Starting /dee2/code/volunteer_pipeline.sh SRR12671686 current disk space = 3049033850880 free memory = 1438839900 SRR12671686 SRAfilesize 581621498bb857f3e171e7c0cdec32ed SRR12671686.sra SRR12671686.sra file validated SRR12671686 is paired end SRR12671686 is conventional basespace SRR12671686 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671686_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.312 37.0 37.0 37.0 37.0 37.0 2 36.336 37.0 37.0 37.0 37.0 37.0 3 36.386 37.0 37.0 37.0 37.0 37.0 4 36.472 37.0 37.0 37.0 37.0 37.0 5 36.491 37.0 37.0 37.0 37.0 37.0 6 36.4735 37.0 37.0 37.0 37.0 37.0 7 36.3905 37.0 37.0 37.0 37.0 37.0 8 36.5075 37.0 37.0 37.0 37.0 37.0 9 36.561 37.0 37.0 37.0 37.0 37.0 10-14 36.521 37.0 37.0 37.0 37.0 37.0 15-19 36.5183 37.0 37.0 37.0 37.0 37.0 20-24 36.4887 37.0 37.0 37.0 37.0 37.0 25-29 36.4749 37.0 37.0 37.0 37.0 37.0 30-34 36.4193 37.0 37.0 37.0 37.0 37.0 35-39 36.3985 37.0 37.0 37.0 37.0 37.0 40-44 36.381299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3341 37.0 37.0 37.0 37.0 37.0 50-54 36.414 37.0 37.0 37.0 37.0 37.0 55-59 36.348699999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.3486 37.0 37.0 37.0 37.0 37.0 65-69 36.3331 37.0 37.0 37.0 37.0 37.0 70-74 36.2746 37.0 37.0 37.0 37.0 37.0 75-79 36.298899999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.2642 37.0 37.0 37.0 37.0 37.0 85-89 36.2669 37.0 37.0 37.0 37.0 37.0 90-94 36.24550000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.120000000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.196000000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1521 37.0 37.0 37.0 37.0 37.0 110-114 36.0814 37.0 37.0 37.0 37.0 37.0 115-119 36.0745 37.0 37.0 37.0 37.0 37.0 120-124 36.0179 37.0 37.0 37.0 37.0 37.0 125-129 35.9514 37.0 37.0 37.0 37.0 37.0 130-134 35.98 37.0 37.0 37.0 37.0 37.0 135-139 35.9685 37.0 37.0 37.0 37.0 37.0 140-144 35.8904 37.0 37.0 37.0 37.0 37.0 145-149 35.823600000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.36125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 0.0 26 4.0 27 6.0 28 14.0 29 23.0 30 23.0 31 28.0 32 54.0 33 84.0 34 146.0 35 323.0 36 2917.0 37 376.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.225 17.4 9.8 40.575 2 20.505758637956937 21.106659989984976 39.684526790185274 18.70305458187281 3 17.875 27.700000000000003 28.499999999999996 25.924999999999997 4 21.775 32.300000000000004 24.425 21.5 5 22.05 36.575 22.675 18.7 6 18.075 36.725 25.3 19.900000000000002 7 12.9 22.275 45.0 19.825 8 18.4 23.025000000000002 29.675 28.9 9 17.65 22.25 33.35 26.75 10-14 19.400000000000002 29.325000000000003 26.63 24.645 15-19 19.975 27.965 27.589999999999996 24.47 20-24 19.5 28.970000000000002 27.27 24.26 25-29 19.495 29.005 27.860000000000003 23.64 30-34 19.84 28.92 27.295 23.945 35-39 19.84 29.21 27.465 23.485 40-44 19.855 29.065 27.485 23.595 45-49 20.22 28.595 27.55 23.635 50-54 19.485 28.389999999999997 28.09 24.035 55-59 19.975 28.310000000000002 27.834999999999997 23.880000000000003 60-64 20.525 28.605000000000004 27.075 23.794999999999998 65-69 19.735 28.46 27.474999999999998 24.33 70-74 19.96 28.395 28.12 23.525 75-79 20.26 28.21 27.565 23.965 80-84 19.919999999999998 28.465 27.445000000000004 24.169999999999998 85-89 19.835 