Starting /dee2/code/volunteer_pipeline.sh SRR12671691 current disk space = 2823857274880 free memory = 1580191140 SRR12671691 SRAfilesize 0cb0bd6b895986124abe1553784f38ec SRR12671691.sra SRR12671691.sra file validated SRR12671691 is paired end SRR12671691 is conventional basespace SRR12671691 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671691_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3455 37.0 37.0 37.0 37.0 37.0 2 36.2665 37.0 37.0 37.0 37.0 37.0 3 36.503 37.0 37.0 37.0 37.0 37.0 4 36.523 37.0 37.0 37.0 37.0 37.0 5 36.55 37.0 37.0 37.0 37.0 37.0 6 36.515 37.0 37.0 37.0 37.0 37.0 7 36.5365 37.0 37.0 37.0 37.0 37.0 8 36.6205 37.0 37.0 37.0 37.0 37.0 9 36.5585 37.0 37.0 37.0 37.0 37.0 10-14 36.5639 37.0 37.0 37.0 37.0 37.0 15-19 36.5405 37.0 37.0 37.0 37.0 37.0 20-24 36.532 37.0 37.0 37.0 37.0 37.0 25-29 36.4838 37.0 37.0 37.0 37.0 37.0 30-34 36.459 37.0 37.0 37.0 37.0 37.0 35-39 36.4691 37.0 37.0 37.0 37.0 37.0 40-44 36.486599999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4183 37.0 37.0 37.0 37.0 37.0 50-54 36.434000000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.372299999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3215 37.0 37.0 37.0 37.0 37.0 65-69 36.4037 37.0 37.0 37.0 37.0 37.0 70-74 36.332300000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.3167 37.0 37.0 37.0 37.0 37.0 80-84 36.332100000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.340799999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.2778 37.0 37.0 37.0 37.0 37.0 95-99 36.196999999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2611 37.0 37.0 37.0 37.0 37.0 105-109 36.1126 37.0 37.0 37.0 37.0 37.0 110-114 36.1837 37.0 37.0 37.0 37.0 37.0 115-119 36.1798 37.0 37.0 37.0 37.0 37.0 120-124 36.1231 37.0 37.0 37.0 37.0 37.0 125-129 36.0324 37.0 37.0 37.0 37.0 37.0 130-134 36.00350000000001 37.0 37.0 37.0 37.0 37.0 135-139 36.022800000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.9222 37.0 37.0 37.0 37.0 37.0 145-149 35.869600000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.389250000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 2.0 26 2.0 27 3.0 28 10.0 29 15.0 30 27.0 31 27.0 32 43.0 33 76.0 34 133.0 35 319.0 36 2982.0 37 357.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.275 16.7 11.25 40.775 2 20.045158053186153 22.428499749121926 37.48118414450577 20.045158053186153 3 17.075000000000003 27.950000000000003 29.275000000000002 25.7 4 19.1 35.449999999999996 23.575 21.875 5 20.9 36.3 23.974999999999998 18.825 6 17.9 35.55 25.124999999999996 21.425 7 15.525 21.15 44.5 18.825 8 18.099999999999998 22.0 31.15 28.749999999999996 9 17.424999999999997 22.1 33.1 27.375 10-14 19.525000000000002 29.509999999999998 26.415 24.55 15-19 19.71 28.02 27.765 24.505 20-24 19.78 28.110000000000003 28.005000000000003 24.104999999999997 25-29 19.950000000000003 28.79 27.355 23.905 30-34 20.015 28.595 27.095000000000002 24.295 35-39 19.715 28.384999999999998 27.685 24.215 40-44 19.925 28.87 27.455000000000002 23.75 45-49 19.950000000000003 27.915 28.04 24.095 50-54 19.830000000000002 28.360000000000003 27.435 24.375 55-59 20.13 27.85 28.17 23.849999999999998 60-64 