Starting /dee2/code/volunteer_pipeline.sh SRR12671687 current disk space = 3048867815424 free memory = 1540043084 SRR12671687 SRAfilesize 6195d49baedb4936f58cde66b6561d9d SRR12671687.sra SRR12671687.sra file validated SRR12671687 is paired end SRR12671687 is conventional basespace SRR12671687 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671687_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.351 37.0 37.0 37.0 37.0 37.0 2 36.236 37.0 37.0 37.0 37.0 37.0 3 36.4245 37.0 37.0 37.0 37.0 37.0 4 36.493 37.0 37.0 37.0 37.0 37.0 5 36.5185 37.0 37.0 37.0 37.0 37.0 6 36.5215 37.0 37.0 37.0 37.0 37.0 7 36.4165 37.0 37.0 37.0 37.0 37.0 8 36.5455 37.0 37.0 37.0 37.0 37.0 9 36.53 37.0 37.0 37.0 37.0 37.0 10-14 36.52419999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4693 37.0 37.0 37.0 37.0 37.0 20-24 36.4602 37.0 37.0 37.0 37.0 37.0 25-29 36.431 37.0 37.0 37.0 37.0 37.0 30-34 36.4116 37.0 37.0 37.0 37.0 37.0 35-39 36.41030000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.3728 37.0 37.0 37.0 37.0 37.0 45-49 36.4172 37.0 37.0 37.0 37.0 37.0 50-54 36.3655 37.0 37.0 37.0 37.0 37.0 55-59 36.3822 37.0 37.0 37.0 37.0 37.0 60-64 36.390699999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.3263 37.0 37.0 37.0 37.0 37.0 70-74 36.3187 37.0 37.0 37.0 37.0 37.0 75-79 36.2857 37.0 37.0 37.0 37.0 37.0 80-84 36.2812 37.0 37.0 37.0 37.0 37.0 85-89 36.2719 37.0 37.0 37.0 37.0 37.0 90-94 36.2347 37.0 37.0 37.0 37.0 37.0 95-99 36.1631 37.0 37.0 37.0 37.0 37.0 100-104 36.2214 37.0 37.0 37.0 37.0 37.0 105-109 36.1683 37.0 37.0 37.0 37.0 37.0 110-114 36.1533 37.0 37.0 37.0 37.0 37.0 115-119 36.106 37.0 37.0 37.0 37.0 37.0 120-124 36.0255 37.0 37.0 37.0 37.0 37.0 125-129 35.9839 37.0 37.0 37.0 37.0 37.0 130-134 35.933 37.0 37.0 37.0 37.0 37.0 135-139 35.946400000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.936400000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.8766 37.0 37.0 37.0 37.0 37.0 150-151 35.422250000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 0.0 25 1.0 26 0.0 27 5.0 28 11.0 29 24.0 30 21.0 31 49.0 32 48.0 33 75.0 34 127.0 35 312.0 36 2973.0 37 353.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.874999999999996 17.05 10.674999999999999 40.400000000000006 2 20.42042042042042 20.995995995995994 38.33833833833834 20.245245245245243 3 16.75 28.95 27.55 26.75 4 21.6 33.5 24.625 20.275000000000002 5 20.95 38.275 22.650000000000002 18.125 6 17.1 35.85 26.450000000000003 20.599999999999998 7 13.875000000000002 20.25 45.725 20.150000000000002 8 17.9 22.325 29.849999999999998 29.925 9 17.125 21.95 33.2 27.725 10-14 19.445 28.810000000000002 27.134999999999998 24.610000000000003 15-19 19.215 28.38 28.355000000000004 24.05 20-24 19.81 28.560000000000002 27.83 23.799999999999997 25-29 19.245 28.34 28.065 24.349999999999998 30-34 19.49 28.105000000000004 28.28 24.125 35-39 19.465 28.28 27.975 24.279999999999998 40-44 19.46 28.744999999999997 27.445000000000004 24.349999999999998 45-49 19.6 29.220000000000002 26.695 24.485 50-54 20.200000000000003 28.46 27.650000000000002 23.69 55-59 19.495 28.299999999999997 27.42 24.785 60-64 19.935 28.285 27.655 24.125 65-69 20.005 28.395 27.37 24.23 70-74 19.42 28.22 28.044999999999998 