Starting /dee2/code/volunteer_pipeline.sh SRR12671688 current disk space = 3048947245056 free memory = 1483568848 SRR12671688 SRAfilesize 461e0134d5963abf4745cda4ddee889c SRR12671688.sra SRR12671688.sra file validated SRR12671688 is paired end SRR12671688 is conventional basespace SRR12671688 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671688_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.536 37.0 37.0 37.0 37.0 37.0 2 36.18375 37.0 37.0 37.0 37.0 37.0 3 36.5375 37.0 37.0 37.0 37.0 37.0 4 36.5935 37.0 37.0 37.0 37.0 37.0 5 36.4875 37.0 37.0 37.0 37.0 37.0 6 36.544 37.0 37.0 37.0 37.0 37.0 7 36.494 37.0 37.0 37.0 37.0 37.0 8 36.5845 37.0 37.0 37.0 37.0 37.0 9 36.5035 37.0 37.0 37.0 37.0 37.0 10-14 36.5412 37.0 37.0 37.0 37.0 37.0 15-19 36.5134 37.0 37.0 37.0 37.0 37.0 20-24 36.5455 37.0 37.0 37.0 37.0 37.0 25-29 36.487399999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.4864 37.0 37.0 37.0 37.0 37.0 35-39 36.4514 37.0 37.0 37.0 37.0 37.0 40-44 36.44539999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.4037 37.0 37.0 37.0 37.0 37.0 50-54 36.377 37.0 37.0 37.0 37.0 37.0 55-59 36.3678 37.0 37.0 37.0 37.0 37.0 60-64 36.3586 37.0 37.0 37.0 37.0 37.0 65-69 36.3442 37.0 37.0 37.0 37.0 37.0 70-74 36.3374 37.0 37.0 37.0 37.0 37.0 75-79 36.3428 37.0 37.0 37.0 37.0 37.0 80-84 36.3025 37.0 37.0 37.0 37.0 37.0 85-89 36.2787 37.0 37.0 37.0 37.0 37.0 90-94 36.215700000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.1524 37.0 37.0 37.0 37.0 37.0 100-104 36.237700000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.138600000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.156000000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.1486 37.0 37.0 37.0 37.0 37.0 120-124 36.0541 37.0 37.0 37.0 37.0 37.0 125-129 36.066900000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.013999999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.0079 37.0 37.0 37.0 37.0 37.0 140-144 35.9517 37.0 37.0 37.0 37.0 37.0 145-149 35.813 37.0 37.0 37.0 37.0 37.0 150-151 35.505250000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 0.0 23 0.0 24 1.0 25 0.0 26 7.0 27 4.0 28 9.0 29 21.0 30 31.0 31 43.0 32 42.0 33 64.0 34 108.0 35 327.0 36 2966.0 37 375.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.225 12.25 13.65 43.875 2 19.44235116804823 19.593067068575735 37.98040693293142 22.984174830444612 3 18.125 24.875 27.700000000000003 29.299999999999997 4 22.0 32.475 22.45 23.075000000000003 5 21.775 34.699999999999996 24.625 18.9 6 18.5 35.85 25.1 20.549999999999997 7 13.900000000000002 22.75 44.275 19.075 8 18.375 23.775 29.575000000000003 28.275 9 17.724999999999998 23.799999999999997 32.125 26.35 10-14 19.655 29.099999999999998 27.21 24.035 15-19 20.125 28.285 27.72 23.87 20-24 19.395 28.749999999999996 27.689999999999998 24.165 25-29 19.81 27.894999999999996 28.050000000000004 24.245 30-34 19.91 28.560000000000002 27.415 24.115000000000002 35-39 19.994999999999997 28.225 27.825 23.955000000000002 40-44 20.200000000000003 28.37 28.105000000000004 23.325000000000003 45-49 20.76 27.700000000000003 27.560000000000002 23.98 50-54 20.24 28.365000000000002 27.36 24.035 55-59 20.43 28.485 27.075 24.01 60-64 20.195 27.839999999999996 27.605 24.36 65-69 20.77 27.665 27.229999999999997 24.335 70-74 20.59 28.599999999999998 26.340000000000003 