Starting /dee2/code/volunteer_pipeline.sh SRR12671692 current disk space = 3048973979648 free memory = 1544934856 SRR12671692 SRAfilesize 97a55826068449922c79271c081c2f35 SRR12671692.sra SRR12671692.sra file validated SRR12671692 is paired end SRR12671692 is conventional basespace SRR12671692 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671692_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4095 37.0 37.0 37.0 37.0 37.0 2 36.19625 37.0 37.0 37.0 37.0 37.0 3 36.452 37.0 37.0 37.0 37.0 37.0 4 36.545 37.0 37.0 37.0 37.0 37.0 5 36.525 37.0 37.0 37.0 37.0 37.0 6 36.497 37.0 37.0 37.0 37.0 37.0 7 36.51 37.0 37.0 37.0 37.0 37.0 8 36.5595 37.0 37.0 37.0 37.0 37.0 9 36.538 37.0 37.0 37.0 37.0 37.0 10-14 36.527499999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5258 37.0 37.0 37.0 37.0 37.0 20-24 36.5258 37.0 37.0 37.0 37.0 37.0 25-29 36.477599999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4787 37.0 37.0 37.0 37.0 37.0 35-39 36.4664 37.0 37.0 37.0 37.0 37.0 40-44 36.495400000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4115 37.0 37.0 37.0 37.0 37.0 50-54 36.3863 37.0 37.0 37.0 37.0 37.0 55-59 36.416399999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.4522 37.0 37.0 37.0 37.0 37.0 65-69 36.3482 37.0 37.0 37.0 37.0 37.0 70-74 36.313900000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2966 37.0 37.0 37.0 37.0 37.0 80-84 36.3317 37.0 37.0 37.0 37.0 37.0 85-89 36.2551 37.0 37.0 37.0 37.0 37.0 90-94 36.290499999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.1971 37.0 37.0 37.0 37.0 37.0 100-104 36.236000000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.1859 37.0 37.0 37.0 37.0 37.0 110-114 36.1342 37.0 37.0 37.0 37.0 37.0 115-119 36.1536 37.0 37.0 37.0 37.0 37.0 120-124 36.065200000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.1075 37.0 37.0 37.0 37.0 37.0 130-134 36.0127 37.0 37.0 37.0 37.0 37.0 135-139 35.9593 37.0 37.0 37.0 37.0 37.0 140-144 35.9308 37.0 37.0 37.0 37.0 37.0 145-149 35.902 37.0 37.0 37.0 37.0 37.0 150-151 35.39 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 0.0 25 1.0 26 3.0 27 7.0 28 14.0 29 18.0 30 29.0 31 32.0 32 46.0 33 63.0 34 123.0 35 306.0 36 2950.0 37 406.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.125 13.275 14.725 39.875 2 19.222082810539522 20.175658720200754 38.06775407779172 22.534504391468005 3 19.1 24.4 28.15 28.349999999999998 4 21.75 33.975 22.325 21.95 5 20.75 36.125 23.625 19.5 6 18.175 36.275 25.775 19.775000000000002 7 14.924999999999999 21.65 43.325 20.1 8 18.3 23.275000000000002 29.099999999999998 29.325000000000003 9 16.725 24.075 31.724999999999998 27.474999999999998 10-14 19.759999999999998 29.265 26.695 24.279999999999998 15-19 19.96 27.965 28.03 24.044999999999998 20-24 20.085 28.455000000000002 27.689999999999998 23.77 25-29 20.225 28.015 27.515 24.245 30-34 20.175 28.595 27.384999999999998 23.845 35-39 20.294999999999998 28.610000000000003 27.084999999999997 24.01 40-44 20.49 28.084999999999997 27.445000000000004 23.98 45-49 20.82 28.325 26.855 24.0 50-54 20.235 28.42 27.12 24.224999999999998 55-59 20.080000000000002 28.605000000000004 27.105 24.21 60-64 20.294999999999998 27.894999999999996 27.334999999999997 24.474999999999998 65-69 20.244999999999997 28.22 27.275 