Starting /dee2/code/volunteer_pipeline.sh SRR12671690 current disk space = 3049027559424 free memory = 1581845056 SRR12671690 SRAfilesize 8834886a62da2f438d091c4b74ec92f0 SRR12671690.sra SRR12671690.sra file validated SRR12671690 is paired end SRR12671690 is conventional basespace SRR12671690 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671690_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4305 37.0 37.0 37.0 37.0 37.0 2 36.2525 37.0 37.0 37.0 37.0 37.0 3 36.513 37.0 37.0 37.0 37.0 37.0 4 36.4945 37.0 37.0 37.0 37.0 37.0 5 36.5225 37.0 37.0 37.0 37.0 37.0 6 36.6035 37.0 37.0 37.0 37.0 37.0 7 36.51 37.0 37.0 37.0 37.0 37.0 8 36.398 37.0 37.0 37.0 37.0 37.0 9 36.503 37.0 37.0 37.0 37.0 37.0 10-14 36.589400000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.505700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4936 37.0 37.0 37.0 37.0 37.0 25-29 36.4457 37.0 37.0 37.0 37.0 37.0 30-34 36.4701 37.0 37.0 37.0 37.0 37.0 35-39 36.4601 37.0 37.0 37.0 37.0 37.0 40-44 36.4349 37.0 37.0 37.0 37.0 37.0 45-49 36.4144 37.0 37.0 37.0 37.0 37.0 50-54 36.375600000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.33200000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.381299999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.312599999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.27890000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.3057 37.0 37.0 37.0 37.0 37.0 80-84 36.24810000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.20550000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.2392 37.0 37.0 37.0 37.0 37.0 95-99 36.114 37.0 37.0 37.0 37.0 37.0 100-104 36.1449 37.0 37.0 37.0 37.0 37.0 105-109 36.0715 37.0 37.0 37.0 37.0 37.0 110-114 36.105500000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.1486 37.0 37.0 37.0 37.0 37.0 120-124 35.9955 37.0 37.0 37.0 37.0 37.0 125-129 36.02380000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.985 37.0 37.0 37.0 37.0 37.0 135-139 35.876 37.0 37.0 37.0 37.0 37.0 140-144 35.9162 37.0 37.0 37.0 37.0 37.0 145-149 35.831399999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.35675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 3.0 27 8.0 28 11.0 29 24.0 30 31.0 31 38.0 32 49.0 33 79.0 34 129.0 35 312.0 36 2934.0 37 380.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.7 15.775 12.4 40.125 2 21.213640922768302 19.132397191574725 37.21163490471414 22.442326980942827 3 17.45 26.75 28.1 27.700000000000003 4 21.775 32.7 22.5 23.025000000000002 5 21.0 36.075 23.875 19.05 6 17.875 35.699999999999996 24.325 22.1 7 14.625 21.675 43.275000000000006 20.424999999999997 8 17.7 23.3 28.975 30.025000000000002 9 17.95 22.400000000000002 33.1 26.55 10-14 20.19 28.73 26.775 24.305 15-19 20.119999999999997 28.15 27.61 24.12 20-24 20.235 27.85 27.575 24.34 25-29 20.595 28.165000000000003 27.35 23.89 30-34 19.75 28.51 27.134999999999998 24.605 35-39 20.13 27.79 27.98 24.099999999999998 40-44 20.105 28.845 27.365000000000002 23.685000000000002 45-49 20.23 28.105000000000004 27.365000000000002 24.3 50-54 20.455000000000002 28.444999999999997 27.650000000000002 23.45 55-59 19.994999999999997 28.575 27.689999999999998 23.74 60-64 20.585 28.134999999999998 27.650000000000002 