24.47 75-79 20.595 28.060000000000002 27.284999999999997 24.060000000000002 80-84 20.830000000000002 27.860000000000003 26.625 24.685000000000002 85-89 20.794999999999998 27.47 26.815 24.92 90-94 21.029999999999998 27.750000000000004 27.47 23.75 95-99 20.835 27.195000000000004 27.894999999999996 24.075 100-104 20.925 27.495000000000005 27.27 24.310000000000002 105-109 20.765 27.315 27.365000000000002 24.555 110-114 20.305 27.235 28.050000000000004 24.41 115-119 20.7 27.650000000000002 27.325 24.325 120-124 21.240000000000002 27.175 27.605 23.98 125-129 21.240000000000002 27.405 27.245 24.11 130-134 21.32 26.93 27.365000000000002 24.385 135-139 21.67 27.445000000000004 26.974999999999998 23.91 140-144 21.395 27.515 26.290000000000003 24.8 145-149 21.18 26.979999999999997 26.790000000000003 25.05 150-151 21.712500000000002 26.674999999999997 27.3875 24.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 2.0 22 2.5 23 2.5 24 2.5 25 2.0 26 4.0 27 6.0 28 7.5 29 10.5 30 18.0 31 25.0 32 29.0 33 43.5 34 62.5 35 71.5 36 89.5 37 113.0 38 127.0 39 154.0 40 175.5 41 185.0 42 201.5 43 223.0 44 232.5 45 245.5 46 251.0 47 249.0 48 256.0 49 234.5 50 202.0 51 166.5 52 128.5 53 114.5 54 93.5 55 63.0 56 50.0 57 41.5 58 32.5 59 25.5 60 18.5 61 12.5 62 8.0 63 5.0 64 4.0 65 2.0 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.45 #Duplication Level Percentage of deduplicated Percentage of total 1 92.61763115197404 85.625 2 6.679286100594917 12.35 3 0.6489994591671173 1.7999999999999998 4 0.027041644131963225 0.1 5 0.027041644131963225 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTACAATCCAAGAGCACCCAGAGGAGTCTTGCCTTGACCAGCCTCGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4375 0.0 0.0 0.0 0.0 120-121 1.5499999999999998 0.0 0.0 0.0 0.0 122-123 1.7000000000000002 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.675 0.0 0.0 0.0 0.0 132-133 3.05 0.0 0.0 0.0 0.0 134-135 3.4749999999999996 0.0 0.0 0.0 0.0 136-137 3.775 0.0 0.0 0.0 0.0 138-139 4.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671688 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671688_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.33 37.0 37.0 37.0 37.0 37.0 2 36.056 37.0 37.0 37.0 37.0 37.0 3 36.2835 37.0 37.0 37.0 37.0 37.0 4 36.273 37.0 37.0 37.0 37.0 37.0 5 36.2585 37.0 37.0 37.0 37.0 37.0 6 36.276 37.0 37.0 37.0 37.0 37.0 7 36.2705 37.0 37.0 37.0 37.0 37.0 8 36.3235 37.0 37.0 37.0 37.0 37.0 9 36.2905 37.0 37.0 37.0 37.0 37.0 10-14 36.3428 37.0 37.0 37.0 37.0 37.0 15-19 36.2393 37.0 37.0 37.0 37.0 37.0 20-24 36.235699999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.1695 37.0 37.0 37.0 37.0 37.0 30-34 36.2246 37.0 37.0 37.0 37.0 37.0 35-39 36.144600000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.2157 37.0 37.0 37.0 37.0 37.0 45-49 36.1515 37.0 37.0 37.0 37.0 37.0 50-54 36.1194 37.0 37.0 37.0 37.0 37.0 55-59 36.0673 37.0 37.0 37.0 37.0 37.0 60-64 36.027100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.0059 37.0 37.0 37.0 37.0 37.0 70-74 36.0419 37.0 37.0 37.0 37.0 37.0 75-79 35.9506 37.0 37.0 37.0 37.0 37.0 80-84 35.957899999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.910000000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.903 37.0 37.0 37.0 37.0 37.0 95-99 35.932 37.0 37.0 37.0 37.0 37.0 100-104 35.8389 37.0 37.0 37.0 