Starting /dee2/code/volunteer_pipeline.sh SRR12671694 current disk space = 3049138184192 free memory = 1576845476 SRR12671694 SRAfilesize 0c44d42e881014c7d67ef96a40cd9538 SRR12671694.sra SRR12671694.sra file validated SRR12671694 is paired end SRR12671694 is conventional basespace SRR12671694 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671694_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4425 37.0 37.0 37.0 37.0 37.0 2 36.2865 37.0 37.0 37.0 37.0 37.0 3 36.449 37.0 37.0 37.0 37.0 37.0 4 36.528 37.0 37.0 37.0 37.0 37.0 5 36.5515 37.0 37.0 37.0 37.0 37.0 6 36.4125 37.0 37.0 37.0 37.0 37.0 7 36.431 37.0 37.0 37.0 37.0 37.0 8 36.5545 37.0 37.0 37.0 37.0 37.0 9 36.541 37.0 37.0 37.0 37.0 37.0 10-14 36.532 37.0 37.0 37.0 37.0 37.0 15-19 36.4405 37.0 37.0 37.0 37.0 37.0 20-24 36.4705 37.0 37.0 37.0 37.0 37.0 25-29 36.4044 37.0 37.0 37.0 37.0 37.0 30-34 36.4294 37.0 37.0 37.0 37.0 37.0 35-39 36.4313 37.0 37.0 37.0 37.0 37.0 40-44 36.3866 37.0 37.0 37.0 37.0 37.0 45-49 36.352700000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.3286 37.0 37.0 37.0 37.0 37.0 55-59 36.306400000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3305 37.0 37.0 37.0 37.0 37.0 65-69 36.3231 37.0 37.0 37.0 37.0 37.0 70-74 36.3031 37.0 37.0 37.0 37.0 37.0 75-79 36.306799999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.272800000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2666 37.0 37.0 37.0 37.0 37.0 90-94 36.1617 37.0 37.0 37.0 37.0 37.0 95-99 36.1718 37.0 37.0 37.0 37.0 37.0 100-104 36.202600000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.1392 37.0 37.0 37.0 37.0 37.0 110-114 36.12519999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.1026 37.0 37.0 37.0 37.0 37.0 120-124 36.077999999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.051300000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.9902 37.0 37.0 37.0 37.0 37.0 135-139 35.9462 37.0 37.0 37.0 37.0 37.0 140-144 35.8962 37.0 37.0 37.0 37.0 37.0 145-149 35.8793 37.0 37.0 37.0 37.0 37.0 150-151 35.385999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 4.0 26 1.0 27 8.0 28 20.0 29 17.0 30 25.0 31 37.0 32 62.0 33 63.0 34 134.0 35 298.0 36 2973.0 37 356.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.675 13.900000000000002 14.000000000000002 42.425000000000004 2 19.82974461692539 21.28192288432649 37.180771156735105 21.707561342013022 3 18.075 27.250000000000004 25.6 29.075 4 21.725 33.25 21.125 23.9 5 21.525 37.525 23.125 17.825 6 18.775 36.075 25.2 19.950000000000003 7 14.475 21.775 44.55 19.2 8 18.95 22.575 29.799999999999997 28.675 9 18.825 21.9 33.550000000000004 25.724999999999998 10-14 19.79 29.455 27.115000000000002 23.64 15-19 19.830000000000002 28.28 27.76 24.13 20-24 20.925 28.249999999999996 27.584999999999997 23.24 25-29 20.369999999999997 29.294999999999998 27.27 23.064999999999998 30-34 20.16 28.535 27.639999999999997 23.665 35-39 20.39 29.125 26.83 23.655 40-44 20.335 29.12 26.729999999999997 23.815 45-49 20.95 28.384999999999998 26.965 23.7 50-54 21.015 28.060000000000002 26.8 24.125 55-59 20.424999999999997 28.810000000000002 26.66 24.104999999999997 60-64 20.31 28.675 27.089999999999996 23.925 65-69 20.810000000000002 27.97 27.05 24.169999999999998 70-74 20.44 28.13 27.555000000000003 23.875 75-79 20.785 28.89 26.8 23.525 80-84 