20.595 28.65 27.065 23.69 65-69 19.794999999999998 27.665 28.04 24.5 70-74 20.474999999999998 27.67 28.265 23.59 75-79 20.47 27.865000000000002 27.150000000000002 24.515 80-84 20.605 28.325 27.029999999999998 24.04 85-89 20.24 28.125 27.415 24.22 90-94 20.395 28.215 27.474999999999998 23.915 95-99 20.785 27.975 27.595 23.645 100-104 20.225 28.275 27.755000000000003 23.745 105-109 20.94 27.534999999999997 27.834999999999997 23.69 110-114 20.76 27.985 28.065 23.189999999999998 115-119 20.810000000000002 28.439999999999998 27.115000000000002 23.635 120-124 20.915 28.26 26.895000000000003 23.93 125-129 20.080000000000002 28.345 27.235 24.34 130-134 20.79 28.294999999999998 27.205000000000002 23.71 135-139 20.645 27.79 27.750000000000004 23.815 140-144 20.845 27.839999999999996 27.47 23.845 145-149 21.335 27.815 27.55 23.3 150-151 21.9 28.325 25.9875 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 1.0 24 1.5 25 2.5 26 4.5 27 7.0 28 11.0 29 15.0 30 13.5 31 19.0 32 38.5 33 48.5 34 56.0 35 66.0 36 85.0 37 108.0 38 123.5 39 160.5 40 198.5 41 216.5 42 243.0 43 264.5 44 269.0 45 255.5 46 244.0 47 238.0 48 222.5 49 220.0 50 187.5 51 142.5 52 124.0 53 96.5 54 74.0 55 56.0 56 44.0 57 34.5 58 23.0 59 23.0 60 18.5 61 15.0 62 11.5 63 6.0 64 4.0 65 1.5 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 94.65608465608466 89.45 2 5.0 9.45 3 0.2380952380952381 0.675 4 0.07936507936507936 0.3 5 0.026455026455026457 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.5499999999999998 0.0 0.0 0.0 0.0 122-123 1.7000000000000002 0.0 0.0 0.0 0.0 124-125 1.8250000000000002 0.0 0.0 0.0 0.0 126-127 2.0 0.0 0.0 0.0 0.0 128-129 2.2875 0.0 0.0 0.0 0.0 130-131 2.4625 0.0 0.0 0.0 0.0 132-133 2.7249999999999996 0.0 0.0 0.0 0.0 134-135 3.0375 0.0 0.0 0.0 0.0 136-137 3.3 0.0 0.0 0.0 0.0 138-139 3.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAGTA 10 0.006830828 145.0 145 >>END_MODULE SRR12671691 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671691_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3125 37.0 37.0 37.0 37.0 37.0 2 36.1635 37.0 37.0 37.0 37.0 37.0 3 36.2025 37.0 37.0 37.0 37.0 37.0 4 36.2585 37.0 37.0 37.0 37.0 37.0 5 36.3245 37.0 37.0 37.0 37.0 37.0 6 36.236 37.0 37.0 37.0 37.0 37.0 7 36.3925 37.0 37.0 37.0 37.0 37.0 8 36.443 37.0 37.0 37.0 37.0 37.0 9 36.3295 37.0 37.0 37.0 37.0 37.0 10-14 36.3602 37.0 37.0 37.0 37.0 37.0 15-19 36.3277 37.0 37.0 37.0 37.0 37.0 20-24 36.3338 37.0 37.0 37.0 37.0 37.0 25-29 36.296800000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.254400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.251599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.238099999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.1682 37.0 37.0 37.0 37.0 37.0 50-54 36.1466 37.0 37.0 37.0 37.0 37.0 55-59 36.09590000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.1228 37.0 37.0 37.0 37.0 37.0 65-69 36.1005 37.0 37.0 37.0 37.0 37.0 70-74 36.0811 37.0 37.0 37.0 37.0 37.0 75-79 36.0421 37.0 37.0 37.0 37.0 37.0 80-84 36.0308 37.0 37.0 37.0 37.0 37.0 85-89 35.9548 37.0 37.0 37.0 37.0 37.0 90-94 35.947199999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.0069 37.0 37.0 37.0 