24.26 70-74 20.71 27.32 26.865 25.105 75-79 20.349999999999998 27.58 27.450000000000003 24.62 80-84 20.485 27.66 27.615000000000002 24.240000000000002 85-89 20.65 28.585 27.02 23.745 90-94 20.875 27.089999999999996 27.57 24.465 95-99 20.705000000000002 28.299999999999997 26.955000000000002 24.04 100-104 21.05 27.310000000000002 27.500000000000004 24.14 105-109 20.995 27.515 26.889999999999997 24.6 110-114 21.235 26.889999999999997 27.584999999999997 24.29 115-119 21.099999999999998 27.315 27.315 24.27 120-124 20.380000000000003 27.765 27.52 24.335 125-129 21.17 26.855 27.57 24.404999999999998 130-134 20.825 27.38 27.365000000000002 24.43 135-139 20.78 27.694999999999997 26.715 24.81 140-144 21.705 27.235 26.96 24.099999999999998 145-149 21.029999999999998 26.905 27.485 24.58 150-151 21.0125 27.450000000000003 27.35 24.1875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 3.0 22 2.5 23 1.5 24 2.5 25 3.5 26 5.5 27 6.0 28 8.0 29 13.0 30 15.0 31 20.0 32 32.0 33 40.0 34 54.0 35 75.5 36 93.0 37 109.0 38 123.5 39 142.0 40 169.5 41 199.0 42 212.5 43 222.5 44 238.0 45 235.0 46 239.0 47 252.5 48 247.5 49 230.5 50 200.5 51 167.5 52 148.0 53 114.5 54 90.0 55 80.0 56 52.5 57 40.0 58 35.0 59 24.5 60 18.0 61 12.0 62 6.5 63 5.0 64 2.5 65 1.5 66 1.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.375 #Duplication Level Percentage of deduplicated Percentage of total 1 93.65461847389558 87.45 2 5.7028112449799195 10.65 3 0.535475234270415 1.5 4 0.107095046854083 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.38749999999999996 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.075 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.1749999999999998 0.0 0.0 0.0 0.0 130-131 1.275 0.0 0.0 0.0 0.0 132-133 1.45 0.0 0.0 0.0 0.0 134-135 1.7375 0.0 0.0 0.0 0.0 136-137 1.875 0.0 0.0 0.0 0.0 138-139 1.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTTCG 10 0.006830828 145.0 3 >>END_MODULE SRR12671692 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671692_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2745 37.0 37.0 37.0 37.0 37.0 2 36.1345 37.0 37.0 37.0 37.0 37.0 3 36.247 37.0 37.0 37.0 37.0 37.0 4 36.1895 37.0 37.0 37.0 37.0 37.0 5 36.347 37.0 37.0 37.0 37.0 37.0 6 36.2205 37.0 37.0 37.0 37.0 37.0 7 36.384 37.0 37.0 37.0 37.0 37.0 8 36.4015 37.0 37.0 37.0 37.0 37.0 9 36.375 37.0 37.0 37.0 37.0 37.0 10-14 36.3283 37.0 37.0 37.0 37.0 37.0 15-19 36.3024 37.0 37.0 37.0 37.0 37.0 20-24 36.257000000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1991 37.0 37.0 37.0 37.0 37.0 30-34 36.2193 37.0 37.0 37.0 37.0 37.0 35-39 36.203700000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.1553 37.0 37.0 37.0 37.0 37.0 45-49 36.1711 37.0 37.0 37.0 37.0 37.0 50-54 36.160999999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.1048 37.0 37.0 37.0 37.0 37.0 60-64 36.096000000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.0618 37.0 37.0 37.0 37.0 37.0 70-74 36.1072 37.0 37.0 37.0 37.0 37.0 75-79 36.0049 37.0 37.0 37.0 37.0 37.0 80-84 36.0109 37.0 37.0 37.0 37.0 37.0 85-89 35.9965 37.0 37.0 37.0 37.0 37.0 90-94 35.97860000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.972899999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.865899999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.8393 