Starting /dee2/code/volunteer_pipeline.sh SRR12671696 current disk space = 3049201590272 free memory = 1579377160 SRR12671696 SRAfilesize 6200899ec6a5318268fe9adcfd3317c8 SRR12671696.sra SRR12671696.sra file validated SRR12671696 is paired end SRR12671696 is conventional basespace SRR12671696 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671696_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5675 37.0 37.0 37.0 37.0 37.0 2 36.4125 37.0 37.0 37.0 37.0 37.0 3 36.578 37.0 37.0 37.0 37.0 37.0 4 36.6085 37.0 37.0 37.0 37.0 37.0 5 36.5315 37.0 37.0 37.0 37.0 37.0 6 36.598 37.0 37.0 37.0 37.0 37.0 7 36.5135 37.0 37.0 37.0 37.0 37.0 8 36.4805 37.0 37.0 37.0 37.0 37.0 9 36.504 37.0 37.0 37.0 37.0 37.0 10-14 36.5694 37.0 37.0 37.0 37.0 37.0 15-19 36.5575 37.0 37.0 37.0 37.0 37.0 20-24 36.518600000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.491 37.0 37.0 37.0 37.0 37.0 30-34 36.434200000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4413 37.0 37.0 37.0 37.0 37.0 40-44 36.4586 37.0 37.0 37.0 37.0 37.0 45-49 36.417 37.0 37.0 37.0 37.0 37.0 50-54 36.4476 37.0 37.0 37.0 37.0 37.0 55-59 36.4206 37.0 37.0 37.0 37.0 37.0 60-64 36.38420000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.3625 37.0 37.0 37.0 37.0 37.0 70-74 36.340999999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.3546 37.0 37.0 37.0 37.0 37.0 80-84 36.324200000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.316700000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.301700000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.214299999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.2505 37.0 37.0 37.0 37.0 37.0 105-109 36.2312 37.0 37.0 37.0 37.0 37.0 110-114 36.1443 37.0 37.0 37.0 37.0 37.0 115-119 36.1611 37.0 37.0 37.0 37.0 37.0 120-124 36.1254 37.0 37.0 37.0 37.0 37.0 125-129 36.103 37.0 37.0 37.0 37.0 37.0 130-134 36.0533 37.0 37.0 37.0 37.0 37.0 135-139 36.0612 37.0 37.0 37.0 37.0 37.0 140-144 36.0377 37.0 37.0 37.0 37.0 37.0 145-149 36.0192 37.0 37.0 37.0 37.0 37.0 150-151 35.62525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 2.0 27 9.0 28 12.0 29 25.0 30 26.0 31 35.0 32 48.0 33 56.0 34 91.0 35 253.0 36 2976.0 37 463.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.3 13.600000000000001 14.924999999999999 40.175 2 19.949874686716793 17.26817042606516 36.61654135338346 26.165413533834585 3 18.8 20.8 26.424999999999997 33.975 4 23.025000000000002 28.449999999999996 21.45 27.075 5 21.575 31.2 25.05 22.175 6 20.724999999999998 32.6 26.55 20.125 7 14.75 25.874999999999996 41.425 17.95 8 17.424999999999997 26.075 30.5 26.0 9 18.775 24.375 32.35 24.5 10-14 19.89 30.12 26.415 23.575 15-19 19.564999999999998 28.754999999999995 27.339999999999996 24.34 20-24 19.79 28.505000000000003 28.294999999999998 23.41 25-29 20.57 28.499999999999996 26.924999999999997 24.005000000000003 30-34 20.275000000000002 28.410000000000004 27.365000000000002 23.95 35-39 19.96 29.13 26.805 24.104999999999997 40-44 20.05 28.965000000000003 27.189999999999998 23.794999999999998 45-49 20.495 28.17 27.205000000000002 24.13 50-54 20.685000000000002 27.689999999999998 27.41 24.215 55-59 20.64 27.894999999999996 27.339999999999996 24.125 60-64 20.385 27.68 27.255000000000003 24.68 65-69 20.424999999999997 28.04 27.18 24.355 70-74 