24.315 75-79 20.06 28.610000000000003 27.589999999999996 23.74 80-84 19.975 27.79 27.584999999999997 24.65 85-89 20.275000000000002 28.084999999999997 27.994999999999997 23.645 90-94 20.4 28.175 28.194999999999997 23.23 95-99 20.495 28.199999999999996 27.894999999999996 23.41 100-104 20.585 27.889999999999997 27.71 23.815 105-109 20.21 27.779999999999998 28.26 23.75 110-114 20.825 27.845 27.345000000000002 23.985 115-119 20.599999999999998 28.265 27.235 23.9 120-124 20.424999999999997 28.215 27.084999999999997 24.275 125-129 20.445 28.685 27.235 23.635 130-134 20.885 27.700000000000003 27.61 23.805 135-139 20.715 28.08 27.55 23.655 140-144 20.565 28.84 27.32 23.275000000000002 145-149 20.830000000000002 28.310000000000002 27.345000000000002 23.515 150-151 22.0 27.712500000000002 27.212500000000002 23.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 1.0 16 1.0 17 1.5 18 2.0 19 1.0 20 0.5 21 0.5 22 2.0 23 3.0 24 3.0 25 5.5 26 7.0 27 9.0 28 9.5 29 11.0 30 19.0 31 26.5 32 29.5 33 38.5 34 54.5 35 80.5 36 99.0 37 119.0 38 137.5 39 153.0 40 188.5 41 219.5 42 238.0 43 248.5 44 260.0 45 265.5 46 254.5 47 247.0 48 234.5 49 196.0 50 170.0 51 158.5 52 123.5 53 87.5 54 74.5 55 64.5 56 49.0 57 30.0 58 16.5 59 14.5 60 12.0 61 7.5 62 5.5 63 4.0 64 4.5 65 3.5 66 1.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.0 #Duplication Level Percentage of deduplicated Percentage of total 1 93.01075268817203 86.5 2 6.505376344086021 12.1 3 0.43010752688172044 1.2 4 0.053763440860215055 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.5875 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 0.9875 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.35 0.0 0.0 0.0 0.0 130-131 1.55 0.0 0.0 0.0 0.0 132-133 1.7875 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.3499999999999996 0.0 0.0 0.0 0.0 138-139 2.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACAGAA 10 0.006830828 145.0 2 TTTTCAC 10 0.006830828 145.0 5 GTAGTCG 10 0.006830828 145.0 3 >>END_MODULE SRR12671687 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671687_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.958 37.0 37.0 37.0 37.0 37.0 2 35.789 37.0 37.0 37.0 37.0 37.0 3 35.9815 37.0 37.0 37.0 37.0 37.0 4 35.8965 37.0 37.0 37.0 37.0 37.0 5 36.1145 37.0 37.0 37.0 37.0 37.0 6 36.0895 37.0 37.0 37.0 37.0 37.0 7 36.0615 37.0 37.0 37.0 37.0 37.0 8 36.062 37.0 37.0 37.0 37.0 37.0 9 36.093 37.0 37.0 37.0 37.0 37.0 10-14 36.0573 37.0 37.0 37.0 37.0 37.0 15-19 36.1056 37.0 37.0 37.0 37.0 37.0 20-24 36.050200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.040200000000006 37.0 37.0 37.0 37.0 37.0 30-34 35.951100000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.9449 37.0 37.0 37.0 37.0 37.0 40-44 35.876999999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.882799999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.9267 37.0 37.0 37.0 37.0 37.0 55-59 35.79260000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.7631 37.0 37.0 37.0 37.0 37.0 65-69 35.740300000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.722699999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.6272 37.0 37.0 37.0 37.0 37.0 80-84 35.6618 37.0 37.0 37.0 37.0 37.0 85-89 35.6499 37.0 37.0 37.0 37.0 