37.0 37.0 37.0 37.0 37.0 110-114 35.828700000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.8163 37.0 37.0 37.0 37.0 37.0 120-124 35.8172 37.0 37.0 37.0 37.0 37.0 125-129 35.718599999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.73440000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.7258 37.0 37.0 37.0 37.0 37.0 140-144 35.5634 37.0 37.0 37.0 37.0 37.0 145-149 35.6171 37.0 37.0 37.0 37.0 37.0 150-151 35.292500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 3.0 16 1.0 17 0.0 18 0.0 19 3.0 20 0.0 21 1.0 22 3.0 23 3.0 24 4.0 25 7.0 26 8.0 27 11.0 28 13.0 29 16.0 30 31.0 31 27.0 32 60.0 33 79.0 34 166.0 35 509.0 36 2799.0 37 253.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.0 16.5 18.7 30.8 2 28.1 22.2 34.275 15.425 3 22.2 26.174999999999997 30.825000000000003 20.8 4 24.224999999999998 35.475 20.474999999999998 19.825 5 25.55 36.4 19.475 18.575 6 20.724999999999998 36.775000000000006 22.425 20.075000000000003 7 18.3 17.275 42.75 21.675 8 22.900000000000002 22.775000000000002 26.525 27.800000000000004 9 22.825 24.075 27.500000000000004 25.6 10-14 23.669999999999998 28.044999999999998 25.929999999999996 22.355 15-19 23.215 27.900000000000002 26.43 22.455 20-24 23.745 27.46 26.96 21.834999999999997 25-29 23.57 27.345000000000002 27.325 21.759999999999998 30-34 22.88 28.455000000000002 27.325 21.34 35-39 23.27 27.744999999999997 26.775 22.21 40-44 23.585 27.915 26.889999999999997 21.61 45-49 23.49 28.29 27.005000000000003 21.215 50-54 23.275000000000002 28.335 27.015 21.375 55-59 23.755000000000003 27.544999999999998 27.089999999999996 21.61 60-64 23.674999999999997 27.22 27.084999999999997 22.02 65-69 24.005000000000003 27.755000000000003 26.27 21.97 70-74 23.03 27.805000000000003 26.83 22.335 75-79 23.810000000000002 27.52 26.884999999999998 21.785 80-84 24.135 28.03 26.055 21.78 85-89 24.095 27.0 27.055 21.85 90-94 23.630000000000003 28.32 26.07 21.98 95-99 24.33 27.779999999999998 26.415 21.475 100-104 23.97 28.21 26.815 21.005 105-109 23.905 27.08 27.32 21.695 110-114 24.37 27.395000000000003 27.169999999999998 21.065 115-119 23.995 27.675 27.055 21.275 120-124 24.26 27.884999999999998 26.815 21.04 125-129 24.58 27.6 26.534999999999997 21.285 130-134 24.135 28.095 26.71 21.060000000000002 135-139 24.325 27.884999999999998 27.055 20.735 140-144 24.154999999999998 28.360000000000003 26.31 21.175 145-149 24.415 28.015 26.77 20.8 150-151 24.3125 27.725 27.187499999999996 20.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 2.0 7 2.5 8 2.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 1.0 22 1.5 23 1.0 24 2.0 25 2.0 26 1.0 27 2.0 28 3.0 29 3.5 30 4.0 31 6.5 32 9.5 33 17.5 34 27.5 35 36.0 36 59.5 37 83.5 38 104.5 39 133.0 40 174.0 41 202.0 42 206.0 43 249.5 44 299.0 45 278.5 46 250.5 47 250.5 48 251.0 49 230.0 50 211.5 51 192.5 52 145.5 53 114.0 54 101.0 55 83.5 56 59.5 57 45.0 58 31.0 59 27.5 60 26.5 61 16.0 62 13.0 63 11.5 64 9.0 65 3.5 66 1.0 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.19595314164005 88.44999999999999 2 5.1916932907348246 9.75 3 0.5324813631522897 1.5 4 0.07987220447284345 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.38749999999999996 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.075 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.1749999999999998 0.0 0.0 0.0 0.0 130-131 1.275 0.0 0.0 0.0 0.0 132-133 1.45 0.0 0.0 0.0 0.0 134-135 1.7375 0.0 0.0 0.0 0.0 136-137 1.875 0.0 0.0 0.0 0.0 138-139 1.