20.91 27.405 27.46 24.224999999999998 75-79 20.73 28.055000000000003 26.650000000000002 24.565 80-84 20.669999999999998 28.285 27.21 23.835 85-89 21.44 27.955000000000002 26.805 23.799999999999997 90-94 21.255 27.495000000000005 26.985 24.265 95-99 21.09 26.86 27.79 24.26 100-104 21.490000000000002 27.79 26.884999999999998 23.835 105-109 20.87 27.389999999999997 27.375 24.365000000000002 110-114 21.675 27.575 27.084999999999997 23.665 115-119 21.54 27.22 27.250000000000004 23.990000000000002 120-124 21.990000000000002 27.245 26.779999999999998 23.985 125-129 20.84 27.939999999999998 27.1 24.12 130-134 21.565 26.745 27.089999999999996 24.6 135-139 22.12 27.250000000000004 26.58 24.05 140-144 21.709999999999997 26.855 26.779999999999998 24.654999999999998 145-149 21.75 27.705000000000002 26.46 24.085 150-151 20.8625 26.4625 27.900000000000002 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 2.5 24 3.0 25 3.5 26 6.5 27 10.5 28 14.0 29 15.5 30 20.0 31 27.0 32 33.0 33 39.5 34 57.5 35 80.5 36 91.0 37 98.5 38 112.0 39 132.5 40 166.0 41 191.0 42 198.5 43 213.0 44 229.5 45 247.0 46 250.0 47 250.5 48 239.5 49 219.0 50 204.0 51 164.5 52 129.0 53 114.0 54 93.5 55 75.5 56 63.5 57 52.0 58 43.5 59 29.5 60 19.0 61 12.0 62 9.0 63 6.0 64 4.5 65 6.5 66 6.0 67 4.0 68 2.0 69 2.5 70 2.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.95088676671213 84.25 2 7.094133697135062 13.0 3 0.8458390177353342 2.325 4 0.08185538881309685 0.3 5 0.027285129604365622 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.8375 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.2625 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.6375 0.0 0.0 0.0 0.0 124-125 1.8 0.0 0.0 0.0 0.0 126-127 2.0625 0.0 0.0 0.0 0.0 128-129 2.2125 0.0 0.0 0.0 0.0 130-131 2.55 0.0 0.0 0.0 0.0 132-133 2.8875 0.0 0.0 0.0 0.0 134-135 3.2125 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138-139 3.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGATC 10 0.006830828 145.0 6 >>END_MODULE SRR12671696 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671696_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.402 37.0 37.0 37.0 37.0 37.0 2 36.3035 37.0 37.0 37.0 37.0 37.0 3 36.366 37.0 37.0 37.0 37.0 37.0 4 36.344 37.0 37.0 37.0 37.0 37.0 5 36.3175 37.0 37.0 37.0 37.0 37.0 6 36.3625 37.0 37.0 37.0 37.0 37.0 7 36.3465 37.0 37.0 37.0 37.0 37.0 8 36.272 37.0 37.0 37.0 37.0 37.0 9 36.3265 37.0 37.0 37.0 37.0 37.0 10-14 36.3144 37.0 37.0 37.0 37.0 37.0 15-19 36.2362 37.0 37.0 37.0 37.0 37.0 20-24 36.2477 37.0 37.0 37.0 37.0 37.0 25-29 36.211400000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.1703 37.0 37.0 37.0 37.0 37.0 35-39 36.1463 37.0 37.0 37.0 37.0 37.0 40-44 36.1485 37.0 37.0 37.0 37.0 37.0 45-49 36.11559999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.095800000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.0857 37.0 37.0 37.0 37.0 37.0 60-64 36.0278 37.0 37.0 37.0 37.0 37.0 65-69 36.030699999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.0095 37.0 37.0 37.0 37.0 37.0 75-79 35.9605 37.0 37.0 37.0 37.0 37.0 80-84 35.969100000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.9422 37.0 37.0 37.0 37.0 37.0 90-94 35.920100000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.9507 37.0 37.0 37.0 37.0 37.0 100-104 