Starting /dee2/code/volunteer_pipeline.sh SRR12671697 current disk space = 2824978997248 free memory = 1567926396 SRR12671697 SRAfilesize e959f2df2178aaedb79a5a790a53029c SRR12671697.sra SRR12671697.sra file validated SRR12671697 is paired end SRR12671697 is conventional basespace SRR12671697 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671697_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4225 37.0 37.0 37.0 37.0 37.0 2 36.23275 37.0 37.0 37.0 37.0 37.0 3 36.48 37.0 37.0 37.0 37.0 37.0 4 36.5215 37.0 37.0 37.0 37.0 37.0 5 36.533 37.0 37.0 37.0 37.0 37.0 6 36.508 37.0 37.0 37.0 37.0 37.0 7 36.4475 37.0 37.0 37.0 37.0 37.0 8 36.5105 37.0 37.0 37.0 37.0 37.0 9 36.555 37.0 37.0 37.0 37.0 37.0 10-14 36.5707 37.0 37.0 37.0 37.0 37.0 15-19 36.5424 37.0 37.0 37.0 37.0 37.0 20-24 36.5192 37.0 37.0 37.0 37.0 37.0 25-29 36.5186 37.0 37.0 37.0 37.0 37.0 30-34 36.44780000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4524 37.0 37.0 37.0 37.0 37.0 40-44 36.4812 37.0 37.0 37.0 37.0 37.0 45-49 36.4116 37.0 37.0 37.0 37.0 37.0 50-54 36.429100000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.4034 37.0 37.0 37.0 37.0 37.0 60-64 36.3849 37.0 37.0 37.0 37.0 37.0 65-69 36.3535 37.0 37.0 37.0 37.0 37.0 70-74 36.3087 37.0 37.0 37.0 37.0 37.0 75-79 36.319500000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.3173 37.0 37.0 37.0 37.0 37.0 85-89 36.2827 37.0 37.0 37.0 37.0 37.0 90-94 36.2393 37.0 37.0 37.0 37.0 37.0 95-99 36.1931 37.0 37.0 37.0 37.0 37.0 100-104 36.2562 37.0 37.0 37.0 37.0 37.0 105-109 36.1288 37.0 37.0 37.0 37.0 37.0 110-114 36.182900000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1486 37.0 37.0 37.0 37.0 37.0 120-124 36.132799999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.107800000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.0203 37.0 37.0 37.0 37.0 37.0 135-139 36.0125 37.0 37.0 37.0 37.0 37.0 140-144 35.9728 37.0 37.0 37.0 37.0 37.0 145-149 35.871900000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.383750000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 3.0 26 1.0 27 13.0 28 13.0 29 11.0 30 32.0 31 44.0 32 43.0 33 60.0 34 103.0 35 288.0 36 2986.0 37 403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.275 14.249999999999998 11.275 41.199999999999996 2 19.839478304489592 20.993227990970656 39.252570855279664 19.914722849260095 3 17.95 25.95 27.1 28.999999999999996 4 21.625 33.175 22.650000000000002 22.55 5 19.625 38.175 23.75 18.45 6 18.4 36.7 26.3 18.6 7 13.100000000000001 21.925 44.925 20.05 8 17.299999999999997 22.825 30.175 29.7 9 17.5 23.05 32.125 27.325 10-14 19.505 29.075 27.47 23.95 15-19 19.919999999999998 28.804999999999996 27.435 23.84 20-24 19.64 28.275 28.294999999999998 23.79 25-29 19.695 28.904999999999998 27.425 23.974999999999998 30-34 19.439999999999998 28.110000000000003 28.345 24.104999999999997 35-39 19.865 29.299999999999997 27.560000000000002 23.275000000000002 40-44 19.42 29.049999999999997 27.21 24.32 45-49 19.220000000000002 28.205000000000002 27.705000000000002 24.87 50-54 19.7 28.79 27.675 23.835 55-59 19.794999999999998 28.67 26.875 24.66 60-64 20.27 28.794999999999998 27.005000000000003 23.93 65-69 20.095 28.9 27.33 23.674999999999997 70-74 20.14 28.144999999999996 27.634999999999998 24.08 75-79 20.34 28.515 27.12 24.025 80-84 20.18 28.845 27.095000000000002 23.880000000000003 85-89 20.74 27.92 27.35 23.990000000000002 90-94 20.185 28.599999999999998 27.334999999999997 23.880000000000003 95-99 20.3 28.1 27.22 24.38 100-104 20.325 28.244999999999997 27.47 23.96 105-109 20.68 27.750000000000004 28.08 23.49 110-114 20.794999999999998 28.02 27.905 23.28 115-119 20.845 27.825 27.689999999999998 23.64 120-124 20.580000000000002 27.560000000000002 27.765 24.095 125-129 20.9 27.860000000000003 27.38 23.86 130-134 20.95 27.92 27.584999999999997 23.544999999999998 135-139 20.745 27.810000000000002 27.805000000000003 23.64 140-144 20.8 27.72 27.744999999999997 23.735 145-149 20.69 27.73 27.96 23.62 150-151 20.849999999999998 28.199999999999996 26.75 24.