28.904999999999998 27.134999999999998 24.125 90-94 20.380000000000003 28.395 27.855 23.369999999999997 95-99 19.919999999999998 28.499999999999996 28.000000000000004 23.580000000000002 100-104 20.630000000000003 28.720000000000002 27.22 23.43 105-109 20.915 27.38 28.235 23.47 110-114 20.46 28.4 27.715 23.425 115-119 20.74 27.834999999999997 27.735 23.69 120-124 20.41 27.634999999999998 27.639999999999997 24.315 125-129 20.41 27.825 27.544999999999998 24.22 130-134 20.445 27.755000000000003 27.32 24.48 135-139 20.65 27.950000000000003 27.47 23.93 140-144 20.885 28.26 26.685 24.169999999999998 145-149 20.51 28.035 27.74 23.715 150-151 21.8875 28.512500000000003 26.35 23.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 2.0 23 2.5 24 3.5 25 4.0 26 4.0 27 8.0 28 8.5 29 17.5 30 27.0 31 31.0 32 37.5 33 43.0 34 67.0 35 88.0 36 97.5 37 115.5 38 131.0 39 154.0 40 191.5 41 222.0 42 235.0 43 247.5 44 259.0 45 257.0 46 252.0 47 255.5 48 228.5 49 186.5 50 171.0 51 138.5 52 104.5 53 90.5 54 77.5 55 62.5 56 58.0 57 45.5 58 23.0 59 18.5 60 14.0 61 5.5 62 2.5 63 3.0 64 4.0 65 1.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.625 #Duplication Level Percentage of deduplicated Percentage of total 1 94.61030383091149 89.525 2 5.151915455746367 9.75 3 0.18494055482166447 0.525 4 0.05284015852047556 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.1749999999999998 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.6124999999999998 0.0 0.0 0.0 0.0 120-121 1.7999999999999998 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.4625000000000004 0.0 0.0 0.0 0.0 128-129 2.8625 0.0 0.0 0.0 0.0 130-131 3.175 0.0 0.0 0.0 0.0 132-133 3.45 0.0 0.0 0.0 0.0 134-135 3.7 0.0 0.0 0.0 0.0 136-137 3.9625000000000004 0.0 0.0 0.0 0.0 138-139 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATAGAG 10 0.006830828 145.0 5 AGATAGT 10 0.006830828 145.0 1 >>END_MODULE SRR12671686 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671686_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2055 37.0 37.0 37.0 37.0 37.0 2 35.9735 37.0 37.0 37.0 37.0 37.0 3 36.1445 37.0 37.0 37.0 37.0 37.0 4 36.1565 37.0 37.0 37.0 37.0 37.0 5 36.2135 37.0 37.0 37.0 37.0 37.0 6 36.17 37.0 37.0 37.0 37.0 37.0 7 36.321 37.0 37.0 37.0 37.0 37.0 8 36.287 37.0 37.0 37.0 37.0 37.0 9 36.186 37.0 37.0 37.0 37.0 37.0 10-14 36.256099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2328 37.0 37.0 37.0 37.0 37.0 20-24 36.2247 37.0 37.0 37.0 37.0 37.0 25-29 36.188 37.0 37.0 37.0 37.0 37.0 30-34 36.2008 37.0 37.0 37.0 37.0 37.0 35-39 36.149800000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.120599999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.125 37.0 37.0 37.0 37.0 37.0 50-54 36.108999999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.0095 37.0 37.0 37.0 37.0 37.0 60-64 35.991200000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.955 37.0 37.0 37.0 37.0 37.0 70-74 35.9423 37.0 37.0 37.0 37.0 37.0 75-79 35.8448 37.0 37.0 37.0 37.0 37.0 80-84 35.8864 37.0 37.0 37.0 37.0 37.0 85-89 35.8213 37.0 37.0 37.0 37.0 37.0 90-94 35.778800000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.7996 37.0 37.0 37.0 37.0 37.0 100-104 35.7885 37.0 37.0 37.0 37.0 37.0 105-109 35.7604 37.0 37.0 37.0 37.0 37.0 110-114 35.637 37.0 37.0 37.0 37.0 37.0 115-119 35.6345 37.0 37.0 37.0 37.0 37.0 120-124 35.6819 37.0 37.0 37.0 37.0 37.0 125-129 35.5536 37.0 37.0 37.0 37.0 37.0 130-134 35.6221 37.0 37.0 37.0 37.0 37.0 135-139 35.4867 37.0 37.0 37.0 37.0 37.0 140-144 35.2856 37.0 37.0 37.0 32.2 37.0 145-149 35.4003 37.0 37.0 37.0 34.6 37.0 150-151 34.955 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 2.0 15 2.