Starting /dee2/code/volunteer_pipeline.sh SRR12671689 current disk space = 3049003229184 free memory = 1434525080 SRR12671689 SRAfilesize 6710f51775fad443ca68ba3593dc6867 SRR12671689.sra SRR12671689.sra file validated SRR12671689 is paired end SRR12671689 is conventional basespace SRR12671689 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671689_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5095 37.0 37.0 37.0 37.0 37.0 2 36.20575 37.0 37.0 37.0 37.0 37.0 3 36.449 37.0 37.0 37.0 37.0 37.0 4 36.5375 37.0 37.0 37.0 37.0 37.0 5 36.559 37.0 37.0 37.0 37.0 37.0 6 36.5265 37.0 37.0 37.0 37.0 37.0 7 36.464 37.0 37.0 37.0 37.0 37.0 8 36.59 37.0 37.0 37.0 37.0 37.0 9 36.526 37.0 37.0 37.0 37.0 37.0 10-14 36.5527 37.0 37.0 37.0 37.0 37.0 15-19 36.5474 37.0 37.0 37.0 37.0 37.0 20-24 36.5402 37.0 37.0 37.0 37.0 37.0 25-29 36.4539 37.0 37.0 37.0 37.0 37.0 30-34 36.4823 37.0 37.0 37.0 37.0 37.0 35-39 36.482299999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.4546 37.0 37.0 37.0 37.0 37.0 45-49 36.3586 37.0 37.0 37.0 37.0 37.0 50-54 36.362100000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.3902 37.0 37.0 37.0 37.0 37.0 60-64 36.396699999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.366699999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.3073 37.0 37.0 37.0 37.0 37.0 75-79 36.283100000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.3123 37.0 37.0 37.0 37.0 37.0 85-89 36.2838 37.0 37.0 37.0 37.0 37.0 90-94 36.257400000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.1942 37.0 37.0 37.0 37.0 37.0 100-104 36.236700000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.120999999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.160399999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.125699999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.0415 37.0 37.0 37.0 37.0 37.0 125-129 36.052800000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.0156 37.0 37.0 37.0 37.0 37.0 135-139 35.9439 37.0 37.0 37.0 37.0 37.0 140-144 35.851 37.0 37.0 37.0 37.0 37.0 145-149 35.8557 37.0 37.0 37.0 37.0 37.0 150-151 35.41975 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 1.0 25 3.0 26 1.0 27 8.0 28 7.0 29 20.0 30 25.0 31 40.0 32 45.0 33 75.0 34 104.0 35 332.0 36 2948.0 37 389.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.65 14.6 12.7 44.05 2 18.820577164366373 20.677540777917187 42.358845671267254 18.143036386449186 3 17.275 26.1 26.325 30.3 4 21.7 34.675 21.25 22.375 5 20.849999999999998 37.275000000000006 24.175 17.7 6 16.75 35.975 26.224999999999998 21.05 7 13.425 21.175 45.15 20.25 8 18.525 21.8 30.175 29.5 9 17.599999999999998 22.35 33.300000000000004 26.75 10-14 19.23 28.925 27.639999999999997 24.205 15-19 19.455 28.439999999999998 27.87 24.235 20-24 19.88 28.939999999999998 27.855 23.325000000000003 25-29 19.2 28.27 28.22 24.310000000000002 30-34 19.23 28.499999999999996 27.41 24.86 35-39 19.89 28.999999999999996 27.68 23.43 40-44 19.71 28.725 27.775 23.79 45-49 19.935 28.155 27.639999999999997 24.27 50-54 19.64 28.360000000000003 28.1 23.9 55-59 19.5 28.64 27.72 24.14 60-64 19.7 28.499999999999996 27.61 24.19 65-69 19.8 28.825 26.765 24.610000000000003 70-74 19.79 28.065 28.035 24.11 75-79 19.825 29.349999999999998 26.51 24.315 80-84 19.97 28.485 27.87 23.674999999999997 85-89 20.315 28.575 27.175 23.935000000000002 90-94 19.555 29.020000000000003 27.57 23.855 95-99 20.21 28.105000000000004 27.555000000000003 24.13 100-104 19.63 28.115000000000002 27.565 24.69 105-109 20.19 28.18 28.110000000000003 23.52 110-114 21.135 27.87 26.985 24.01 115-119 19.88 28.92 27.63 23.57 120-124 19.994999999999997 27.815 27.985 24.205 125-129 20.1 28.1 27.82 23.98 130-134 20.735 28.499999999999996 27.284999999999997 23.48 135-139 20.895 28.299999999999997 27.284999999999997 23.52 140-144 20.71 28.03 27.785 23.474999999999998 145-149 20.73 28.384999999999998 27.155 23.73 150-151 21.375 28.125 26.637499999999996 23.8625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 