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 1.0 23 3.0 24 3.0 25 3.0 26 6.5 27 11.5 28 14.5 29 17.0 30 19.5 31 24.5 32 35.5 33 43.5 34 59.0 35 81.0 36 95.0 37 109.5 38 128.5 39 152.5 40 181.0 41 215.5 42 254.5 43 268.0 44 252.5 45 258.0 46 242.5 47 241.5 48 238.0 49 199.0 50 166.5 51 133.5 52 111.5 53 100.5 54 81.0 55 56.0 56 52.5 57 43.5 58 28.5 59 18.5 60 17.0 61 11.5 62 6.0 63 5.0 64 3.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.375 #Duplication Level Percentage of deduplicated Percentage of total 1 93.46720214190094 87.275 2 5.997322623828648 11.200000000000001 3 0.5087014725568942 1.425 4 0.02677376171352075 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.8374999999999999 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.2625000000000002 0.0 0.0 0.0 0.0 128-129 1.3875000000000002 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.6375 0.0 0.0 0.0 0.0 134-135 1.775 0.0 0.0 0.0 0.0 136-137 1.9375 0.0 0.0 0.0 0.0 138-139 2.0875000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGCTT 20 3.5877043E-4 108.75 9 >>END_MODULE SRR12671697 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671697_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1695 37.0 37.0 37.0 37.0 37.0 2 36.022 37.0 37.0 37.0 37.0 37.0 3 36.0565 37.0 37.0 37.0 37.0 37.0 4 36.0175 37.0 37.0 37.0 37.0 37.0 5 36.253 37.0 37.0 37.0 37.0 37.0 6 36.088 37.0 37.0 37.0 37.0 37.0 7 36.232 37.0 37.0 37.0 37.0 37.0 8 36.2415 37.0 37.0 37.0 37.0 37.0 9 36.2055 37.0 37.0 37.0 37.0 37.0 10-14 36.223200000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.1404 37.0 37.0 37.0 37.0 37.0 20-24 36.144499999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.1078 37.0 37.0 37.0 37.0 37.0 30-34 36.112700000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.980599999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.1097 37.0 37.0 37.0 37.0 37.0 45-49 36.0452 37.0 37.0 37.0 37.0 37.0 50-54 35.976600000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.94539999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.969300000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.8816 37.0 37.0 37.0 37.0 37.0 70-74 35.904900000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.8323 37.0 37.0 37.0 37.0 37.0 80-84 35.864599999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.754900000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.70869999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.7537 37.0 37.0 37.0 37.0 37.0 100-104 35.689099999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.6971 37.0 37.0 37.0 37.0 37.0 110-114 35.563300000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6149 37.0 37.0 37.0 37.0 37.0 120-124 35.632600000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.510299999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.5099 37.0 37.0 37.0 37.0 37.0 135-139 35.532 37.0 37.0 37.0 37.0 37.0 140-144 35.313900000000004 37.0 37.0 37.0 32.2 37.0 145-149 35.392199999999995 37.0 37.0 37.0 34.6 37.0 150-151 34.877750000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 0.0 14 3.0 15 0.0 16 1.0 17 2.0 18 0.0 19 4.0 20 1.0 21 2.0 22 3.0 23 4.0 24 6.0 25 10.0 26 9.0 27 12.0 28 15.0 29 22.0 30 35.0 31 36.0 32 65.0 33 118.0 34 200.0 35 557.0 36 2706.0 37 185.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.5 19.45 14.674999999999999 31.374999999999996 2 25.674999999999997 24.75 34.625 14.95 3 20.75 27.35 31.175000000000004 20.724999999999998 4 23.1 35.975 20.925 20.0 5 23.3 37.775 20.775 18.15 6 17.9 38.75 23.549999999999997 19.8 7 16.85 17.724999999999998 44.375 21.05 8 21.75 21.6 27.125 29.525000000000002 9 19.825 24.224999999999998 28.675 27.275 10-14 22.82 29.110000000000003 26.43 21.64 15-19 22.564999999999998 28.485 27.815 21.135 20-24 22.095000000000002 28.815 27.045 22.045 25-29 22.515 28.189999999999998 28.16 21.135 30-34 22.15 28.26 27.96 21.63 35-39 22.84 27.925 27.665 21.57 40-44 22.98 28.235 27.61 21.175 45-49 22.625 27.779999999999998 28.575 21.02 50-54 23.07 27.884999999999998 27.49 21.555 55-59 23.235 27.694999999999997 27.900000000000002 