20.445 27.785 27.42 24.349999999999998 85-89 20.294999999999998 27.79 27.560000000000002 24.355 90-94 20.935000000000002 27.450000000000003 27.165 24.45 95-99 20.935000000000002 27.855 27.0 24.21 100-104 20.72 28.125 26.88 24.275 105-109 21.37 27.505000000000003 27.284999999999997 23.84 110-114 21.295 27.775 27.229999999999997 23.7 115-119 21.705 27.68 26.955000000000002 23.66 120-124 21.515 27.284999999999997 27.43 23.77 125-129 21.39 28.095 26.775 23.74 130-134 21.325 27.639999999999997 26.765 24.27 135-139 21.7 27.145000000000003 26.77 24.385 140-144 20.965 27.18 27.195000000000004 24.66 145-149 21.67 27.485 27.435 23.41 150-151 21.3625 28.1625 25.6 24.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 4.0 24 4.5 25 6.0 26 8.0 27 10.0 28 14.5 29 19.5 30 24.0 31 26.5 32 39.0 33 52.5 34 64.5 35 83.0 36 104.5 37 108.5 38 118.5 39 143.5 40 164.5 41 199.0 42 221.0 43 217.0 44 224.5 45 227.5 46 225.5 47 231.0 48 222.0 49 209.5 50 186.5 51 158.5 52 129.5 53 102.5 54 86.5 55 76.0 56 65.0 57 51.0 58 41.5 59 36.0 60 29.5 61 22.5 62 14.5 63 8.5 64 5.0 65 2.0 66 1.0 67 0.5 68 1.0 69 1.5 70 0.5 71 0.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.075 #Duplication Level Percentage of deduplicated Percentage of total 1 94.0473026840287 88.47500000000001 2 5.633802816901409 10.6 3 0.29231995748073347 0.8250000000000001 4 0.026574541589157584 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.3250000000000002 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.5750000000000002 0.0 0.0 0.0 0.0 130-131 1.8625 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.1625 0.0 0.0 0.0 0.0 136-137 2.5375 0.0 0.0 0.0 0.0 138-139 2.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGCA 10 0.006830828 145.0 9 AATATAG 10 0.006830828 145.0 5 >>END_MODULE SRR12671694 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671694_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2615 37.0 37.0 37.0 37.0 37.0 2 36.0335 37.0 37.0 37.0 37.0 37.0 3 36.065 37.0 37.0 37.0 37.0 37.0 4 36.082 37.0 37.0 37.0 37.0 37.0 5 36.297 37.0 37.0 37.0 37.0 37.0 6 36.24 37.0 37.0 37.0 37.0 37.0 7 36.1725 37.0 37.0 37.0 37.0 37.0 8 36.3205 37.0 37.0 37.0 37.0 37.0 9 36.175 37.0 37.0 37.0 37.0 37.0 10-14 36.28779999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.2818 37.0 37.0 37.0 37.0 37.0 20-24 36.27 37.0 37.0 37.0 37.0 37.0 25-29 36.201 37.0 37.0 37.0 37.0 37.0 30-34 36.1773 37.0 37.0 37.0 37.0 37.0 35-39 36.179199999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.1157 37.0 37.0 37.0 37.0 37.0 45-49 36.103300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.062200000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.0448 37.0 37.0 37.0 37.0 37.0 60-64 36.0147 37.0 37.0 37.0 37.0 37.0 65-69 36.039300000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.9632 37.0 37.0 37.0 37.0 37.0 75-79 35.929199999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.964 37.0 37.0 37.0 37.0 37.0 85-89 35.9072 37.0 37.0 37.0 37.0 37.0 90-94 35.88870000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.9105 37.0 37.0 37.0 37.0 37.0 100-104 35.8731 37.0 37.0 37.0 37.0 37.0 105-109 35.8175 37.0 37.0 37.0 37.0 37.0 110-114 35.697500000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.7589 37.0 37.0 37.0 37.0 37.0 120-124 35.68390000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.6479 37.0 37.0 37.0 37.0 37.0 130-134 35.693 37.0 37.0 37.0 37.0 37.0 135-139 35.6205 37.0 37.0 37.0 37.0 37.0 140-144 35.4214 37.0 37.0 37.0 37.0 37.0 145-149 35.430600000000005 37.0 37.0 37.0 34.6 37.0 150-151 35.034 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 0.0 15 0.0 16 3.0 17 1.0 18 1.0 19 0.0 20 0.0 21 2.0 22 4.0 23 4.0 24 4.0 25 6.0 26 6.0 27 15.0 28 11.0 29 20.0 30 33.0 31 35.0 32 77.0 33 108.0 34 166.0 35 507.0 36 2765.0 37 229.