37.0 37.0 105-109 35.868700000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.78000000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.837799999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.7826 37.0 37.0 37.0 37.0 37.0 125-129 35.6952 37.0 37.0 37.0 37.0 37.0 130-134 35.7041 37.0 37.0 37.0 37.0 37.0 135-139 35.663 37.0 37.0 37.0 37.0 37.0 140-144 35.473200000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.5704 37.0 37.0 37.0 37.0 37.0 150-151 35.258250000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 2.0 15 0.0 16 1.0 17 1.0 18 2.0 19 2.0 20 1.0 21 5.0 22 5.0 23 10.0 24 7.0 25 3.0 26 7.0 27 8.0 28 13.0 29 19.0 30 32.0 31 34.0 32 53.0 33 73.0 34 145.0 35 470.0 36 2856.0 37 247.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.975 18.35 17.625 31.05 2 26.825 22.95 33.375 16.85 3 20.775 25.874999999999996 31.374999999999996 21.975 4 23.775 33.625 22.425 20.175 5 25.95 36.775000000000006 20.125 17.150000000000002 6 19.25 39.025 22.7 19.025 7 19.975 17.849999999999998 40.525 21.65 8 21.425 23.7 26.450000000000003 28.425 9 22.725 23.724999999999998 29.225 24.325 10-14 24.19 27.310000000000002 26.27 22.23 15-19 23.65 28.185 26.11 22.055 20-24 22.985 28.34 26.82 21.855 25-29 23.805 27.505000000000003 26.66 22.03 30-34 23.169999999999998 28.310000000000002 26.99 21.529999999999998 35-39 23.825 27.589999999999996 26.71 21.875 40-44 23.544999999999998 28.16 26.61 21.685 45-49 23.895 28.249999999999996 26.484999999999996 21.37 50-54 23.895 28.065 26.314999999999998 21.725 55-59 24.12 27.215 26.745 21.92 60-64 24.26 27.560000000000002 26.950000000000003 21.23 65-69 23.82 27.355 26.729999999999997 22.095000000000002 70-74 24.315 27.584999999999997 27.0 21.099999999999998 75-79 23.895 28.115000000000002 26.534999999999997 21.455 80-84 24.145 27.79 26.43 21.634999999999998 85-89 24.43 27.68 27.155 20.735 90-94 24.2 27.744999999999997 26.655 21.4 95-99 24.245 27.165 27.21 21.38 100-104 24.43 27.345000000000002 26.97 21.255 105-109 24.46 27.77 26.805 20.965 110-114 24.585 28.005000000000003 26.400000000000002 21.01 115-119 24.265 28.139999999999997 26.275 21.32 120-124 23.93 27.650000000000002 26.97 21.45 125-129 24.92 28.000000000000004 26.11 20.97 130-134 24.5 27.865000000000002 26.505000000000003 21.13 135-139 24.54 27.705000000000002 26.75 21.005 140-144 24.55 28.134999999999998 26.384999999999998 20.93 145-149 25.575 27.495000000000005 26.69 20.24 150-151 25.874999999999996 27.537499999999998 25.924999999999997 20.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.5 15 0.5 16 1.0 17 2.0 18 1.5 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 0.5 25 0.5 26 2.0 27 1.5 28 3.0 29 5.0 30 3.0 31 7.0 32 12.5 33 21.0 34 31.0 35 40.0 36 56.0 37 71.0 38 89.5 39 122.5 40 164.5 41 210.0 42 235.0 43 251.5 44 269.5 45 285.5 46 275.5 47 270.0 48 267.0 49 218.5 50 200.0 51 184.0 52 145.5 53 124.5 54 105.5 55 75.5 56 51.0 57 39.5 58 27.5 59 21.5 60 27.0 61 21.5 62 8.5 63 9.0 64 9.0 65 4.5 66 3.5 67 3.0 68 2.5 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.075 #Duplication Level Percentage of deduplicated Percentage of total 1 93.3655654042439 86.9 2 6.01665323663712 11.200000000000001 3 0.4834810636583401 1.35 4 0.08058017727639001 0.3 5 0.05372011818426001 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTTATGCCCTGGGCGACACACGTGCTACAATGGCCGGGACAAAGGGTCG 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.2625 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.6749999999999998 0.0 0.0 0.0 0.0 124-125 1.9125 0.0 0.0 0.0 0.0 126-127 2.1500000000000004 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.675 0.0 0.0 0.0 0.0 132-133 3.05 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.8 0.0 0.0 0.0 0.0 138-139 4.