37.0 37.0 100-104 35.9501 37.0 37.0 37.0 37.0 37.0 105-109 35.9225 37.0 37.0 37.0 37.0 37.0 110-114 35.7814 37.0 37.0 37.0 37.0 37.0 115-119 35.8163 37.0 37.0 37.0 37.0 37.0 120-124 35.8394 37.0 37.0 37.0 37.0 37.0 125-129 35.7629 37.0 37.0 37.0 37.0 37.0 130-134 35.8235 37.0 37.0 37.0 37.0 37.0 135-139 35.708299999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.48700000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.5882 37.0 37.0 37.0 37.0 37.0 150-151 35.19475 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 0.0 21 2.0 22 2.0 23 4.0 24 7.0 25 5.0 26 11.0 27 5.0 28 8.0 29 22.0 30 33.0 31 29.0 32 55.0 33 78.0 34 203.0 35 491.0 36 2768.0 37 272.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.475 20.65 14.124999999999998 30.75 2 25.775 24.925 34.525 14.774999999999999 3 19.7 28.475 31.5 20.325 4 22.85 35.425000000000004 23.125 18.6 5 24.275 37.375 21.375 16.975 6 19.0 37.9 24.224999999999998 18.875 7 18.025 18.575 41.675000000000004 21.725 8 20.25 23.9 26.775 29.075 9 20.474999999999998 24.7 29.975 24.85 10-14 21.745 28.645 26.935 22.675 15-19 22.58 27.965 27.675 21.78 20-24 22.650000000000002 28.084999999999997 27.694999999999997 21.57 25-29 22.435 28.134999999999998 27.61 21.82 30-34 22.55 27.58 28.34 21.529999999999998 35-39 22.470000000000002 27.935 28.115000000000002 21.48 40-44 22.16 28.32 28.044999999999998 21.475 45-49 22.81 27.584999999999997 27.950000000000003 21.654999999999998 50-54 22.605 28.22 27.485 21.69 55-59 22.945 27.389999999999997 27.889999999999997 21.775 60-64 23.635 27.345000000000002 27.615000000000002 21.404999999999998 65-69 23.085 27.985 26.979999999999997 21.95 70-74 23.150000000000002 28.155 26.93 21.765 75-79 23.565 27.465 27.775 21.195 80-84 22.905 28.025 27.295 21.775 85-89 23.565 27.560000000000002 26.97 21.905 90-94 23.395 27.355 27.42 21.83 95-99 22.73 28.1 27.395000000000003 21.775 100-104 23.265 27.765 27.51 21.46 105-109 22.99 28.365000000000002 27.315 21.33 110-114 23.255 27.644999999999996 27.605 21.495 115-119 23.799999999999997 27.27 27.785 21.145 120-124 23.455000000000002 27.29 27.625 21.63 125-129 23.935000000000002 27.345000000000002 27.395000000000003 21.325 130-134 24.0 27.744999999999997 27.284999999999997 20.97 135-139 24.245 27.615000000000002 27.525 20.615 140-144 24.235 27.63 26.939999999999998 21.195 145-149 24.63 27.810000000000002 26.85 20.71 150-151 25.275 27.500000000000004 26.987499999999997 20.2375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 1.0 20 0.5 21 0.5 22 0.0 23 0.5 24 2.0 25 3.5 26 4.0 27 3.5 28 2.5 29 8.5 30 14.5 31 22.0 32 22.5 33 22.0 34 36.0 35 58.5 36 78.5 37 97.5 38 139.5 39 177.0 40 200.0 41 228.0 42 254.5 43 263.0 44 268.5 45 276.0 46 261.0 47 240.5 48 222.0 49 203.5 50 169.5 51 133.0 52 109.0 53 94.5 54 87.5 55 76.0 56 60.0 57 40.5 58 28.0 59 21.5 60 18.0 61 11.0 62 8.5 63 7.5 64 3.0 65 2.0 66 2.5 67 2.5 68 2.5 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.425 #Duplication Level Percentage of deduplicated Percentage of total 1 94.57241196716971 89.3 2 5.030447445062219 9.5 3 0.3177124702144559 0.8999999999999999 4 0.07942811755361398 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.5499999999999998 0.0 0.0 0.0 0.0 122-123 1.6749999999999998 0.0 0.0 0.0 0.0 124-125 1.8125 0.0 0.0 0.0 0.0 126-127 2.0 0.0 0.0 0.0 0.0 128-129 2.2875 0.0 0.0 0.0 0.0 130-131 2.4875 0.0 0.0 0.0 0.0 132-133 2.75 0.0 0.0 0.0 0.0 134-135 3.0625 0.0 0.0 0.0 0.0 136-137 3.325 0.0 0.0 0.0 0.0 138-139 3.