Starting /dee2/code/volunteer_pipeline.sh SRR12671695 current disk space = 3049035497472 free memory = 1430020372 SRR12671695 SRAfilesize 968bf69b87bcdbc222d962b0a24f78ae SRR12671695.sra SRR12671695.sra file validated SRR12671695 is paired end SRR12671695 is conventional basespace SRR12671695 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671695_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.539 37.0 37.0 37.0 37.0 37.0 2 36.276 37.0 37.0 37.0 37.0 37.0 3 36.502 37.0 37.0 37.0 37.0 37.0 4 36.5805 37.0 37.0 37.0 37.0 37.0 5 36.4975 37.0 37.0 37.0 37.0 37.0 6 36.518 37.0 37.0 37.0 37.0 37.0 7 36.5315 37.0 37.0 37.0 37.0 37.0 8 36.455 37.0 37.0 37.0 37.0 37.0 9 36.5265 37.0 37.0 37.0 37.0 37.0 10-14 36.5576 37.0 37.0 37.0 37.0 37.0 15-19 36.523399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5302 37.0 37.0 37.0 37.0 37.0 25-29 36.5292 37.0 37.0 37.0 37.0 37.0 30-34 36.451100000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4343 37.0 37.0 37.0 37.0 37.0 40-44 36.4643 37.0 37.0 37.0 37.0 37.0 45-49 36.394 37.0 37.0 37.0 37.0 37.0 50-54 36.437200000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.357800000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.376400000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3304 37.0 37.0 37.0 37.0 37.0 70-74 36.305800000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.2959 37.0 37.0 37.0 37.0 37.0 80-84 36.309200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2268 37.0 37.0 37.0 37.0 37.0 90-94 36.1702 37.0 37.0 37.0 37.0 37.0 95-99 36.1691 37.0 37.0 37.0 37.0 37.0 100-104 36.170500000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.168600000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.1453 37.0 37.0 37.0 37.0 37.0 115-119 36.136700000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0427 37.0 37.0 37.0 37.0 37.0 125-129 35.9732 37.0 37.0 37.0 37.0 37.0 130-134 35.995400000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.9529 37.0 37.0 37.0 37.0 37.0 140-144 35.9493 37.0 37.0 37.0 37.0 37.0 145-149 35.81439999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.4135 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 3.0 26 1.0 27 11.0 28 16.0 29 20.0 30 21.0 31 29.0 32 49.0 33 84.0 34 121.0 35 293.0 36 2971.0 37 379.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.249999999999996 14.274999999999999 12.15 45.324999999999996 2 19.964929859719437 19.71442885771543 40.4559118236473 19.864729458917836 3 17.0 25.75 27.925 29.325000000000003 4 21.55 33.375 22.475 22.6 5 21.349999999999998 37.75 23.45 17.45 6 17.0 36.225 25.900000000000002 20.875 7 13.450000000000001 20.925 45.775 19.85 8 18.2 21.625 29.975 30.2 9 16.675 22.35 34.075 26.900000000000002 10-14 19.400000000000002 29.615000000000002 27.339999999999996 23.645 15-19 19.62 28.26 28.349999999999998 23.77 20-24 19.455 28.87 27.584999999999997 24.09 25-29 19.705000000000002 28.975 27.529999999999998 23.79 30-34 19.985 28.235 27.650000000000002 24.13 35-39 20.175 28.51 27.35 23.965 40-44 19.68 29.134999999999998 27.810000000000002 23.375 45-49 19.6 28.744999999999997 27.800000000000004 23.855 50-54 20.035 28.125 27.875 23.965 55-59 20.4 28.634999999999998 27.305 23.66 60-64 20.275000000000002 28.48 27.365000000000002 23.880000000000003 65-69 20.169999999999998 28.705000000000002 27.279999999999998 