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 3.0 22 3.0 23 4.0 24 2.0 25 10.0 26 14.0 27 11.0 28 19.0 29 32.0 30 33.0 31 33.0 32 53.0 33 113.0 34 193.0 35 564.0 36 2655.0 37 250.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.175 20.0 12.775 32.05 2 25.3 22.475 36.425000000000004 15.8 3 19.975 26.55 32.1 21.375 4 23.025000000000002 35.725 22.525000000000002 18.725 5 22.975 37.95 21.675 17.4 6 18.925 38.05 23.375 19.650000000000002 7 18.4 17.95 40.949999999999996 22.7 8 19.3 23.849999999999998 27.800000000000004 29.049999999999997 9 20.225 24.125 31.225 24.425 10-14 22.884999999999998 28.035 27.165 21.915000000000003 15-19 22.85 28.275 27.125 21.75 20-24 22.74 28.439999999999998 28.225 20.595 25-29 22.03 28.499999999999996 27.845 21.625 30-34 22.29 27.955000000000002 28.349999999999998 21.404999999999998 35-39 22.425 27.83 28.299999999999997 21.445 40-44 22.919999999999998 27.465 28.28 21.335 45-49 22.355 28.08 27.955000000000002 21.61 50-54 23.044999999999998 27.034999999999997 28.625 21.295 55-59 22.765 27.534999999999997 28.325 21.375 60-64 22.71 27.57 28.389999999999997 21.33 65-69 23.03 27.334999999999997 27.884999999999998 21.75 70-74 23.02 28.02 27.894999999999996 21.065 75-79 22.595000000000002 27.735 27.894999999999996 21.775 80-84 23.5 28.18 27.205000000000002 21.115000000000002 85-89 23.375 28.24 27.439999999999998 20.945 90-94 23.185 28.549999999999997 27.11 21.154999999999998 95-99 23.72 28.02 27.279999999999998 20.979999999999997 100-104 23.18 28.275 27.41 21.135 105-109 23.415 28.34 27.93 20.315 110-114 23.215 27.725 28.084999999999997 20.974999999999998 115-119 24.02 27.975 27.58 20.424999999999997 120-124 24.15 27.295 27.700000000000003 20.855 125-129 23.515 28.139999999999997 27.38 20.965 130-134 23.895 28.005000000000003 27.224999999999998 20.875 135-139 24.349999999999998 27.634999999999998 27.439999999999998 20.575 140-144 24.8 27.54 27.060000000000002 20.599999999999998 145-149 25.05 27.395000000000003 27.525 20.03 150-151 24.2625 28.037499999999998 27.737499999999997 19.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 1.0 13 1.0 14 0.5 15 1.0 16 1.5 17 1.0 18 1.0 19 2.0 20 1.5 21 0.5 22 1.0 23 2.0 24 1.0 25 1.5 26 5.0 27 7.5 28 6.0 29 7.5 30 15.0 31 21.0 32 34.0 33 43.5 34 50.0 35 70.0 36 90.5 37 104.5 38 137.5 39 175.5 40 186.0 41 210.0 42 225.5 43 250.5 44 268.0 45 275.0 46 275.5 47 236.0 48 225.0 49 205.0 50 157.0 51 128.0 52 114.5 53 103.0 54 86.0 55 66.0 56 55.0 57 46.5 58 30.0 59 21.5 60 15.5 61 6.5 62 9.5 63 9.0 64 3.0 65 0.5 66 0.5 67 0.5 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.425 #Duplication Level Percentage of deduplicated Percentage of total 1 94.62536404553879 89.35 2 5.003971405877681 9.45 3 0.23828435266084197 0.675 4 0.10590415673815197 0.4 5 0.026476039184537992 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2000000000000002 0.0 0.0 0.0 0.0 114-115 1.3375 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.85 0.0 0.0 0.0 0.0 122-123 2.0625 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.4625000000000004 0.0 0.0 0.0 0.0 128-129 2.8625 0.0 0.0 0.0 0.0 130-131 3.175 0.0 0.0 0.0 0.0 132-133 3.4375 0.0 0.0 0.0 0.0 134-135 3.6625 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138-139 4.