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.650000000000006 17.849999999999998 16.975 31.525 2 27.725 22.525000000000002 33.900000000000006 15.85 3 21.45 26.75 29.975 21.825 4 23.400000000000002 33.925 21.85 20.825 5 24.85 35.675000000000004 21.675 17.8 6 20.150000000000002 37.325 21.975 20.549999999999997 7 18.9 17.625 41.675000000000004 21.8 8 21.525 23.025000000000002 27.025 28.425 9 21.75 24.375 28.15 25.724999999999998 10-14 23.835 28.255000000000003 25.365 22.545 15-19 23.66 27.83 26.465 22.045 20-24 23.455000000000002 27.900000000000002 26.810000000000002 21.834999999999997 25-29 22.945 27.97 27.405 21.68 30-34 23.064999999999998 28.044999999999998 26.69 22.2 35-39 23.325000000000003 28.02 26.805 21.85 40-44 23.575 28.48 26.484999999999996 21.46 45-49 22.88 27.395000000000003 27.435 22.29 50-54 23.765 27.975 26.75 21.51 55-59 23.96 27.85 26.619999999999997 21.57 60-64 23.494999999999997 27.034999999999997 27.51 21.959999999999997 65-69 23.705000000000002 26.93 26.979999999999997 22.384999999999998 70-74 23.385 27.26 27.250000000000004 22.105 75-79 23.825 27.33 26.72 22.125 80-84 23.73 27.250000000000004 27.229999999999997 21.790000000000003 85-89 24.13 26.985 26.83 22.055 90-94 23.315 27.925 26.97 21.790000000000003 95-99 23.455000000000002 27.810000000000002 26.86 21.875 100-104 23.98 27.089999999999996 26.834999999999997 22.095000000000002 105-109 24.18 27.375 27.560000000000002 20.885 110-114 24.015 27.634999999999998 26.75 21.6 115-119 24.34 27.750000000000004 26.91 21.0 120-124 24.51 27.505000000000003 26.729999999999997 21.255 125-129 24.3 27.295 27.084999999999997 21.32 130-134 24.565 27.12 26.91 21.404999999999998 135-139 24.745 27.474999999999998 26.82 20.96 140-144 24.865000000000002 27.425 26.169999999999998 21.54 145-149 25.005 27.675 26.029999999999998 21.29 150-151 24.4 28.125 26.5 20.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 1.0 14 1.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.5 20 2.0 21 1.0 22 0.0 23 0.5 24 1.5 25 1.0 26 2.0 27 3.5 28 4.5 29 8.0 30 12.0 31 15.0 32 22.0 33 32.5 34 37.5 35 46.0 36 69.0 37 94.5 38 113.0 39 124.5 40 158.0 41 202.5 42 214.0 43 229.5 44 248.5 45 251.0 46 258.0 47 251.0 48 240.0 49 213.0 50 177.0 51 164.0 52 145.5 53 118.5 54 101.0 55 90.0 56 75.0 57 63.0 58 54.0 59 39.0 60 32.0 61 28.0 62 17.5 63 8.5 64 3.5 65 3.0 66 1.5 67 2.0 68 1.5 69 0.5 70 1.0 71 1.5 72 2.0 73 1.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 1.0 98 1.