23.630000000000003 65-69 20.165 27.61 28.155 24.07 70-74 20.380000000000003 28.325 27.665 23.630000000000003 75-79 20.815 28.065 27.99 23.13 80-84 20.355 27.74 28.325 23.580000000000002 85-89 20.225 28.349999999999998 27.85 23.575 90-94 20.865000000000002 27.655 27.615000000000002 23.865 95-99 20.849999999999998 28.46 27.16 23.53 100-104 20.755000000000003 27.71 27.435 24.099999999999998 105-109 20.275000000000002 27.815 27.965 23.945 110-114 20.455000000000002 27.785 28.075 23.685000000000002 115-119 20.955 28.655 27.12 23.27 120-124 20.235 28.37 27.87 23.525 125-129 21.25 28.005000000000003 27.384999999999998 23.36 130-134 21.165 28.810000000000002 26.265 23.76 135-139 21.915000000000003 27.52 27.07 23.494999999999997 140-144 21.490000000000002 27.83 26.51 24.169999999999998 145-149 21.27 28.08 26.855 23.794999999999998 150-151 21.337500000000002 28.262500000000003 27.212500000000002 23.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.0 26 3.5 27 3.5 28 4.0 29 13.0 30 19.0 31 19.5 32 28.5 33 39.0 34 54.5 35 74.0 36 85.5 37 109.5 38 124.0 39 142.0 40 185.5 41 217.0 42 242.0 43 258.0 44 271.5 45 279.5 46 259.5 47 250.5 48 250.0 49 213.5 50 165.5 51 138.5 52 126.5 53 100.5 54 70.0 55 56.5 56 48.5 57 38.5 58 31.5 59 25.5 60 18.5 61 12.5 62 5.5 63 3.0 64 2.0 65 1.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.4 #Duplication Level Percentage of deduplicated Percentage of total 1 93.44218415417559 87.275 2 6.076017130620985 11.35 3 0.4550321199143469 1.275 4 0.02676659528907923 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.1749999999999998 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.9625 0.0 0.0 0.0 0.0 122-123 2.1875 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.8375 0.0 0.0 0.0 0.0 128-129 3.1500000000000004 0.0 0.0 0.0 0.0 130-131 3.3499999999999996 0.0 0.0 0.0 0.0 132-133 3.7874999999999996 0.0 0.0 0.0 0.0 134-135 4.1875 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 5.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACCTGT 10 0.006830828 145.0 145 >>END_MODULE SRR12671690 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671690_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.307 37.0 37.0 37.0 37.0 37.0 2 36.2375 37.0 37.0 37.0 37.0 37.0 3 36.2645 37.0 37.0 37.0 37.0 37.0 4 36.3 37.0 37.0 37.0 37.0 37.0 5 36.414 37.0 37.0 37.0 37.0 37.0 6 36.433 37.0 37.0 37.0 37.0 37.0 7 36.371 37.0 37.0 37.0 37.0 37.0 8 36.443 37.0 37.0 37.0 37.0 37.0 9 36.3375 37.0 37.0 37.0 37.0 37.0 10-14 36.3965 37.0 37.0 37.0 37.0 37.0 15-19 36.3425 37.0 37.0 37.0 37.0 37.0 20-24 36.3428 37.0 37.0 37.0 37.0 37.0 25-29 36.294799999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.3179 37.0 37.0 37.0 37.0 37.0 35-39 36.2508 37.0 37.0 37.0 37.0 37.0 40-44 36.2619 37.0 37.0 37.0 37.0 37.0 45-49 36.2392 37.0 37.0 37.0 37.0 37.0 50-54 36.2582 37.0 37.0 37.0 37.0 37.0 55-59 36.1896 37.0 37.0 37.0 37.0 37.0 60-64 36.1087 37.0 37.0 37.0 37.0 37.0 65-69 36.1061 37.0 37.0 37.0 37.0 37.0 70-74 36.111599999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.9975 37.0 37.0 37.0 37.0 37.0 80-84 36.0536 37.0 37.0 37.0 37.0 37.0 85-89 36.0293 37.0 37.0 37.0 37.0 37.0 90-94 35.9979 37.0 37.0 37.0 37.0 37.0 95-99 