2.0 23 2.0 24 2.0 25 3.5 26 5.5 27 7.5 28 10.5 29 11.0 30 20.5 31 36.0 32 39.5 33 46.0 34 61.0 35 77.5 36 96.0 37 117.0 38 129.0 39 143.0 40 182.5 41 215.5 42 239.0 43 259.5 44 262.5 45 266.5 46 260.0 47 247.5 48 256.0 49 217.0 50 167.0 51 140.5 52 106.5 53 88.5 54 68.5 55 50.5 56 44.0 57 33.0 58 22.5 59 19.0 60 12.0 61 10.0 62 7.5 63 2.5 64 1.0 65 2.5 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.025 #Duplication Level Percentage of deduplicated Percentage of total 1 93.22762698199408 86.725 2 6.073636119322763 11.3 3 0.6718624025799517 1.875 4 0.026874496103198062 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.8374999999999999 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.125 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.4875 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.875 0.0 0.0 0.0 0.0 134-135 2.2249999999999996 0.0 0.0 0.0 0.0 136-137 2.4749999999999996 0.0 0.0 0.0 0.0 138-139 2.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671689 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671689_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6815 37.0 37.0 37.0 37.0 37.0 2 35.509 37.0 37.0 37.0 37.0 37.0 3 35.7265 37.0 37.0 37.0 37.0 37.0 4 35.756 37.0 37.0 37.0 37.0 37.0 5 35.9045 37.0 37.0 37.0 37.0 37.0 6 35.8695 37.0 37.0 37.0 37.0 37.0 7 35.9775 37.0 37.0 37.0 37.0 37.0 8 36.085 37.0 37.0 37.0 37.0 37.0 9 35.944 37.0 37.0 37.0 37.0 37.0 10-14 36.0166 37.0 37.0 37.0 37.0 37.0 15-19 35.988099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.0062 37.0 37.0 37.0 37.0 37.0 25-29 35.9211 37.0 37.0 37.0 37.0 37.0 30-34 35.8995 37.0 37.0 37.0 37.0 37.0 35-39 35.85079999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.89960000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.8666 37.0 37.0 37.0 37.0 37.0 50-54 35.7296 37.0 37.0 37.0 37.0 37.0 55-59 35.7761 37.0 37.0 37.0 37.0 37.0 60-64 35.682599999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.723699999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.7332 37.0 37.0 37.0 37.0 37.0 75-79 35.5429 37.0 37.0 37.0 37.0 37.0 80-84 35.6194 37.0 37.0 37.0 37.0 37.0 85-89 35.5645 37.0 37.0 37.0 37.0 37.0 90-94 35.4988 37.0 37.0 37.0 37.0 37.0 95-99 35.61409999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.465500000000006 37.0 37.0 37.0 34.6 37.0 105-109 35.4294 37.0 37.0 37.0 37.0 37.0 110-114 35.343500000000006 37.0 37.0 37.0 34.6 37.0 115-119 35.297799999999995 37.0 37.0 37.0 32.2 37.0 120-124 35.3112 37.0 37.0 37.0 37.0 37.0 125-129 35.231700000000004 37.0 37.0 37.0 25.0 37.0 130-134 35.2653 37.0 37.0 37.0 32.2 37.0 135-139 35.3091 37.0 37.0 37.0 34.6 37.0 140-144 35.053799999999995 37.0 37.0 37.0 25.0 37.0 145-149 35.018100000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.6265 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 0.0 19 0.0 20 1.0 21 2.0 22 4.0 23 6.0 24 3.0 25 10.0 26 12.0 27 22.0 28 25.0 29 30.0 30 48.0 31 54.0 32 101.0 33 136.0 34 262.0 35 788.0 36 2327.0 37 163.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.550000000000004 15.625 18.099999999999998 33.725 2 25.55 23.125 35.875 15.45 3 20.150000000000002 25.4 32.074999999999996 22.375 4 23.400000000000002 35.05 21.425 20.125 5 23.974999999999998 36.025 21.675 18.325 6 17.8 37.6 25.3 19.3 7 17.075000000000003 16.525000000000002 45.275 21.125 8 21.224999999999998 22.525000000000002 25.874999999999996 30.375000000000004 9 21.375 23.7 29.275000000000002 25.650000000000002 10-14 22.11 29.270000000000003 27.11 21.51 15-19 22.384999999999998 27.68 28.24 21.695 20-24 22.41 27.845 28.345 21.4 25-29 22.7 27.694999999999997 28.395 21.21 30-34 22.18 27.650000000000002 28.565 21.605 35-39 22.55 28.189999999999998 27.985 21.275 40-44 22.09 28.185 28.194999999999997 21.529999999999998 45-49 22.85 28.249999999999996 27.71 21.19 50-54 22.765 28.505000000000003 27.325 21.404999999999998 55-59 22.425 27.265 28.46 21.85 60-64 23.835 27.555000000000003 27.485 21.125 65-69 23.255 27.3 27.85 21.595 