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTTCG 10 0.006830828 145.0 9 GAGTTGT 10 0.006830828 145.0 5 GAGTTCT 10 0.006830828 145.0 9 AGTTGTT 10 0.006830828 145.0 6 >>END_MODULE Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143571 spots for SRR12671692.sra Written 1143571 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra Read 1143565 spots for SRR12671692.sra Written 1143565 spots for SRR12671692.sra SRR ids: ['SRR12671692.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u8vk_137 SRR12671692.sra spots: 22871306 blocks: [[1, 1143565], [1143566, 2287130], [2287131, 3430695], [3430696, 4574260], [4574261, 5717825], [5717826, 6861390], [6861391, 8004955], [8004956, 9148520], [9148521, 10292085], [10292086, 11435650], [11435651, 12579215], [12579216, 13722780], [13722781, 14866345], [14866346, 16009910], [16009911, 17153475], [17153476, 18297040], [18297041, 19440605], [19440606, 20584170], [20584171, 21727735], [21727736, 22871306]] SRR12671692 file size 7750970 SRR12671692 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671692 SRR12671692_1.fastq SRR12671692_2.fastq Input file: SRR12671692_1.fastq Paired file: SRR12671692_2.fastq trimmed: SRR12671692-trimmed-pair1.fastq, SRR12671692-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:48:02 2025 >> started Wed Feb 12 03:48:26 2025 >> done (23.944s) 22871306 read pairs processed; of these: 12 ( 0.00%) short read pairs filtered out after trimming by size control 2719 ( 0.01%) empty read pairs filtered out after trimming by size control 22868575 (99.99%) read pairs available; of these: 858960 ( 3.76%) trimmed read pairs available after processing 22009615 (96.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 0 0.00% 21 4 0.00% 22 3 0.00% 23 5 0.00% 24 4 0.00% 25 2 0.00% 26 2 0.00% 27 5 0.00% 28 5 0.00% 29 5 0.00% 30 6 0.00% 31 9 0.00% 32 4 0.00% 33 6 0.00% 34 6 0.00% 35 7 0.00% 36 6 0.00% 37 15 0.00% 38 9 0.00% 39 11 0.00% 40 24 0.00% 41 11 0.00% 42 10 0.00% 43 19 0.00% 44 26 0.00% 45 17 0.00% 46 22 0.00% 47 18 0.00% 48 27 0.00% 49 28 0.00% 50 40 0.00% 51 33 0.00% 52 38 0.00% 53 31 0.00% 54 37 0.00% 55 46 0.00% 56 36 0.00% 57 62 0.00% 58 63 0.00% 59 69 0.00% 60 78 0.00% 61 95 0.00% 62 107 0.00% 63 129 0.00% 64 108 0.00% 65 119 0.00% 66 113 0.00% 67 156 0.00% 68 131 0.00% 69 189 0.00% 70 211 0.00% 71 230 0.00% 72 242 0.00% 73 362 0.00% 74 331 0.00% 75 361 0.00% 76 365 0.00% 77 404 0.00% 78 494 0.00% 79 532 0.00% 80 611 0.00% 81 670 0.00% 82 809 0.00% 83 893 0.00% 84 930 0.00% 85 1091 0.00% 86 1150 0.01% 87 1258 0.01% 88 1376 0.01% 89 1433 0.01% 90 1651 0.01% 91 1845 0.01% 92 2000 0.01% 93 2253 0.01% 94 2561 0.01% 95 2742 0.01% 96 2750 0.01% 97 3115 0.01% 98 3194 0.01% 99 3511 0.02% 100 3609 0.02% 101 4041 0.02% 102 4296 0.02% 103 4730 0.02% 104 5091 0.02% 105 5212 0.02% 106 5622 0.02% 107 5858 0.03% 108 6252 0.03% 109 6560 0.03% 110 6679 0.03% 111 7093 0.03% 112 7530 0.03% 113 8073 0.04% 114 8614 0.04% 115 9356 0.04% 116 9473 0.04% 117 10065 0.04% 118 10300 0.05% 119 10566 0.05% 120 