36.021899999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.967 37.0 37.0 37.0 37.0 37.0 105-109 35.863699999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.8073 37.0 37.0 37.0 37.0 37.0 115-119 35.8362 37.0 37.0 37.0 37.0 37.0 120-124 35.867900000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.7059 37.0 37.0 37.0 37.0 37.0 130-134 35.789 37.0 37.0 37.0 37.0 37.0 135-139 35.7791 37.0 37.0 37.0 37.0 37.0 140-144 35.4661 37.0 37.0 37.0 37.0 37.0 145-149 35.557100000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.0865 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 0.0 18 2.0 19 0.0 20 0.0 21 1.0 22 2.0 23 5.0 24 2.0 25 2.0 26 8.0 27 9.0 28 12.0 29 11.0 30 23.0 31 46.0 32 55.0 33 83.0 34 175.0 35 518.0 36 2830.0 37 214.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.875 18.75 15.85 31.525 2 25.45 24.525 33.074999999999996 16.950000000000003 3 21.025 28.199999999999996 30.65 20.125 4 23.275000000000002 34.675 22.625 19.425 5 22.45 36.9 20.95 19.7 6 19.025 36.575 23.7 20.7 7 18.0 17.299999999999997 42.625 22.075 8 20.875 23.549999999999997 26.375 29.2 9 21.125 23.65 29.2 26.025 10-14 22.665 28.494999999999997 26.6 22.24 15-19 22.045 28.215 27.32 22.42 20-24 22.98 28.000000000000004 27.66 21.36 25-29 22.73 28.28 27.35 21.64 30-34 21.62 28.305000000000003 28.01 22.065 35-39 22.055 28.110000000000003 28.21 21.625 40-44 22.795 27.91 28.015 21.279999999999998 45-49 22.68 27.83 27.555000000000003 21.935 50-54 22.884999999999998 27.985 27.689999999999998 21.44 55-59 22.945 27.900000000000002 26.87 22.285 60-64 23.03 28.215 27.689999999999998 21.065 65-69 22.689999999999998 27.98 27.255000000000003 22.075 70-74 22.865 28.17 27.250000000000004 21.715 75-79 22.93 27.450000000000003 27.765 21.855 80-84 23.43 28.1 26.88 21.59 85-89 23.525 27.72 27.134999999999998 21.62 90-94 23.265 27.605 27.515 21.615000000000002 95-99 23.015 27.185 27.815 21.985 100-104 23.145 28.605000000000004 27.325 20.925 105-109 23.244999999999997 28.065 27.389999999999997 21.3 110-114 23.5 27.134999999999998 27.83 21.535 115-119 23.485 27.965 27.57 20.979999999999997 120-124 23.830000000000002 28.27 26.685 21.215 125-129 24.01 27.395000000000003 27.235 21.36 130-134 24.62 28.345 26.605 20.43 135-139 24.55 27.27 27.29 20.89 140-144 25.155 27.82 26.795 20.23 145-149 25.119999999999997 27.725 26.775 20.380000000000003 150-151 25.887500000000003 26.924999999999997 27.3125 19.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 2.5 25 2.0 26 1.5 27 2.0 28 3.0 29 3.0 30 9.5 31 18.5 32 22.5 33 32.0 34 49.0 35 63.5 36 76.0 37 94.0 38 125.5 39 164.0 40 185.5 41 211.5 42 240.5 43 266.0 44 273.5 45 252.0 46 269.0 47 264.5 48 246.5 49 226.0 50 186.5 51 148.0 52 107.5 53 93.5 54 87.5 55 75.0 56 51.5 57 34.5 58 27.0 59 24.5 60 17.5 61 11.0 62 9.5 63 5.0 64 3.0 65 3.5 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.35 #Duplication Level Percentage of deduplicated Percentage of total 1 93.5457953936797 87.325 2 5.865024102838779 10.95 3 0.5623995715050883 1.575 4 0.0 0.0 5 0.0 0.0 6 0.02678093197643278 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1625 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 2.0375 0.0 0.0 0.0 0.0 122-123 2.2625 0.0 0.0 0.0 0.0 