGTACT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=33 prefix-density=0.55 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=24.56 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=1.4 sequence=TGGCTTCCTCTACGCTCTCCCCTGCCACTCCCTCACAGCTATGCTCTAGCAAGAGTGGCATGTTCTCTCCTACACATGCGGTGTTTGTGAAACCAACAAGGACAAATATGGTG SRR12671685 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:17:53 Started mapping on | Feb 12 03:17:54 Finished on | Feb 12 03:19:38 Mapping speed, Million of reads per hour | 604.31 Number of input reads | 17457843 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16562319 Uniquely mapped reads % | 94.87% Average mapped length | 297.13 Number of splices: Total | 16761436 Number of splices: Annotated (sjdb) | 16382574 Number of splices: GT/AG | 16425689 Number of splices: GC/AG | 271142 Number of splices: AT/AC | 11006 Number of splices: Non-canonical | 53599 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 393064 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 68038 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 502460 502460 502460 N_multimapping 393064 393064 393064 N_noFeature 656602 16319342 746521 N_ambiguous 260395 1121 106637 UnstrandedReadsAssigned:15645322 PositiveStrandReadsAssigned:241856 NegativeStrandReadsAssigned:15709161 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671685 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671685-trimmed-pair1.fastq SRR12671685-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,457,843 reads, 15,649,446 reads pseudoaligned [quant] estimated average fragment length: 286.996 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR12671685.ke.tsv 34699 SRR12671685.se.tsv 87100 total ==> SRR12671685.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732 740 26.3146 Potri.005G024800.1.v4.1 1035 749.004 265 21.7909 Potri.004G059700.1.v4.1 961 675.497 12 1.09414 Potri.007G009000.2.v4.1 1416 1130 0 0 Potri.003G141000.2.v4.1 2943 2657 997 23.1109 Potri.016G087400.1.v4.1 270 80.9683 686 521.822 Potri.015G069301.1.v4.1 564 304.051 0 0 Potri.010G195200.1.v4.1 1773 1487 64 2.65083 Potri.012G127500.1.v4.1 977 691.27 223 19.8687 ==> SRR12671685.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 195 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 201 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR12671685 completed mapping pipeline successfully