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 94.76190476190476 89.55 2 4.761904761904762 9.0 3 0.3968253968253968 1.125 4 0.052910052910052914 0.2 5 0.026455026455026457 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.5249999999999999 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8375 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 0.9874999999999999 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.25 0.0 0.0 0.0 0.0 126-127 1.3625 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.7875 0.0 0.0 0.0 0.0 132-133 1.9500000000000002 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.4875 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGCAG 10 0.006830828 145.0 145 >>END_MODULE Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965128 spots for SRR12671694.sra Written 965128 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra Read 965117 spots for SRR12671694.sra Written 965117 spots for SRR12671694.sra SRR ids: ['SRR12671694.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ryd61cu SRR12671694.sra spots: 19302351 blocks: [[1, 965117], [965118, 1930234], [1930235, 2895351], [2895352, 3860468], [3860469, 4825585], [4825586, 5790702], [5790703, 6755819], [6755820, 7720936], [7720937, 8686053], [8686054, 9651170], [9651171, 10616287], [10616288, 11581404], [11581405, 12546521], [12546522, 13511638], [13511639, 14476755], [14476756, 15441872], [15441873, 16406989], [16406990, 17372106], [17372107, 18337223], [18337224, 19302351]] SRR12671694 file size 6538082 SRR12671694 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671694 SRR12671694_1.fastq SRR12671694_2.fastq Input file: SRR12671694_1.fastq Paired file: SRR12671694_2.fastq trimmed: SRR12671694-trimmed-pair1.fastq, SRR12671694-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:22:05 2025 >> started Wed Feb 12 04:22:26 2025 >> done (21.126s) 19302351 read pairs processed; of these: 12 ( 0.00%) short read pairs filtered out after trimming by size control 1848 ( 0.01%) empty read pairs filtered out after trimming by size control 19300491 (99.99%) read pairs available; of these: 944927 ( 4.90%) trimmed read pairs available after processing 18355564 (95.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 10 0.00% 28 1 0.00% 29 2 0.00% 30 2 0.00% 31 7 0.00% 32 2 0.00% 33 4 0.00% 34 5 0.00% 35 5 0.00% 36 9 0.00% 37 6 0.00% 38 11 0.00% 39 8 0.00% 40 8 0.00% 41 11 0.00% 42 22 0.00% 43 10 0.00% 44 19 0.00% 45 18 0.00% 46 13 0.00% 47 12 0.00% 48 27 0.00% 49 26 0.00% 50 41 0.00% 51 42 0.00% 52 36 0.00% 53 52 0.00% 54 52 0.00% 55 42 0.00% 56 58 0.00% 57 53 0.00% 58 62 0.00% 59 72 0.00% 60 87 0.00% 61 93 0.00% 62 93 0.00% 63 107 0.00% 64 143 0.00% 65 139 0.00% 66 116 0.00% 67 160 0.00% 68 158 0.00% 69 205 0.00% 70 223 0.00% 71 242 0.00% 72 260 0.00% 73 346 0.00% 74 392 0.00% 75 450 0.00% 76 432 0.00% 77 476 0.00% 78 526 0.00% 79 614 0.00% 80 674 0.00% 81 770 0.00% 82 881 0.00% 83 1035 0.01% 84 1159 0.01% 85 1303 0.01% 86 1309 0.01% 87 1377 0.01% 88 1628 0.01% 89 1737 0.01% 90 1944 0.01% 91 2089 0.01% 92 2367 0.01% 93 2687 0.01% 94 3018 0.02% 95 3161 0.02% 96 3477 0.02% 97 3459 0.02% 98 3623 0.02% 99 3826 0.02% 100 4158 0.02% 101 4672 0.02% 102 5102 0.03% 103 5612 0.03% 104 5834 0.03% 105 6296 0.03% 106 6696 0.03% 107 7024 0.04% 108 7134 0.04% 109 7643 0.04% 110 7947 0.04% 111 8662 0.04% 112 8854 0.05% 113 9326 0.05% 114 10104 0.05% 115 10532 0.05% 116 11278 0.06% 117 11579 0.06% 118 11836 0.06% 119 12368 0.06% 120 13247 0.07% 121 13483 0.07% 122 14029 0.07% 123 14916 0.08% 124 15560 0.08% 125 16350 0.08% 126 16886 0.09% 127 17568 0.09% 128 18347 0.10% 129 18814 0.10% 130 18958 0.10% 131 19683 