124-125 2.625 0.0 0.0 0.0 0.0 126-127 2.9625 0.0 0.0 0.0 0.0 128-129 3.2750000000000004 0.0 0.0 0.0 0.0 130-131 3.4625 0.0 0.0 0.0 0.0 132-133 3.875 0.0 0.0 0.0 0.0 134-135 4.2625 0.0 0.0 0.0 0.0 136-137 4.7875 0.0 0.0 0.0 0.0 138-139 5.1875 0.0 0.0125 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACTTG 10 0.006830828 145.0 2 CAATCAA 10 0.006830828 145.0 9 AGTCTCA 10 0.006830828 145.0 7 GGGGGGG 130 4.8405236E-5 11.153846 125-129 >>END_MODULE Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729623 spots for SRR12671690.sra Written 729623 spots for SRR12671690.sra Read 729630 spots for SRR12671690.sra Written 729630 spots for SRR12671690.sra SRR ids: ['SRR12671690.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fcizwgfa SRR12671690.sra spots: 14592467 blocks: [[1, 729623], [729624, 1459246], [1459247, 2188869], [2188870, 2918492], [2918493, 3648115], [3648116, 4377738], [4377739, 5107361], [5107362, 5836984], [5836985, 6566607], [6566608, 7296230], [7296231, 8025853], [8025854, 8755476], [8755477, 9485099], [9485100, 10214722], [10214723, 10944345], [10944346, 11673968], [11673969, 12403591], [12403592, 13133214], [13133215, 13862837], [13862838, 14592467]] SRR12671690 file size 4937458 SRR12671690 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671690 SRR12671690_1.fastq SRR12671690_2.fastq Input file: SRR12671690_1.fastq Paired file: SRR12671690_2.fastq trimmed: SRR12671690-trimmed-pair1.fastq, SRR12671690-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:03:16 2025 >> started Wed Feb 12 04:03:32 2025 >> done (15.477s) 14592467 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 122 ( 0.00%) empty read pairs filtered out after trimming by size control 14592329 (100.00%) read pairs available; of these: 1134905 ( 7.78%) trimmed read pairs available after processing 13457424 (92.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 3 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 2 0.00% 26 2 0.00% 27 4 0.00% 28 0 0.00% 29 4 0.00% 30 0 0.00% 31 2 0.00% 32 2 0.00% 33 8 0.00% 34 6 0.00% 35 4 0.00% 36 8 0.00% 37 10 0.00% 38 13 0.00% 39 10 0.00% 40 9 0.00% 41 14 0.00% 42 12 0.00% 43 17 0.00% 44 9 0.00% 45 12 0.00% 46 17 0.00% 47 22 0.00% 48 22 0.00% 49 24 0.00% 50 34 0.00% 51 41 0.00% 52 41 0.00% 53 58 0.00% 54 58 0.00% 55 48 0.00% 56 42 0.00% 57 80 0.00% 58 85 0.00% 59 88 0.00% 60 111 0.00% 61 142 0.00% 62 157 0.00% 63 149 0.00% 64 195 0.00% 65 190 0.00% 66 184 0.00% 67 226 0.00% 68 287 0.00% 69 293 0.00% 70 396 0.00% 71 459 0.00% 72 522 0.00% 73 596 0.00% 74 611 0.00% 75 741 0.01% 76 746 0.01% 77 802 0.01% 78 883 0.01% 79 1012 0.01% 80 1133 0.01% 81 1422 0.01% 82 1684 0.01% 83 1792 0.01% 84 2016 0.01% 85 2099 0.01% 86 2312 0.02% 87 2497 0.02% 88 2499 0.02% 89 2806 0.02% 90 3064 0.02% 91 3484 0.02% 92 3776 0.03% 93 4387 0.03% 94 4791 0.03% 95 5217 0.04% 96 5307 0.04% 97 5359 0.04% 98 5606 0.04% 99 5812 0.04% 100 6250 0.04% 101 6935 0.05% 102 7447 0.05% 103 8100 0.06% 104 8561 0.06% 105 9382 0.06% 106 9775 0.07% 107 9840 0.07% 108 9826 0.07% 109 10248 0.07% 110 10570 0.07% 111 11201 0.08% 112 12164 0.08% 113 13011 0.09% 114 13645 0.09% 115 14626 0.10% 116 15062 0.10% 117 15371 0.11% 118 15464 0.11% 119 15646 0.11% 120 16331 