23.845 70-74 20.43 27.83 27.505000000000003 24.235 75-79 20.51 28.215 27.88 23.395 80-84 20.105 28.655 27.195000000000004 24.044999999999998 85-89 20.525 28.33 27.66 23.485 90-94 20.26 28.044999999999998 27.805000000000003 23.89 95-99 19.575 28.625 27.48 24.32 100-104 19.715 28.244999999999997 27.950000000000003 24.09 105-109 20.4 28.315 27.115000000000002 24.169999999999998 110-114 21.055 28.299999999999997 27.12 23.525 115-119 20.275000000000002 28.660000000000004 27.13 23.935000000000002 120-124 20.605 28.38 27.495000000000005 23.52 125-129 20.57 28.655 27.084999999999997 23.69 130-134 20.47 28.34 27.47 23.72 135-139 21.025 28.000000000000004 27.265 23.71 140-144 21.25 27.815 26.915 24.02 145-149 20.549999999999997 27.860000000000003 27.275 24.315 150-151 20.5 27.9125 27.462500000000002 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 1.0 24 2.0 25 4.0 26 6.5 27 13.5 28 14.0 29 16.0 30 21.0 31 28.5 32 37.5 33 48.0 34 65.0 35 84.0 36 93.0 37 95.0 38 126.0 39 152.0 40 170.5 41 208.0 42 235.5 43 250.5 44 268.5 45 284.5 46 269.5 47 239.5 48 235.0 49 213.5 50 167.5 51 138.0 52 120.0 53 93.0 54 74.5 55 66.0 56 48.0 57 34.0 58 23.5 59 16.0 60 12.5 61 7.5 62 4.0 63 3.0 64 1.5 65 1.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.24809661328433 90.7 2 4.541874507744815 8.649999999999999 3 0.15752165922814387 0.44999999999999996 4 0.05250721974271463 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.025 0.0 80-81 0.0875 0.0 0.0 0.025 0.0 82-83 0.1 0.0 0.0 0.025 0.0 84-85 0.125 0.0 0.0 0.025 0.0 86-87 0.1375 0.0 0.0 0.025 0.0 88-89 0.16249999999999998 0.0 0.0 0.025 0.0 90-91 0.1875 0.0 0.0 0.025 0.0 92-93 0.225 0.0 0.0 0.025 0.0 94-95 0.2875 0.0 0.0 0.025 0.0 96-97 0.325 0.0 0.0 0.025 0.0 98-99 0.325 0.0 0.0 0.025 0.0 100-101 0.375 0.0 0.0 0.025 0.0 102-103 0.44999999999999996 0.0 0.0 0.025 0.0 104-105 0.55 0.0 0.0 0.025 0.0 106-107 0.6125 0.0 0.0 0.025 0.0 108-109 0.6625000000000001 0.0 0.0 0.025 0.0 110-111 0.875 0.0 0.0 0.025 0.0 112-113 0.9875 0.0 0.0 0.025 0.0 114-115 1.075 0.0 0.0 0.025 0.0 116-117 1.2625000000000002 0.0 0.0 0.025 0.0 118-119 1.425 0.0 0.0 0.025 0.0 120-121 1.6125 0.0 0.0 0.025 0.0 122-123 1.8875000000000002 0.0 0.0 0.025 0.0 124-125 2.05 0.0 0.0 0.025 0.0 126-127 2.2125 0.0 0.0 0.025 0.0 128-129 2.375 0.0 0.0 0.025 0.0 130-131 2.475 0.0 0.0 0.025 0.0 132-133 2.6375 0.0 0.0 0.025 0.0 134-135 2.9125 0.0 0.0 0.025 0.0 136-137 3.1625 0.0 0.0 0.025 0.0 138-139 3.425 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTTT 10 0.006830828 145.0 1 TTTCCAA 10 0.006830828 145.0 5 >>END_MODULE SRR12671695 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671695_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9655 37.0 37.0 37.0 37.0 37.0 2 35.939 37.0 37.0 37.0 37.0 37.0 3 36.0705 37.0 37.0 37.0 37.0 37.0 4 36.08 37.0 37.0 37.0 37.0 37.0 5 36.171 37.0 37.0 37.0 37.0 37.0 6 36.0355 37.0 37.0 37.0 37.0 37.0 7 36.113 37.0 37.0 37.0 37.0 37.0 8 36.2275 37.0 37.0 37.0 37.0 37.0 9 36.2565 37.0 37.0 37.0 37.0 37.0 10-14 36.2071 37.0 37.0 37.0 37.0 37.0 15-19 36.131299999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.1183 37.0 37.0 37.0 37.0 37.0 25-29 36.109500000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.110400000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.0779 37.0 37.0 37.0 37.0 37.0 40-44 