37.0 90-94 35.5273 37.0 37.0 37.0 37.0 37.0 95-99 35.56529999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.5411 37.0 37.0 37.0 37.0 37.0 105-109 35.4693 37.0 37.0 37.0 37.0 37.0 110-114 35.470400000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.5249 37.0 37.0 37.0 37.0 37.0 120-124 35.3796 37.0 37.0 37.0 37.0 37.0 125-129 35.376999999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.3808 37.0 37.0 37.0 37.0 37.0 135-139 35.317899999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.1507 37.0 37.0 37.0 27.4 37.0 145-149 35.209599999999995 37.0 37.0 37.0 32.2 37.0 150-151 34.77225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 2.0 21 3.0 22 5.0 23 3.0 24 6.0 25 11.0 26 14.0 27 25.0 28 19.0 29 26.0 30 38.0 31 55.0 32 83.0 33 138.0 34 245.0 35 636.0 36 2522.0 37 161.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.5 19.975 14.325 31.2 2 25.825 24.675 34.925 14.575 3 20.674999999999997 27.875 31.275 20.175 4 22.725 36.325 22.8 18.15 5 23.549999999999997 37.475 20.775 18.2 6 18.099999999999998 38.35 23.275000000000002 20.275000000000002 7 17.1 18.575 42.5 21.825 8 21.125 23.25 26.8 28.825 9 20.125 23.225 29.775000000000002 26.875 10-14 22.14 28.665000000000003 26.565 22.63 15-19 22.365 28.465 27.735 21.435000000000002 20-24 22.14 27.944999999999997 28.355000000000004 21.560000000000002 25-29 22.555 28.52 27.965 20.96 30-34 22.375 28.37 27.775 21.48 35-39 22.770000000000003 27.860000000000003 28.125 21.245 40-44 22.37 28.134999999999998 27.605 21.89 45-49 22.900000000000002 28.475 27.315 21.310000000000002 50-54 22.64 28.360000000000003 27.615000000000002 21.385 55-59 22.81 27.54 27.685 21.965 60-64 22.814999999999998 27.339999999999996 28.299999999999997 21.545 65-69 23.22 27.58 27.855 21.345 70-74 23.35 27.97 27.215 21.465 75-79 23.025000000000002 28.375 26.545 22.055 80-84 23.36 27.450000000000003 27.36 21.83 85-89 23.48 27.915 27.155 21.45 90-94 23.34 27.825 28.134999999999998 20.7 95-99 23.080000000000002 28.175 27.560000000000002 21.185000000000002 100-104 22.955000000000002 28.215 27.450000000000003 21.38 105-109 22.884999999999998 28.189999999999998 28.105000000000004 20.82 110-114 23.169999999999998 28.804999999999996 27.37 20.655 115-119 23.935000000000002 27.51 27.255000000000003 21.3 120-124 23.895 27.79 27.6 20.715 125-129 23.855 28.565 27.01 20.57 130-134 23.665 27.500000000000004 27.925 20.91 135-139 23.794999999999998 27.6 27.415 21.19 140-144 23.76 28.025 27.525 20.69 145-149 24.19 28.225 27.250000000000004 20.335 150-151 24.3625 27.875 27.325 20.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 1.5 21 1.5 22 1.0 23 1.0 24 1.5 25 4.0 26 4.0 27 5.5 28 10.0 29 12.0 30 13.0 31 23.5 32 39.0 33 38.0 34 41.0 35 58.0 36 79.0 37 102.5 38 128.5 39 169.0 40 189.5 41 200.5 42 246.0 43 266.5 44 252.5 45 276.0 46 269.0 47 244.0 48 227.5 49 198.0 50 177.0 51 143.0 52 109.0 53 95.5 54 88.5 55 70.5 56 55.5 57 36.0 58 23.5 59 24.5 60 21.5 61 11.0 62 5.5 63 7.5 64 7.0 65 4.5 66 2.