70-74 22.68 27.794999999999998 27.474999999999998 22.05 75-79 23.06 27.855 27.845 21.240000000000002 80-84 23.335 27.77 27.66 21.235 85-89 23.615 27.589999999999996 27.38 21.415 90-94 23.315 27.900000000000002 27.515 21.27 95-99 23.075000000000003 27.755000000000003 27.48 21.69 100-104 23.165 27.339999999999996 28.15 21.345 105-109 23.474999999999998 27.169999999999998 28.499999999999996 20.855 110-114 23.54 28.249999999999996 27.555000000000003 20.655 115-119 23.669999999999998 27.889999999999997 27.785 20.655 120-124 24.240000000000002 28.060000000000002 27.150000000000002 20.549999999999997 125-129 24.47 27.725 27.12 20.685000000000002 130-134 23.915 26.979999999999997 27.92 21.185000000000002 135-139 23.66 27.860000000000003 27.425 21.055 140-144 24.145 28.235 26.595000000000002 21.025 145-149 24.62 28.38 26.755000000000003 20.244999999999997 150-151 24.95 26.575 28.1875 20.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 1.5 23 3.0 24 3.5 25 2.5 26 4.0 27 8.5 28 11.5 29 11.0 30 16.5 31 25.5 32 29.0 33 38.0 34 55.5 35 66.5 36 73.0 37 101.0 38 140.0 39 170.0 40 182.0 41 192.5 42 237.0 43 273.5 44 264.0 45 274.5 46 273.5 47 233.0 48 209.5 49 199.5 50 177.0 51 148.0 52 117.5 53 102.0 54 86.0 55 61.0 56 55.5 57 38.0 58 23.5 59 21.5 60 21.0 61 14.0 62 9.5 63 7.5 64 1.5 65 0.5 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.825 #Duplication Level Percentage of deduplicated Percentage of total 1 93.34769727982763 86.65 2 5.871263129544842 10.9 3 0.6463775922434689 1.7999999999999998 4 0.05386479935362241 0.2 5 0.05386479935362241 0.25 6 0.0 0.0 7 0.0 0.0 8 0.026932399676811204 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 8 0.2 No Hit CTTCAATCGTAAATCACAAATACATACACGTTTACTCATCAGCTCGAAAA 5 0.125 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.5375 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.125 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.4875 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.875 0.0 0.0 0.0 0.0 134-135 2.2375 0.0 0.0 0.0 0.0 136-137 2.4749999999999996 0.0 0.0 0.0 0.0 138-139 2.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974333 spots for SRR12671689.sra Written 974333 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra Read 974325 spots for SRR12671689.sra Written 974325 spots for SRR12671689.sra SRR ids: ['SRR12671689.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ba39_153 SRR12671689.sra spots: 19486508 blocks: [[1, 974325], [974326, 1948650], [1948651, 2922975], [2922976, 3897300], [3897301, 4871625], [4871626, 5845950], [5845951, 6820275], [6820276, 7794600], [7794601, 8768925], [8768926, 9743250], [9743251, 10717575], [10717576, 11691900], [11691901, 12666225], [12666226, 13640550], [13640551, 14614875], [14614876, 15589200], [15589201, 16563525], [16563526, 17537850], [17537851, 18512175], [18512176, 19486508]] SRR12671689 file size 6600667 SRR12671689 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671689 SRR12671689_1.fastq SRR12671689_2.fastq Input file: SRR12671689_1.fastq Paired file: SRR12671689_2.fastq trimmed: SRR12671689-trimmed-pair1.fastq, SRR12671689-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:43:20 2025 >> started Wed Feb 12 03:43:50 2025 >> done (29.462s) 19486508 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 1405 ( 0.01%) empty read pairs filtered out after trimming by size control 19485089 (99.99%) read pairs available; of these: 816487 ( 4.19%) trimmed read pairs available after processing 18668602 (95.