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAGGG 10 0.006830828 145.0 3 >>END_MODULE Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268697 spots for SRR12671688.sra Written 1268697 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra Read 1268687 spots for SRR12671688.sra Written 1268687 spots for SRR12671688.sra SRR ids: ['SRR12671688.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o7u05dfp SRR12671688.sra spots: 25373750 blocks: [[1, 1268687], [1268688, 2537374], [2537375, 3806061], [3806062, 5074748], [5074749, 6343435], [6343436, 7612122], [7612123, 8880809], [8880810, 10149496], [10149497, 11418183], [11418184, 12686870], [12686871, 13955557], [13955558, 15224244], [15224245, 16492931], [16492932, 17761618], [17761619, 19030305], [19030306, 20298992], [20298993, 21567679], [21567680, 22836366], [22836367, 24105053], [24105054, 25373750]] SRR12671688 file size 8601409 SRR12671688 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671688 SRR12671688_1.fastq SRR12671688_2.fastq Input file: SRR12671688_1.fastq Paired file: SRR12671688_2.fastq trimmed: SRR12671688-trimmed-pair1.fastq, SRR12671688-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:23:49 2025 >> started Wed Feb 12 03:24:21 2025 >> done (32.240s) 25373750 read pairs processed; of these: 10 ( 0.00%) short read pairs filtered out after trimming by size control 4659 ( 0.02%) empty read pairs filtered out after trimming by size control 25369081 (99.98%) read pairs available; of these: 1679143 ( 6.62%) trimmed read pairs available after processing 23689938 (93.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 3 0.00% 23 4 0.00% 24 3 0.00% 25 10 0.00% 26 4 0.00% 27 3 0.00% 28 7 0.00% 29 10 0.00% 30 14 0.00% 31 11 0.00% 32 9 0.00% 33 11 0.00% 34 8 0.00% 35 18 0.00% 36 14 0.00% 37 20 0.00% 38 19 0.00% 39 18 0.00% 40 14 0.00% 41 19 0.00% 42 21 0.00% 43 34 0.00% 44 36 0.00% 45 39 0.00% 46 45 0.00% 47 51 0.00% 48 55 0.00% 49 49 0.00% 50 50 0.00% 51 45 0.00% 52 67 0.00% 53 72 0.00% 54 94 0.00% 55 79 0.00% 56 98 0.00% 57 113 0.00% 58 110 0.00% 59 145 0.00% 60 140 0.00% 61 198 0.00% 62 186 0.00% 63 230 0.00% 64 229 0.00% 65 238 0.00% 66 288 0.00% 67 309 0.00% 68 307 0.00% 69 422 0.00% 70 412 0.00% 71 526 0.00% 72 624 0.00% 73 639 0.00% 74 713 0.00% 75 815 0.00% 76 969 0.00% 77 971 0.00% 78 1080 0.00% 79 1206 0.00% 80 1389 0.01% 81 1532 0.01% 82 1781 0.01% 83 2003 0.01% 84 2321 0.01% 85 2507 0.01% 86 2672 0.01% 87 2880 0.01% 88 3239 0.01% 89 3485 0.01% 90 3913 0.02% 91 4173 0.02% 92 4632 0.02% 93 5037 0.02% 94 5728 0.02% 95 6199 0.02% 96 6464 0.03% 97 7055 0.03% 98 7326 0.03% 99 7993 0.03% 100 8559 0.03% 101 9034 0.04% 102 9493 0.04% 103 10656 0.04% 104 11191 0.04% 105 11847 0.05% 106 12683 0.05% 107 13230 0.05% 108 13831 0.05% 109 14344 0.06% 110 14913 0.06% 111 15710 0.06% 112 17139 0.07% 113 17853 0.07% 114 18640 0.07% 115 20040 0.08% 116 20704 0.08% 117 21253 