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACTCT 10 0.006830828 145.0 8 >>END_MODULE Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754017 spots for SRR12671686.sra Written 754017 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra Read 754002 spots for SRR12671686.sra Written 754002 spots for SRR12671686.sra SRR ids: ['SRR12671686.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pfy37hgh SRR12671686.sra spots: 15080055 blocks: [[1, 754002], [754003, 1508004], [1508005, 2262006], [2262007, 3016008], [3016009, 3770010], [3770011, 4524012], [4524013, 5278014], [5278015, 6032016], [6032017, 6786018], [6786019, 7540020], [7540021, 8294022], [8294023, 9048024], [9048025, 9802026], [9802027, 10556028], [10556029, 11310030], [11310031, 12064032], [12064033, 12818034], [12818035, 13572036], [13572037, 14326038], [14326039, 15080055]] SRR12671686 file size 5103162 SRR12671686 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671686 SRR12671686_1.fastq SRR12671686_2.fastq Input file: SRR12671686_1.fastq Paired file: SRR12671686_2.fastq trimmed: SRR12671686-trimmed-pair1.fastq, SRR12671686-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:06:17 2025 >> started Wed Feb 12 03:06:34 2025 >> done (17.409s) 15080055 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 878 ( 0.01%) empty read pairs filtered out after trimming by size control 15079159 (99.99%) read pairs available; of these: 1004443 ( 6.66%) trimmed read pairs available after processing 14074716 (93.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 4 0.00% 21 2 0.00% 22 4 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 5 0.00% 27 4 0.00% 28 6 0.00% 29 2 0.00% 30 4 0.00% 31 5 0.00% 32 4 0.00% 33 5 0.00% 34 9 0.00% 35 10 0.00% 36 8 0.00% 37 11 0.00% 38 6 0.00% 39 16 0.00% 40 13 0.00% 41 15 0.00% 42 14 0.00% 43 21 0.00% 44 17 0.00% 45 25 0.00% 46 32 0.00% 47 20 0.00% 48 23 0.00% 49 34 0.00% 50 53 0.00% 51 44 0.00% 52 48 0.00% 53 58 0.00% 54 41 0.00% 55 59 0.00% 56 40 0.00% 57 69 0.00% 58 72 0.00% 59 88 0.00% 60 94 0.00% 61 109 0.00% 62 131 0.00% 63 144 0.00% 64 169 0.00% 65 146 0.00% 66 155 0.00% 67 172 0.00% 68 184 0.00% 69 247 0.00% 70 290 0.00% 71 340 0.00% 72 350 0.00% 73 444 0.00% 74 520 0.00% 75 543 0.00% 76 620 0.00% 77 644 0.00% 78 630 0.00% 79 801 0.01% 80 887 0.01% 81 1019 0.01% 82 1166 0.01% 83 1392 0.01% 84 1475 0.01% 85 1647 0.01% 86 1862 0.01% 87 1844 0.01% 88 1993 0.01% 89 2262 0.02% 90 2466 0.02% 91 2795 0.02% 92 3104 0.02% 93 3480 0.02% 94 3777 0.03% 95 4189 0.03% 96 4409 0.03% 97 4577 0.03% 98 4739 0.03% 99 5007 0.03% 100 5402 0.04% 101 5922 0.04% 102 6576 0.04% 103 7198 0.05% 104 7505 0.05% 105 8020 0.05% 106 8369 0.06% 107 8566 0.06% 108 8830 0.06% 109 8931 0.06% 110 9577 0.06% 111 10119 0.07% 112 10804 0.07% 113 11263 0.07% 114 12073 0.08% 115 13052 0.09% 116 13259 0.09% 117 13552 0.09% 118 14133 0.09% 119 14261 0.09% 120 14766 0.10% 121 