36.05309999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.0253 37.0 37.0 37.0 37.0 37.0 50-54 35.9891 37.0 37.0 37.0 37.0 37.0 55-59 35.975699999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.891000000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.91029999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.8561 37.0 37.0 37.0 37.0 37.0 75-79 35.7506 37.0 37.0 37.0 37.0 37.0 80-84 35.8786 37.0 37.0 37.0 37.0 37.0 85-89 35.808800000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.682100000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.7635 37.0 37.0 37.0 37.0 37.0 100-104 35.7692 37.0 37.0 37.0 37.0 37.0 105-109 35.68 37.0 37.0 37.0 37.0 37.0 110-114 35.547700000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.6095 37.0 37.0 37.0 37.0 37.0 120-124 35.5996 37.0 37.0 37.0 37.0 37.0 125-129 35.4524 37.0 37.0 37.0 37.0 37.0 130-134 35.509 37.0 37.0 37.0 37.0 37.0 135-139 35.3783 37.0 37.0 37.0 37.0 37.0 140-144 35.2405 37.0 37.0 37.0 29.8 37.0 145-149 35.2752 37.0 37.0 37.0 32.2 37.0 150-151 34.9765 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 2.0 19 0.0 20 1.0 21 3.0 22 4.0 23 0.0 24 3.0 25 11.0 26 7.0 27 13.0 28 18.0 29 30.0 30 29.0 31 56.0 32 75.0 33 114.0 34 242.0 35 645.0 36 2557.0 37 188.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.8 16.575 15.55 37.075 2 23.875 21.925 37.65 16.55 3 19.825 26.424999999999997 32.574999999999996 21.175 4 23.7 33.425 22.05 20.825 5 23.25 37.6 21.65 17.5 6 17.625 38.025 24.525 19.825 7 16.625 16.975 44.45 21.95 8 19.950000000000003 21.7 28.95 29.4 9 20.75 23.200000000000003 30.475 25.575 10-14 22.2 27.495000000000005 27.500000000000004 22.805 15-19 22.23 28.175 27.800000000000004 21.795 20-24 21.709999999999997 28.865000000000002 27.775 21.65 25-29 21.9 28.415000000000003 27.99 21.695 30-34 22.15 28.64 27.98 21.23 35-39 22.175 28.375 28.225 21.224999999999998 40-44 22.06 27.845 28.52 21.575 45-49 22.48 27.765 28.175 21.58 50-54 22.05 27.515 28.88 21.555 55-59 22.295 27.155 28.939999999999998 21.61 60-64 22.55 27.544999999999998 28.15 21.755 65-69 22.6 27.175 28.12 22.105 70-74 23.0 27.38 27.925 21.695 75-79 22.605 27.950000000000003 27.62 21.825 80-84 22.625 28.09 27.27 22.015 85-89 23.630000000000003 27.529999999999998 27.189999999999998 21.65 90-94 23.14 27.37 28.199999999999996 21.29 95-99 23.22 28.044999999999998 27.845 20.89 100-104 23.080000000000002 27.605 27.665 21.65 105-109 23.345 27.785 27.465 21.404999999999998 110-114 22.955000000000002 27.939999999999998 28.08 21.025 115-119 23.59 27.889999999999997 27.22 21.3 120-124 24.12 27.384999999999998 27.250000000000004 21.245 125-129 24.115000000000002 27.435 27.384999999999998 21.065 130-134 23.830000000000002 26.825 28.09 21.255 135-139 24.315 26.745 27.83 21.11 140-144 24.610000000000003 27.505000000000003 27.355 20.53 145-149 24.32 27.92 27.134999999999998 20.625 150-151 24.3875 28.1375 26.875 20.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 2.5 23 2.5 24 1.5 25 3.0 26 3.0 27 3.5 28 8.0 29 14.0 30 17.5 31 23.5 32 35.5 33 37.5 34 45.0 35 73.0 36 87.0 37 100.0 38 129.5 39 157.5 40 188.5 41 217.5 42 245.5 43 249.0 44 264.0 45 287.0 46 269.0 47 255.5 48 232.5 49 195.5 50 168.0 51 140.0 52 112.0 53 94.0 54 86.0 55 64.0 56 47.0 57 35.5 58 24.5 59 26.0 60 19.0 61 10.5 62 9.0 63 6.0 64 2.