35.928799999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.8762 37.0 37.0 37.0 37.0 37.0 110-114 35.898900000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.85039999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.7981 37.0 37.0 37.0 37.0 37.0 125-129 35.751 37.0 37.0 37.0 37.0 37.0 130-134 35.7596 37.0 37.0 37.0 37.0 37.0 135-139 35.755399999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.4988 37.0 37.0 37.0 37.0 37.0 145-149 35.604400000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.30175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 6.0 13 3.0 14 6.0 15 3.0 16 2.0 17 4.0 18 3.0 19 2.0 20 2.0 21 5.0 22 8.0 23 7.0 24 2.0 25 7.0 26 9.0 27 10.0 28 13.0 29 13.0 30 13.0 31 26.0 32 44.0 33 60.0 34 119.0 35 377.0 36 2941.0 37 315.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.35 16.725 18.125 29.799999999999997 2 26.174999999999997 24.3 33.15 16.375 3 23.3 28.1 27.474999999999998 21.125 4 25.124999999999996 34.599999999999994 20.925 19.35 5 26.875 35.675000000000004 21.075 16.375 6 21.975 35.6 23.175 19.25 7 20.3 18.425 40.300000000000004 20.974999999999998 8 22.975 24.85 27.200000000000003 24.975 9 23.875 24.349999999999998 28.175 23.599999999999998 10-14 23.9 29.2 24.89 22.009999999999998 15-19 24.465 27.51 26.634999999999998 21.39 20-24 23.474999999999998 27.92 27.200000000000003 21.404999999999998 25-29 23.830000000000002 28.02 26.395000000000003 21.755 30-34 23.415 28.22 26.705000000000002 21.66 35-39 23.87 28.29 26.395000000000003 21.445 40-44 23.595 28.205000000000002 26.290000000000003 21.91 45-49 23.34 28.305000000000003 26.5 21.855 50-54 23.68 27.474999999999998 27.195000000000004 21.65 55-59 23.695 28.025 26.529999999999998 21.75 60-64 24.055 27.83 26.015 22.1 65-69 23.98 26.905 27.279999999999998 21.834999999999997 70-74 24.42 28.1 25.935000000000002 21.545 75-79 24.060000000000002 27.905 26.11 21.925 80-84 23.895 27.339999999999996 27.029999999999998 21.735 85-89 24.38 27.284999999999997 26.41 21.925 90-94 23.794999999999998 27.715 26.479999999999997 22.009999999999998 95-99 24.060000000000002 28.21 26.875 20.855 100-104 23.915 27.58 26.950000000000003 21.555 105-109 24.195 27.625 26.784999999999997 21.395 110-114 24.055 27.939999999999998 25.94 22.065 115-119 24.67 27.38 26.395000000000003 21.555 120-124 24.05 28.215 26.13 21.605 125-129 24.315 27.765 26.939999999999998 20.979999999999997 130-134 24.905 27.775 26.650000000000002 20.669999999999998 135-139 24.44 27.905 26.724999999999998 20.93 140-144 25.174999999999997 28.499999999999996 26.009999999999998 20.315 145-149 25.605 27.735 26.424999999999997 20.235 150-151 25.1875 27.025 26.5375 21.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 1.0 12 1.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 1.5 19 2.0 20 0.5 21 0.5 22 1.0 23 1.0 24 4.0 25 5.0 26 2.0 27 4.0 28 5.0 29 4.0 30 10.5 31 12.5 32 12.0 33 17.5 34 28.5 35 46.5 36 68.0 37 76.5 38 88.5 39 124.5 40 166.0 41 198.0 42 225.5 43 237.5 44 252.5 45 257.5 46 263.0 47 276.0 48 247.0 49 249.5 50 222.0 51 159.0 52 134.0 53 107.5 54 104.5 55 103.5 56 75.5 57 49.0 58 35.5 59 27.5 60 23.0 61 17.5 62 11.0 63 7.0 64 3.5 65 1.0 66 2.0 67 2.5 68 0.5 69 1.0 70 1.5 71 1.0 72 1.5 73 1.5 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 1.0 89 1.0 90 1.0 91 1.