0.10% 132 20501 0.11% 133 21658 0.11% 134 22499 0.12% 135 23571 0.12% 136 24183 0.13% 137 25188 0.13% 138 25717 0.13% 139 26201 0.14% 140 26708 0.14% 141 27528 0.14% 142 28423 0.15% 143 29550 0.15% 144 31182 0.16% 145 31981 0.17% 146 32915 0.17% 147 33599 0.17% 148 34500 0.18% 149 35172 0.18% 150 35808 0.19% 151 18355564 95.10% 19300491 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=30 prefix-density=0.56 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=60.64 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.5 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=12 prefix-density=0.67 prefix-fanout=2.6 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=28.73 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.5 sequence=GCCTTGATAGAGTAAGAGAAAAGCAGAGCAAGCGACTTAGAGGCAGCATTAACAAAGAAGAGTCATGGCAGCCTCTGCAATCCAACAGTCTGCATTTGCTGGCCAGACCGCCTTGAAGCAACCAAATGATCTTGTTCGGAAGGTTGGTTCCTTCGGTGGTGGTCGTGTTACCATGCGCAGGACTGTGAAAAGTGCTCCCCAAAGCATATGGTATGGCCCAGACCGCCCAAAGTTCTTGGGTCCATTCTCTGAGCAAACCCCATCATACCTGACCGGTGAATTCCCTGGTGATTATGGATGGGACACTGC SRR12671694 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:23:10 Started mapping on | Feb 12 04:23:11 Finished on | Feb 12 04:26:01 Mapping speed, Million of reads per hour | 408.72 Number of input reads | 19300491 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 17216124 Uniquely mapped reads % | 89.20% Average mapped length | 298.79 Number of splices: Total | 16128993 Number of splices: Annotated (sjdb) | 15828773 Number of splices: GT/AG | 15800274 Number of splices: GC/AG | 261700 Number of splices: AT/AC | 9828 Number of splices: Non-canonical | 57191 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 593158 % of reads mapped to multiple loci | 3.07% Number of reads mapped to too many loci | 350080 % of reads mapped to too many loci | 1.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.52% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1491209 1491209 1491209 N_multimapping 593158 593158 593158 N_noFeature 606575 16861654 678905 N_ambiguous 390773 1832 107695 UnstrandedReadsAssigned:16218776 PositiveStrandReadsAssigned:352638 NegativeStrandReadsAssigned:16429524 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671694 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671694-trimmed-pair1.fastq SRR12671694-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,300,491 reads, 16,669,035 reads pseudoaligned [quant] estimated average fragment length: 284.5 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52401 SRR12671694.ke.tsv 34699 SRR12671694.se.tsv 87100 total ==> SRR12671694.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.5 532 13.3515 Potri.005G024800.1.v4.1 1035 751.5 350 20.2737 Potri.004G059700.1.v4.1 961 677.721 8 0.513847 Potri.007G009000.2.v4.1 1416 1132.5 0 0 Potri.003G141000.2.v4.1 2943 2659.5 951 15.5659 Potri.016G087400.1.v4.1 270 71.2612 1030 629.185 Potri.015G069301.1.v4.1 564 296.835 0 0 Potri.010G195200.1.v4.1 1773 1489.5 68.8282 2.0115 Potri.012G127500.1.v4.1 977 693.612 629 39.4756 ==> SRR12671694.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 468 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 390 Potri.001G212900.v4.1 139 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671694 completed mapping pipeline successfully