11168 0.05% 121 11687 0.05% 122 12157 0.05% 123 13096 0.06% 124 13845 0.06% 125 14539 0.06% 126 15220 0.07% 127 15755 0.07% 128 15804 0.07% 129 16578 0.07% 130 17359 0.08% 131 17769 0.08% 132 18729 0.08% 133 19699 0.09% 134 20656 0.09% 135 21912 0.10% 136 22292 0.10% 137 23001 0.10% 138 23571 0.10% 139 24333 0.11% 140 24795 0.11% 141 25548 0.11% 142 26760 0.12% 143 28292 0.12% 144 29129 0.13% 145 30842 0.13% 146 31106 0.14% 147 32179 0.14% 148 33211 0.15% 149 33305 0.15% 150 34225 0.15% 151 22009615 96.24% 22868575 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=13 prefix-density=0.87 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=15.46 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.4 sequence=CCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAAC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=13 prefix-density=0.79 prefix-fanout=2.5 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=20 fanout-score=52.19 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.1 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCT SRR12671692 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:49:06 Started mapping on | Feb 12 03:49:07 Finished on | Feb 12 03:51:09 Mapping speed, Million of reads per hour | 674.81 Number of input reads | 22868575 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 21242637 Uniquely mapped reads % | 92.89% Average mapped length | 299.38 Number of splices: Total | 21484130 Number of splices: Annotated (sjdb) | 21141078 Number of splices: GT/AG | 21036239 Number of splices: GC/AG | 384037 Number of splices: AT/AC | 13265 Number of splices: Non-canonical | 50589 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 534036 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 204656 % of reads mapped to too many loci | 0.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.69% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1091902 1091902 1091902 N_multimapping 534036 534036 534036 N_noFeature 476261 20897162 550247 N_ambiguous 411868 1800 139329 UnstrandedReadsAssigned:20354508 PositiveStrandReadsAssigned:343675 NegativeStrandReadsAssigned:20553061 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671692 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671692-trimmed-pair1.fastq SRR12671692-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,868,575 reads, 20,712,755 reads pseudoaligned [quant] estimated average fragment length: 288.91 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR12671692.ke.tsv 34699 SRR12671692.se.tsv 87100 total ==> SRR12671692.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1730.09 724 16.7052 Potri.005G024800.1.v4.1 1035 747.09 202 10.7934 Potri.004G059700.1.v4.1 961 673.266 26 1.54159 Potri.007G009000.2.v4.1 1416 1128.09 0 0 Potri.003G141000.2.v4.1 2943 2655.09 756 11.3664 Potri.016G087400.1.v4.1 270 66.8856 1244.72 742.881 Potri.015G069301.1.v4.1 564 291.505 0 0 Potri.010G195200.1.v4.1 1773 1485.09 78 2.09663 Potri.012G127500.1.v4.1 977 689.176 509 29.4828 ==> SRR12671692.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 511 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 511 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671692 completed mapping pipeline successfully