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.93537325243999 89.97500000000001 2 4.774465840147718 9.049999999999999 3 0.2374043787918755 0.675 4 0.026378264310208392 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026378264310208392 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.9624999999999999 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.2374999999999998 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.8125 0.0 0.0 0.0 0.0 124-125 1.975 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.325 0.0 0.0 0.0 0.0 130-131 2.425 0.0 0.0 0.0 0.0 132-133 2.5875 0.0 0.0 0.0 0.0 134-135 2.8625 0.0 0.0 0.0 0.0 136-137 3.1125 0.0 0.0 0.0 0.0 138-139 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATGTC 10 0.006830828 145.0 4 >>END_MODULE Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167610 spots for SRR12671695.sra Written 1167610 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra Read 1167609 spots for SRR12671695.sra Written 1167609 spots for SRR12671695.sra SRR ids: ['SRR12671695.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_odvc1pcw SRR12671695.sra spots: 23352181 blocks: [[1, 1167609], [1167610, 2335218], [2335219, 3502827], [3502828, 4670436], [4670437, 5838045], [5838046, 7005654], [7005655, 8173263], [8173264, 9340872], [9340873, 10508481], [10508482, 11676090], [11676091, 12843699], [12843700, 14011308], [14011309, 15178917], [15178918, 16346526], [16346527, 17514135], [17514136, 18681744], [18681745, 19849353], [19849354, 21016962], [21016963, 22184571], [22184572, 23352181]] SRR12671695 file size 7914392 SRR12671695 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671695 SRR12671695_1.fastq SRR12671695_2.fastq Input file: SRR12671695_1.fastq Paired file: SRR12671695_2.fastq trimmed: SRR12671695-trimmed-pair1.fastq, SRR12671695-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:03:08 2025 >> started Wed Feb 12 04:03:34 2025 >> done (26.298s) 23352181 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 7505 ( 0.03%) empty read pairs filtered out after trimming by size control 23344646 (99.97%) read pairs available; of these: 1395062 ( 5.98%) trimmed read pairs available after processing 21949584 (94.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 6 0.00% 20 4 0.00% 21 4 0.00% 22 3 0.00% 23 4 0.00% 24 3 0.00% 25 7 0.00% 26 7 0.00% 27 7 0.00% 28 8 0.00% 29 6 0.00% 30 14 0.00% 31 9 0.00% 32 14 0.00% 33 12 0.00% 34 23 0.00% 35 26 0.00% 36 20 0.00% 37 22 0.00% 38 25 0.00% 39 31 0.00% 40 48 0.00% 41 41 0.00% 42 56 0.00% 43 31 0.00% 44 38 0.00% 45 46 0.00% 46 60 0.00% 47 64 0.00% 48 86 0.00% 49 91 0.00% 50 85 0.00% 51 120 0.00% 52 107 0.00% 53 94 0.00% 54 106 0.00% 55 108 0.00% 56 137 0.00% 57 147 0.00% 58 155 0.00% 59 201 0.00% 60 227 0.00% 61 255 0.00% 62 268 0.00% 63 261 0.00% 64 321 0.00% 65 362 0.00% 66 381 0.00% 67 418 0.00% 68 444 0.00% 69 490 0.00% 70 573 0.00% 71 717 0.00% 72 758 0.00% 73 908 0.00% 74 1020 0.00% 75 1023 0.00% 76 1121 0.00% 77 1257 0.01% 78 1477 0.01% 79 1572 0.01% 80 1740 0.01% 81 1970 0.01% 82 2233 0.01% 83 2331 0.01% 84 2803 0.01% 85 2987 0.01% 86 3251 0.01% 87 3445 0.01% 88 3768 0.02% 89 4122 0.02% 90 4393 0.02% 91 4794 0.02% 92 5242 0.02% 93 5772 0.02% 94 6135 0.03% 95 6645 0.03% 96 7159 0.03% 97 7542 0.03% 98 7942 0.03% 99 8433 0.04% 100 9052 0.04% 101 9539 0.04% 102 9950 0.04% 103 10546 0.05% 104 