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTAAA 10 0.006830828 145.0 5 AAAAAAA 20 0.00593511 29.0 55-59 >>END_MODULE Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090589 spots for SRR12671691.sra Written 1090589 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra Read 1090583 spots for SRR12671691.sra Written 1090583 spots for SRR12671691.sra SRR ids: ['SRR12671691.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3zjnupyt SRR12671691.sra spots: 21811666 blocks: [[1, 1090583], [1090584, 2181166], [2181167, 3271749], [3271750, 4362332], [4362333, 5452915], [5452916, 6543498], [6543499, 7634081], [7634082, 8724664], [8724665, 9815247], [9815248, 10905830], [10905831, 11996413], [11996414, 13086996], [13086997, 14177579], [14177580, 15268162], [15268163, 16358745], [16358746, 17449328], [17449329, 18539911], [18539912, 19630494], [19630495, 20721077], [20721078, 21811666]] SRR12671691 file size 7390857 SRR12671691 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671691 SRR12671691_1.fastq SRR12671691_2.fastq Input file: SRR12671691_1.fastq Paired file: SRR12671691_2.fastq trimmed: SRR12671691-trimmed-pair1.fastq, SRR12671691-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 12:53:55 2025 >> started Thu Apr 10 12:54:28 2025 >> done (33.324s) 21811666 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 1445 ( 0.01%) empty read pairs filtered out after trimming by size control 21810197 (99.99%) read pairs available; of these: 1048955 ( 4.81%) trimmed read pairs available after processing 20761242 (95.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 0 0.00% 23 2 0.00% 24 6 0.00% 25 8 0.00% 26 6 0.00% 27 2 0.00% 28 8 0.00% 29 4 0.00% 30 6 0.00% 31 8 0.00% 32 11 0.00% 33 5 0.00% 34 14 0.00% 35 8 0.00% 36 12 0.00% 37 10 0.00% 38 9 0.00% 39 22 0.00% 40 20 0.00% 41 19 0.00% 42 22 0.00% 43 21 0.00% 44 22 0.00% 45 25 0.00% 46 20 0.00% 47 32 0.00% 48 33 0.00% 49 30 0.00% 50 56 0.00% 51 62 0.00% 52 51 0.00% 53 72 0.00% 54 72 0.00% 55 79 0.00% 56 66 0.00% 57 71 0.00% 58 81 0.00% 59 89 0.00% 60 106 0.00% 61 150 0.00% 62 160 0.00% 63 169 0.00% 64 168 0.00% 65 166 0.00% 66 182 0.00% 67 216 0.00% 68 217 0.00% 69 263 0.00% 70 326 0.00% 71 350 0.00% 72 436 0.00% 73 464 0.00% 74 531 0.00% 75 573 0.00% 76 604 0.00% 77 635 0.00% 78 749 0.00% 79 774 0.00% 80 948 0.00% 81 1017 0.00% 82 1216 0.01% 83 1464 0.01% 84 1509 0.01% 85 1635 0.01% 86 1780 0.01% 87 1870 0.01% 88 2040 0.01% 89 2130 0.01% 90 2547 0.01% 91 2747 0.01% 92 3125 0.01% 93 3467 0.02% 94 3970 0.02% 95 4018 0.02% 96 4261 0.02% 97 4434 0.02% 98 4688 0.02% 99 4972 0.02% 100 5154 0.02% 101 5699 0.03% 102 6441 0.03% 103 6766 0.03% 104 7261 0.03% 105 7731 0.04% 106 8091 0.04% 107 8294 0.04% 108 8504 0.04% 109 8944 0.04% 110 9314 0.04% 111 9939 0.05% 112 10570 0.05% 113 11317 0.05% 114 11946 0.05% 115 12796 0.06% 116 13225 0.06% 117 13708 0.06% 