0.08% 118 22266 0.09% 119 22871 0.09% 120 23897 0.09% 121 24875 0.10% 122 25814 0.10% 123 27409 0.11% 124 28960 0.11% 125 29741 0.12% 126 30935 0.12% 127 31126 0.12% 128 32801 0.13% 129 33119 0.13% 130 34324 0.14% 131 35281 0.14% 132 36212 0.14% 133 38636 0.15% 134 39847 0.16% 135 41175 0.16% 136 42245 0.17% 137 43728 0.17% 138 44891 0.18% 139 45481 0.18% 140 45658 0.18% 141 47147 0.19% 142 48619 0.19% 143 50486 0.20% 144 53602 0.21% 145 54478 0.21% 146 56259 0.22% 147 56732 0.22% 148 58313 0.23% 149 58250 0.23% 150 58590 0.23% 151 23689938 93.38% 25369081 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=10 prefix-density=0.82 prefix-fanout=2.6 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.28 sequence-density-rank=21 fanout-score=10.50 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=5.5 sequence=TTCTTTCCAATGCT criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=19 prefix-density=0.64 prefix-fanout=2.3 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.40 sequence-density-rank=11 fanout-score=12.09 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=6.1 sequence=AGCAATGGCAGCA SRR12671688 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:25:06 Started mapping on | Feb 12 03:25:06 Finished on | Feb 12 03:30:49 Mapping speed, Million of reads per hour | 266.26 Number of input reads | 25369081 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 23538208 Uniquely mapped reads % | 92.78% Average mapped length | 298.13 Number of splices: Total | 24138281 Number of splices: Annotated (sjdb) | 23739471 Number of splices: GT/AG | 23621029 Number of splices: GC/AG | 442560 Number of splices: AT/AC | 14874 Number of splices: Non-canonical | 59818 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 615710 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 274498 % of reads mapped to too many loci | 1.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.52% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1215163 1215163 1215163 N_multimapping 615710 615710 615710 N_noFeature 531720 23116471 636606 N_ambiguous 467322 1803 149679 UnstrandedReadsAssigned:22539166 PositiveStrandReadsAssigned:419934 NegativeStrandReadsAssigned:22751923 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671688 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671688-trimmed-pair1.fastq SRR12671688-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,369,081 reads, 22,928,754 reads pseudoaligned [quant] estimated average fragment length: 268.75 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR12671688.ke.tsv 34699 SRR12671688.se.tsv 87100 total ==> SRR12671688.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.25 860 16.7517 Potri.005G024800.1.v4.1 1035 767.25 639 28.3938 Potri.004G059700.1.v4.1 961 693.385 3 0.147505 Potri.007G009000.2.v4.1 1416 1148.25 0 0 Potri.003G141000.2.v4.1 2943 2675.25 1176.58 14.994 Potri.016G087400.1.v4.1 270 75.2446 1395 632.061 Potri.015G069301.1.v4.1 564 307.649 0 0 Potri.010G195200.1.v4.1 1773 1505.25 129 2.92174 Potri.012G127500.1.v4.1 977 709.321 67 3.22027 ==> SRR12671688.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 141 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 635 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 19 SRR12671688 completed mapping pipeline successfully