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.55 #Duplication Level Percentage of deduplicated Percentage of total 1 92.02621518296013 84.25 2 6.990715456034953 12.8 3 0.7919169852539596 2.175 4 0.1365374112506827 0.5 5 0.027307482250136534 0.125 6 0.027307482250136534 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.8375 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.2625 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.6375 0.0 0.0 0.0 0.0 124-125 1.825 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.2625 0.0 0.0 0.0 0.0 130-131 2.6 0.0 0.0 0.0 0.0 132-133 2.9375 0.0 0.0 0.0 0.0 134-135 3.2625 0.0 0.0 0.0 0.0 136-137 3.5375 0.0 0.0 0.0 0.0 138-139 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863116 spots for SRR12671696.sra Written 863116 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra Read 863109 spots for SRR12671696.sra Written 863109 spots for SRR12671696.sra SRR ids: ['SRR12671696.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3luevu0b SRR12671696.sra spots: 17262187 blocks: [[1, 863109], [863110, 1726218], [1726219, 2589327], [2589328, 3452436], [3452437, 4315545], [4315546, 5178654], [5178655, 6041763], [6041764, 6904872], [6904873, 7767981], [7767982, 8631090], [8631091, 9494199], [9494200, 10357308], [10357309, 11220417], [11220418, 12083526], [12083527, 12946635], [12946636, 13809744], [13809745, 14672853], [14672854, 15535962], [15535963, 16399071], [16399072, 17262187]] SRR12671696 file size 5844745 SRR12671696 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671696 SRR12671696_1.fastq SRR12671696_2.fastq Input file: SRR12671696_1.fastq Paired file: SRR12671696_2.fastq trimmed: SRR12671696-trimmed-pair1.fastq, SRR12671696-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:27:41 2025 >> started Wed Feb 12 04:28:02 2025 >> done (20.666s) 17262187 read pairs processed; of these: 12 ( 0.00%) short read pairs filtered out after trimming by size control 25804 ( 0.15%) empty read pairs filtered out after trimming by size control 17236371 (99.85%) read pairs available; of these: 1139906 ( 6.61%) trimmed read pairs available after processing 16096465 (93.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 1 0.00% 23 3 0.00% 24 5 0.00% 25 3 0.00% 26 2 0.00% 27 8 0.00% 28 3 0.00% 29 5 0.00% 30 13 0.00% 31 7 0.00% 32 5 0.00% 33 2 0.00% 34 12 0.00% 35 10 0.00% 36 9 0.00% 37 9 0.00% 38 13 0.00% 39 10 0.00% 40 19 0.00% 41 7 0.00% 42 12 0.00% 43 16 0.00% 44 23 0.00% 45 25 0.00% 46 30 0.00% 47 29 0.00% 48 29 0.00% 49 38 0.00% 50 40 0.00% 51 49 0.00% 52 41 0.00% 53 49 0.00% 54 37 0.00% 55 80 0.00% 56 79 0.00% 57 77 0.00% 58 73 0.00% 59 105 0.00% 60 122 0.00% 61 100 0.00% 62 114 0.00% 63 133 0.00% 64 153 0.00% 65 169 0.00% 66 185 0.00% 67 195 0.00% 68 195 0.00% 69 261 0.00% 70 280 0.00% 71 349 0.00% 72 370 0.00% 73 406 0.00% 74 459 0.00% 75 528 0.00% 76 571 0.00% 77 626 0.00% 78 700 0.00% 79 841 0.00% 80 920 0.01% 81 985 0.01% 82 1213 0.01% 83 1268 0.01% 84 1518 0.01% 85 1706 0.01% 86 1680 0.01% 87 1942 0.01% 88 2018 0.01% 89 2222 0.01% 90 2579 0.01% 91 2790 0.02% 92 3081 0.02% 93 3333 0.02% 94 3774 0.02% 95 4119 0.02% 96 4275 0.02% 97 4604 0.03% 98 4832 0.03% 99 5264 0.03% 100 5731 0.03% 101 5913 0.03% 102 6363 0.04% 103 7034 0.04% 104 7474 0.04% 105 7691 