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.95 #Duplication Level Percentage of deduplicated Percentage of total 1 93.16837009144702 86.6 2 6.293706293706294 11.700000000000001 3 0.4034427111350188 1.125 4 0.08068854222700376 0.3 5 0.026896180742334585 0.125 6 0.026896180742334585 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.8374999999999999 0.0 0.0 0.0 0.0 124-125 0.9624999999999999 0.0 0.0 0.0 0.0 126-127 1.2 0.0 0.0 0.0 0.0 128-129 1.3250000000000002 0.0 0.0 0.0 0.0 130-131 1.525 0.0 0.0 0.0 0.0 132-133 1.775 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.3499999999999996 0.0 0.0 0.0 0.0 138-139 2.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTCTG 10 0.006830828 145.0 9 GGATTCT 25 8.7132835E-4 87.0 1 TCACTCA 20 0.00593511 29.0 45-49 >>END_MODULE Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra Read 950733 spots for SRR12671687.sra Written 950733 spots for SRR12671687.sra Read 950732 spots for SRR12671687.sra Written 950732 spots for SRR12671687.sra SRR ids: ['SRR12671687.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ctby5ni8 SRR12671687.sra spots: 19014641 blocks: [[1, 950732], [950733, 1901464], [1901465, 2852196], [2852197, 3802928], [3802929, 4753660], [4753661, 5704392], [5704393, 6655124], [6655125, 7605856], [7605857, 8556588], [8556589, 9507320], [9507321, 10458052], [10458053, 11408784], [11408785, 12359516], [12359517, 13310248], [13310249, 14260980], [14260981, 15211712], [15211713, 16162444], [16162445, 17113176], [17113177, 18063908], [18063909, 19014641]] SRR12671687 file size 6440306 SRR12671687 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671687 SRR12671687_1.fastq SRR12671687_2.fastq Input file: SRR12671687_1.fastq Paired file: SRR12671687_2.fastq trimmed: SRR12671687-trimmed-pair1.fastq, SRR12671687-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:44:06 2025 >> started Wed Feb 12 03:44:26 2025 >> done (19.893s) 19014641 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 1349 ( 0.01%) empty read pairs filtered out after trimming by size control 19013271 (99.99%) read pairs available; of these: 862535 ( 4.54%) trimmed read pairs available after processing 18150736 (95.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 3 0.00% 21 3 0.00% 22 3 0.00% 23 2 0.00% 24 4 0.00% 25 4 0.00% 26 3 0.00% 27 7 0.00% 28 3 0.00% 29 14 0.00% 30 7 0.00% 31 6 0.00% 32 11 0.00% 33 11 0.00% 34 7 0.00% 35 9 0.00% 36 8 0.00% 37 12 0.00% 38 13 0.00% 39 11 0.00% 40 19 0.00% 41 19 0.00% 42 27 0.00% 43 28 0.00% 44 23 0.00% 45 30 0.00% 46 30 0.00% 47 39 0.00% 48 29 0.00% 49 41 0.00% 50 38 0.00% 51 60 0.00% 52 63 0.00% 53 67 0.00% 54 73 0.00% 55 59 0.00% 56 63 0.00% 57 68 0.00% 58 83 0.00% 59 107 0.00% 60 87 0.00% 61 118 0.00% 62 131 0.00% 63 169 0.00% 64 143 0.00% 65 181 0.00% 66 173 0.00% 67 210 0.00% 68 213 0.00% 69 229 0.00% 70 297 0.00% 71 324 0.00% 72 336 0.00% 73 445 0.00% 74 465 0.00% 75 494 0.00% 76 578 0.00% 77 602 0.00% 78 658 0.00% 79 737 0.00% 80 792 0.00% 81 931 0.00% 82 1148 0.01% 83 1230 0.01% 84 1395 0.01% 85 1481 0.01% 86 1602 0.01% 87 1716 0.01% 88 1812 0.01% 89 1872 0.01% 90 2067 0.01% 91 2382 0.01% 92 2654 0.01% 93 2948 0.02% 94 3227 0.02% 95 3498 0.02% 96 3666 0.02% 97 3828 0.02% 98 3913 0.02% 99 4235 0.02% 100 4546 0.02% 101 4848 0.03% 102 5355 0.03% 103 5703 0.03% 104 6092 0.03% 105 6498 0.03% 106 6764 0.04% 107 6895 0.04% 108 7280 0.04% 109 7489 0.04% 110 7757 0.04% 111 8086 0.04% 112 8935 0.05% 113 9251 0.05% 