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 4 0.00% 23 3 0.00% 24 4 0.00% 25 3 0.00% 26 5 0.00% 27 1 0.00% 28 6 0.00% 29 11 0.00% 30 10 0.00% 31 7 0.00% 32 6 0.00% 33 8 0.00% 34 5 0.00% 35 13 0.00% 36 16 0.00% 37 15 0.00% 38 11 0.00% 39 17 0.00% 40 21 0.00% 41 24 0.00% 42 23 0.00% 43 32 0.00% 44 23 0.00% 45 19 0.00% 46 34 0.00% 47 24 0.00% 48 38 0.00% 49 36 0.00% 50 51 0.00% 51 57 0.00% 52 58 0.00% 53 40 0.00% 54 58 0.00% 55 54 0.00% 56 62 0.00% 57 59 0.00% 58 82 0.00% 59 66 0.00% 60 88 0.00% 61 100 0.00% 62 97 0.00% 63 135 0.00% 64 126 0.00% 65 158 0.00% 66 163 0.00% 67 158 0.00% 68 179 0.00% 69 203 0.00% 70 223 0.00% 71 259 0.00% 72 282 0.00% 73 311 0.00% 74 359 0.00% 75 377 0.00% 76 444 0.00% 77 421 0.00% 78 529 0.00% 79 559 0.00% 80 596 0.00% 81 739 0.00% 82 773 0.00% 83 883 0.00% 84 953 0.00% 85 1066 0.01% 86 1222 0.01% 87 1228 0.01% 88 1409 0.01% 89 1522 0.01% 90 1673 0.01% 91 1894 0.01% 92 2004 0.01% 93 2248 0.01% 94 2492 0.01% 95 2600 0.01% 96 2856 0.01% 97 3078 0.02% 98 3258 0.02% 99 3449 0.02% 100 3741 0.02% 101 4055 0.02% 102 4365 0.02% 103 4693 0.02% 104 4988 0.03% 105 5430 0.03% 106 5773 0.03% 107 6108 0.03% 108 6341 0.03% 109 6764 0.03% 110 6917 0.04% 111 7596 0.04% 112 7907 0.04% 113 8351 0.04% 114 8907 0.05% 115 9248 0.05% 116 10002 0.05% 117 10066 0.05% 118 10364 0.05% 119 11021 0.06% 120 11535 0.06% 121 11828 0.06% 122 12267 0.06% 123 13060 0.07% 124 13742 0.07% 125 14117 0.07% 126 14830 0.08% 127 15433 0.08% 128 15906 0.08% 129 16354 0.08% 130 16781 0.09% 131 17135 0.09% 132 17841 0.09% 133 18961 0.10% 134 19434 0.10% 135 20084 0.10% 136 20788 0.11% 137 21321 0.11% 138 22004 0.11% 139 22812 0.12% 140 23231 0.12% 141 23625 0.12% 142 24991 0.13% 143 25481 0.13% 144 26242 0.13% 145 27253 0.14% 146 28122 0.14% 147 28221 0.14% 148 29186 0.15% 149 29366 0.15% 150 29772 0.15% 151 18668602 95.81% 19485089 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=30 prefix-density=0.45 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=37.32 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=12.2 sequence=CTCTCCTTCAGTG criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=33 prefix-density=0.55 prefix-fanout=2.5 sequence=ATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=42.06 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=13.7 sequence=AAAGAAAAGAAAA SRR12671689 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:44:33 Started mapping on | Feb 12 03:44:33 Finished on | Feb 12 03:46:41 Mapping speed, Million of reads per hour | 548.02 Number of input reads | 19485089 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 18353582 Uniquely mapped reads % | 94.19% Average mapped length | 298.90 Number of splices: Total | 18943266 Number of splices: Annotated (sjdb) | 18527569 Number of splices: GT/AG | 18571041 Number of splices: GC/AG | 307943 Number of splices: AT/AC | 10725 Number of splices: Non-canonical | 53557 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 448996 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 116710 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 682511 682511 682511 N_multimapping 448996 448996 448996 N_noFeature 685199 18047733 780275 N_ambiguous 319776 1261 108383 UnstrandedReadsAssigned:17348607 PositiveStrandReadsAssigned:304588 NegativeStrandReadsAssigned:17464924 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671689 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671689-trimmed-pair1.fastq SRR12671689-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,485,089 reads, 17,465,358 reads pseudoaligned [quant] estimated average fragment length: 312.727 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR12671689.ke.tsv 34699 SRR12671689.se.tsv 87100 total ==> SRR12671689.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1706.27 1307 39.4608 Potri.005G024800.1.v4.1 1035 723.273 273 19.4446 Potri.004G059700.1.v4.1 961 649.879 1 0.0792695 Potri.007G009000.2.v4.1 1416 1104.27 0 0 Potri.003G141000.2.v4.1 2943 2631.27 963.898 18.8714 Potri.016G087400.1.v4.1 270 70.7481 866.689 631.084 Potri.015G069301.1.v4.1 564 283.158 0 0 Potri.010G195200.1.v4.1 1773 1461.27 123 4.33623 Potri.012G127500.1.v4.1 977 665.635 42 3.25051 ==> SRR12671689.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 98 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 234 Potri.001G212900.v4.1 44 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12671689 completed mapping pipeline successfully