0.04% 106 8264 0.05% 107 8825 0.05% 108 9142 0.05% 109 9490 0.06% 110 10061 0.06% 111 10486 0.06% 112 11216 0.07% 113 11697 0.07% 114 12370 0.07% 115 13056 0.08% 116 13914 0.08% 117 14330 0.08% 118 14964 0.09% 119 15040 0.09% 120 15686 0.09% 121 16775 0.10% 122 17167 0.10% 123 18290 0.11% 124 19015 0.11% 125 19918 0.12% 126 20981 0.12% 127 20936 0.12% 128 22132 0.13% 129 22243 0.13% 130 23012 0.13% 131 23859 0.14% 132 24792 0.14% 133 26245 0.15% 134 26785 0.16% 135 27895 0.16% 136 28913 0.17% 137 29942 0.17% 138 30229 0.18% 139 31196 0.18% 140 31256 0.18% 141 32417 0.19% 142 33786 0.20% 143 35390 0.21% 144 36826 0.21% 145 37742 0.22% 146 39064 0.23% 147 39603 0.23% 148 40618 0.24% 149 40690 0.24% 150 41579 0.24% 151 16096465 93.39% 17236371 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=20 prefix-density=0.65 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.16 sequence-density-rank=24 fanout-score=16.09 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=6.9 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.87 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=25.20 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC SRR12671696 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:29:00 Started mapping on | Feb 12 04:29:01 Finished on | Feb 12 04:30:57 Mapping speed, Million of reads per hour | 534.92 Number of input reads | 17236371 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15997907 Uniquely mapped reads % | 92.81% Average mapped length | 298.19 Number of splices: Total | 15934968 Number of splices: Annotated (sjdb) | 15660149 Number of splices: GT/AG | 15601887 Number of splices: GC/AG | 289172 Number of splices: AT/AC | 8917 Number of splices: Non-canonical | 34992 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442688 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 221785 % of reads mapped to too many loci | 1.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 795776 795776 795776 N_multimapping 442688 442688 442688 N_noFeature 500511 15713494 586841 N_ambiguous 300864 1292 101975 UnstrandedReadsAssigned:15196532 PositiveStrandReadsAssigned:283121 NegativeStrandReadsAssigned:15309091 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671696 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671696-trimmed-pair1.fastq SRR12671696-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,236,371 reads, 15,516,306 reads pseudoaligned [quant] estimated average fragment length: 257.988 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR12671696.ke.tsv 34699 SRR12671696.se.tsv 87100 total ==> SRR12671696.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.01 507 13.8606 Potri.005G024800.1.v4.1 1035 778.012 206 12.7473 Potri.004G059700.1.v4.1 961 704.053 7 0.478661 Potri.007G009000.2.v4.1 1416 1159.01 0 0 Potri.003G141000.2.v4.1 2943 2686.01 934 16.7407 Potri.016G087400.1.v4.1 270 72.8333 815.042 538.748 Potri.015G069301.1.v4.1 564 313.041 0 0 Potri.010G195200.1.v4.1 1773 1516.01 117 3.71551 Potri.012G127500.1.v4.1 977 720.03 188 12.5702 ==> SRR12671696.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 262 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 406 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671696 completed mapping pipeline successfully