11136 0.05% 105 11666 0.05% 106 12538 0.05% 107 12813 0.05% 108 13270 0.06% 109 14089 0.06% 110 14465 0.06% 111 15303 0.07% 112 15996 0.07% 113 16327 0.07% 114 17173 0.07% 115 17931 0.08% 116 18407 0.08% 117 19260 0.08% 118 20151 0.09% 119 20612 0.09% 120 20957 0.09% 121 21971 0.09% 122 22625 0.10% 123 23695 0.10% 124 24100 0.10% 125 24355 0.10% 126 25423 0.11% 127 25978 0.11% 128 26762 0.11% 129 27437 0.12% 130 28341 0.12% 131 28619 0.12% 132 29521 0.13% 133 31066 0.13% 134 31209 0.13% 135 31781 0.14% 136 32669 0.14% 137 33179 0.14% 138 33861 0.15% 139 35371 0.15% 140 35236 0.15% 141 35933 0.15% 142 37397 0.16% 143 38343 0.16% 144 39568 0.17% 145 40074 0.17% 146 41106 0.18% 147 41459 0.18% 148 42276 0.18% 149 42369 0.18% 150 43521 0.19% 151 21949584 94.02% 23344646 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=27 prefix-density=0.66 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=185.75 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=13.5 sequence=TCATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=28 prefix-density=0.87 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=42.22 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.4 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671695 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:04:16 Started mapping on | Feb 12 04:04:16 Finished on | Feb 12 04:06:29 Mapping speed, Million of reads per hour | 631.89 Number of input reads | 23344646 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22167139 Uniquely mapped reads % | 94.96% Average mapped length | 297.96 Number of splices: Total | 22336302 Number of splices: Annotated (sjdb) | 21931381 Number of splices: GT/AG | 21892181 Number of splices: GC/AG | 373821 Number of splices: AT/AC | 12271 Number of splices: Non-canonical | 58029 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 546727 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 62836 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.36% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 630780 630780 630780 N_multimapping 546727 546727 546727 N_noFeature 761496 21837893 873067 N_ambiguous 363361 1250 145238 UnstrandedReadsAssigned:21042282 PositiveStrandReadsAssigned:327996 NegativeStrandReadsAssigned:21148834 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671695 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671695-trimmed-pair1.fastq SRR12671695-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,344,646 reads, 21,118,088 reads pseudoaligned [quant] estimated average fragment length: 299.878 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR12671695.ke.tsv 34699 SRR12671695.se.tsv 87100 total ==> SRR12671695.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1719.12 656 17.5375 Potri.005G024800.1.v4.1 1035 736.122 309 19.2921 Potri.004G059700.1.v4.1 961 662.597 7 0.485534 Potri.007G009000.2.v4.1 1416 1117.12 0 0 Potri.003G141000.2.v4.1 2943 2644.12 1125.42 19.5616 Potri.016G087400.1.v4.1 270 76.1422 608 366.986 Potri.015G069301.1.v4.1 564 292.314 0 0 Potri.010G195200.1.v4.1 1773 1474.12 43 1.34062 Potri.012G127500.1.v4.1 977 678.371 111 7.52015 ==> SRR12671695.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 586 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 5 SRR12671695 completed mapping pipeline successfully