118 13860 0.06% 119 14063 0.06% 120 14441 0.07% 121 15130 0.07% 122 15868 0.07% 123 17229 0.08% 124 17952 0.08% 125 19130 0.09% 126 19136 0.09% 127 19824 0.09% 128 19862 0.09% 129 20425 0.09% 130 20837 0.10% 131 21682 0.10% 132 22406 0.10% 133 24065 0.11% 134 24685 0.11% 135 25914 0.12% 136 26732 0.12% 137 27705 0.13% 138 27440 0.13% 139 27882 0.13% 140 28306 0.13% 141 28480 0.13% 142 30000 0.14% 143 31062 0.14% 144 33288 0.15% 145 33948 0.16% 146 35476 0.16% 147 36024 0.17% 148 36128 0.17% 149 35918 0.16% 150 36189 0.17% 151 20761242 95.19% 21810197 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=29 prefix-density=0.57 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=197.75 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.9 sequence=CTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATTCC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=28 prefix-density=0.76 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=40.41 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.3 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC SRR12671691 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 12:55:13 Started mapping on | Apr 10 12:55:13 Finished on | Apr 10 12:57:28 Mapping speed, Million of reads per hour | 581.61 Number of input reads | 21810197 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20477615 Uniquely mapped reads % | 93.89% Average mapped length | 298.75 Number of splices: Total | 20686993 Number of splices: Annotated (sjdb) | 20265133 Number of splices: GT/AG | 20290662 Number of splices: GC/AG | 327399 Number of splices: AT/AC | 11609 Number of splices: Non-canonical | 57323 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 509434 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 66742 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.37% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 823148 823148 823148 N_multimapping 509434 509434 509434 N_noFeature 649600 20127067 757541 N_ambiguous 363606 1516 120144 UnstrandedReadsAssigned:19464409 PositiveStrandReadsAssigned:349032 NegativeStrandReadsAssigned:19599930 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671691 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671691-trimmed-pair1.fastq SRR12671691-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,810,197 reads, 19,520,617 reads pseudoaligned [quant] estimated average fragment length: 305.964 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR12671691.ke.tsv 34699 SRR12671691.se.tsv 87100 total ==> SRR12671691.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1713.04 638 16.7477 Potri.005G024800.1.v4.1 1035 730.036 219 13.4897 Potri.004G059700.1.v4.1 961 656.618 2 0.136968 Potri.007G009000.2.v4.1 1416 1111.04 0 0 Potri.003G141000.2.v4.1 2943 2638.04 1202.4 20.496 Potri.016G087400.1.v4.1 270 72.0058 1039 648.857 Potri.015G069301.1.v4.1 564 287.169 0 0 Potri.010G195200.1.v4.1 1773 1468.04 37 1.13336 Potri.012G127500.1.v4.1 977 672.357 190 12.7073 ==> SRR12671691.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 212 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 2 SRR12671691 completed mapping pipeline successfully