114 9804 0.05% 115 10405 0.05% 116 10839 0.06% 117 11285 0.06% 118 11275 0.06% 119 11648 0.06% 120 11954 0.06% 121 12598 0.07% 122 13043 0.07% 123 14032 0.07% 124 14764 0.08% 125 15264 0.08% 126 15979 0.08% 127 16082 0.08% 128 16403 0.09% 129 16491 0.09% 130 17457 0.09% 131 17555 0.09% 132 18238 0.10% 133 19440 0.10% 134 20387 0.11% 135 21119 0.11% 136 21706 0.11% 137 22057 0.12% 138 22789 0.12% 139 22741 0.12% 140 22872 0.12% 141 23516 0.12% 142 24579 0.13% 143 25720 0.14% 144 26923 0.14% 145 27509 0.14% 146 28841 0.15% 147 29068 0.15% 148 29641 0.16% 149 29461 0.15% 150 29455 0.15% 151 18150736 95.46% 19013271 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=24 prefix-density=0.41 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=120.95 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.6 sequence=CAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=35 prefix-density=0.75 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=34.62 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.5 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTT SRR12671687 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:45:10 Started mapping on | Feb 12 03:45:10 Finished on | Feb 12 03:47:10 Mapping speed, Million of reads per hour | 570.40 Number of input reads | 19013271 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 17710557 Uniquely mapped reads % | 93.15% Average mapped length | 298.57 Number of splices: Total | 18337937 Number of splices: Annotated (sjdb) | 17945340 Number of splices: GT/AG | 17976261 Number of splices: GC/AG | 298260 Number of splices: AT/AC | 10425 Number of splices: Non-canonical | 52991 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 459320 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 135101 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.57% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 843394 843394 843394 N_multimapping 459320 459320 459320 N_noFeature 660998 17416057 751255 N_ambiguous 330451 1358 125441 UnstrandedReadsAssigned:16719108 PositiveStrandReadsAssigned:293142 NegativeStrandReadsAssigned:16833861 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671687 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671687-trimmed-pair1.fastq SRR12671687-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,013,271 reads, 16,851,928 reads pseudoaligned [quant] estimated average fragment length: 310.983 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR12671687.ke.tsv 34699 SRR12671687.se.tsv 87100 total ==> SRR12671687.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1708.02 864 27.3321 Potri.005G024800.1.v4.1 1035 725.017 315 23.4754 Potri.004G059700.1.v4.1 961 651.642 0 0 Potri.007G009000.2.v4.1 1416 1106.02 0 0 Potri.003G141000.2.v4.1 2943 2633.02 1168.57 23.9802 Potri.016G087400.1.v4.1 270 72.3046 981 733.085 Potri.015G069301.1.v4.1 564 285.298 0 0 Potri.010G195200.1.v4.1 1773 1463.02 136 5.02274 Potri.012G127500.1.v4.1 977 667.362 82 6.63901 ==> SRR12671687.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 86 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 28 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671687 completed mapping pipeline successfully