0.11% 121 16711 0.11% 122 17564 0.12% 123 18787 0.13% 124 19775 0.14% 125 20786 0.14% 126 21488 0.15% 127 21782 0.15% 128 22001 0.15% 129 22331 0.15% 130 22551 0.15% 131 23139 0.16% 132 24072 0.16% 133 25331 0.17% 134 26310 0.18% 135 27299 0.19% 136 28570 0.20% 137 28957 0.20% 138 29688 0.20% 139 29526 0.20% 140 29730 0.20% 141 30244 0.21% 142 30923 0.21% 143 31755 0.22% 144 33483 0.23% 145 34764 0.24% 146 35742 0.24% 147 36121 0.25% 148 36693 0.25% 149 36281 0.25% 150 36466 0.25% 151 13457424 92.22% 14592329 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=29 prefix-density=0.44 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=24.35 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=5.8 sequence=CAGCCTTGACAA criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=24 prefix-density=0.83 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTG criterion=fanout-score sequence-density=0.16 sequence-density-rank=17 fanout-score=29.74 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=11.9 sequence=AAGAAAAGAAAA SRR12671690 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:04:29 Started mapping on | Feb 12 04:04:29 Finished on | Feb 12 04:05:44 Mapping speed, Million of reads per hour | 700.43 Number of input reads | 14592329 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12849465 Uniquely mapped reads % | 88.06% Average mapped length | 294.10 Number of splices: Total | 13462920 Number of splices: Annotated (sjdb) | 13177721 Number of splices: GT/AG | 13203284 Number of splices: GC/AG | 211692 Number of splices: AT/AC | 8152 Number of splices: Non-canonical | 39792 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304074 % of reads mapped to multiple loci | 2.08% Number of reads mapped to too many loci | 61784 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.31% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1438790 1438790 1438790 N_multimapping 304074 304074 304074 N_noFeature 422103 12658570 476147 N_ambiguous 241938 1272 104289 UnstrandedReadsAssigned:12185424 PositiveStrandReadsAssigned:189623 NegativeStrandReadsAssigned:12269029 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671690 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671690-trimmed-pair1.fastq SRR12671690-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,592,329 reads, 12,877,084 reads pseudoaligned [quant] estimated average fragment length: 262.977 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR12671690.ke.tsv 34699 SRR12671690.se.tsv 87100 total ==> SRR12671690.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.02 440 17.6948 Potri.005G024800.1.v4.1 1035 773.023 210 19.1845 Potri.004G059700.1.v4.1 961 699.172 5 0.505022 Potri.007G009000.2.v4.1 1416 1154.02 0 0 Potri.003G141000.2.v4.1 2943 2681.02 675 17.7798 Potri.016G087400.1.v4.1 270 80.1193 512 451.291 Potri.015G069301.1.v4.1 564 313.415 0 0 Potri.010G195200.1.v4.1 1773 1511.02 62 2.89764 Potri.012G127500.1.v4.1 977 715.116 79 7.80144 ==> SRR12671690.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 195 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 169 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR12671690 completed mapping pipeline successfully