15498 0.10% 122 15933 0.11% 123 17057 0.11% 124 17900 0.12% 125 18502 0.12% 126 19136 0.13% 127 19187 0.13% 128 19529 0.13% 129 20040 0.13% 130 20376 0.14% 131 20807 0.14% 132 21751 0.14% 133 22664 0.15% 134 23549 0.16% 135 24433 0.16% 136 25094 0.17% 137 25790 0.17% 138 26098 0.17% 139 26350 0.17% 140 26367 0.17% 141 26434 0.18% 142 27622 0.18% 143 28578 0.19% 144 29980 0.20% 145 31011 0.21% 146 31982 0.21% 147 32041 0.21% 148 32625 0.22% 149 31839 0.21% 150 32374 0.21% 151 14074716 93.34% 15079159 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=24 prefix-density=0.51 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=91.31 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=7.9 sequence=TTCATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGATATAGCTAGGGACACATCAAGTTCTGGGACGACTTAGACACCTTTCGGCTTGGCGGCAATAAAGCTGATGCACTGCACTTGACG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=29 prefix-density=0.72 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=20 fanout-score=9.14 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=6.6 sequence=ATGCTTCTTGCACCAC SRR12671686 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:07:17 Started mapping on | Feb 12 03:07:17 Finished on | Feb 12 03:08:55 Mapping speed, Million of reads per hour | 553.93 Number of input reads | 15079159 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 13935474 Uniquely mapped reads % | 92.42% Average mapped length | 297.74 Number of splices: Total | 14052656 Number of splices: Annotated (sjdb) | 13769519 Number of splices: GT/AG | 13772371 Number of splices: GC/AG | 236295 Number of splices: AT/AC | 8728 Number of splices: Non-canonical | 35262 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352183 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 180002 % of reads mapped to too many loci | 1.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.84% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 791502 791502 791502 N_multimapping 352183 352183 352183 N_noFeature 600588 13728873 670750 N_ambiguous 218994 1124 81994 UnstrandedReadsAssigned:13115892 PositiveStrandReadsAssigned:205477 NegativeStrandReadsAssigned:13182730 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671686 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671686-trimmed-pair1.fastq SRR12671686-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,079,159 reads, 13,266,407 reads pseudoaligned [quant] estimated average fragment length: 298.479 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR12671686.ke.tsv 34699 SRR12671686.se.tsv 87100 total ==> SRR12671686.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1720.52 420 17.8692 Potri.005G024800.1.v4.1 1035 737.521 229 22.7288 Potri.004G059700.1.v4.1 961 664.216 0 0 Potri.007G009000.2.v4.1 1416 1118.52 0 0 Potri.003G141000.2.v4.1 2943 2645.52 683 18.8984 Potri.016G087400.1.v4.1 270 78.6308 410 381.687 Potri.015G069301.1.v4.1 564 296.727 0 0 Potri.010G195200.1.v4.1 1773 1475.52 39 1.9348 Potri.012G127500.1.v4.1 977 679.903 59 6.35215 ==> SRR12671686.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 85 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 141 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671686 completed mapping pipeline successfully