21.17 60-64 23.13 28.084999999999997 27.334999999999997 21.45 65-69 22.17 28.055000000000003 27.744999999999997 22.03 70-74 22.785 27.950000000000003 27.985 21.279999999999998 75-79 23.189999999999998 28.035 27.250000000000004 21.525 80-84 23.35 27.775 27.534999999999997 21.34 85-89 23.0 28.57 27.185 21.245 90-94 23.525 27.375 27.755000000000003 21.345 95-99 23.505000000000003 28.205000000000002 27.42 20.87 100-104 23.29 28.325 27.12 21.265 105-109 23.305 27.794999999999998 28.060000000000002 20.84 110-114 23.145 28.17 27.68 21.005 115-119 23.84 28.610000000000003 26.75 20.8 120-124 23.205000000000002 28.26 27.650000000000002 20.885 125-129 23.705000000000002 27.845 27.425 21.025 130-134 23.525 27.62 27.725 21.13 135-139 24.205 27.605 27.22 20.97 140-144 23.810000000000002 28.005000000000003 27.32 20.865000000000002 145-149 24.04 27.700000000000003 27.400000000000002 20.86 150-151 24.4125 28.449999999999996 27.250000000000004 19.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 1.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 2.0 23 5.0 24 4.5 25 2.5 26 4.0 27 7.5 28 7.5 29 9.5 30 14.5 31 16.5 32 26.5 33 40.0 34 56.0 35 70.0 36 82.0 37 109.0 38 140.5 39 167.0 40 189.5 41 223.5 42 239.0 43 253.5 44 276.5 45 260.0 46 235.5 47 231.5 48 229.5 49 200.5 50 174.5 51 142.5 52 102.5 53 94.5 54 85.5 55 68.5 56 54.5 57 40.5 58 33.0 59 24.0 60 16.5 61 15.0 62 13.0 63 9.0 64 3.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 1.0 77 0.5 78 0.5 79 0.5 80 1.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.125 #Duplication Level Percentage of deduplicated Percentage of total 1 93.63758389261744 87.2 2 5.6644295302013425 10.549999999999999 3 0.5369127516778524 1.5 4 0.10738255033557045 0.4 5 0.026845637583892613 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.026845637583892613 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 9 0.22499999999999998 No Hit AAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.8374999999999999 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.125 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.4 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.6375 0.0 0.0 0.0 0.0 134-135 1.775 0.0 0.0 0.0 0.0 136-137 1.9625 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTTGA 10 0.006830828 145.0 4 GTGCTGG 10 0.006830828 145.0 5 >>END_MODULE Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087402 spots for SRR12671697.sra Written 1087402 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra Read 1087393 spots for SRR12671697.sra Written 1087393 spots for SRR12671697.sra SRR ids: ['SRR12671697.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8fjecufr SRR12671697.sra spots: 21747869 blocks: [[1, 1087393], [1087394, 2174786], [2174787, 3262179], [3262180, 4349572], [4349573, 5436965], [5436966, 6524358], [6524359, 7611751], [7611752, 8699144], [8699145, 9786537], [9786538, 10873930], [10873931, 11961323], [11961324, 13048716], [13048717, 14136109], [14136110, 15223502], [15223503, 16310895], [16310896, 17398288], [17398289, 18485681], [18485682, 19573074], [19573075, 20660467], [20660468, 21747869]] SRR12671697 file size 7369176 SRR12671697 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671697 SRR12671697_1.fastq SRR12671697_2.fastq Input file: SRR12671697_1.fastq Paired file: SRR12671697_2.fastq trimmed: SRR12671697-trimmed-pair1.fastq, SRR12671697-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 11:34:50 2025 >> started Thu Apr 10 11:35:12 2025 >> done (22.775s) 21747869 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 1750 ( 0.01%) empty read pairs filtered out after trimming by size control 21746097 (99.99%) read pairs available; of these: 719430 ( 3.31%) trimmed read pairs available after processing 21026667 (96.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 0 0.00% 21 2 0.00% 22 3 0.00% 23 3 0.00% 24 4 0.00% 25 5 0.00% 26 4 0.00% 27 5 0.00% 28 6 0.00% 29 12 0.00% 30 8 0.00% 31 10 0.00% 32 10 0.00% 33 9 0.00% 34 14 0.00% 35 7 0.00% 36 10 0.00% 37 16 0.00% 38 18 0.00% 39 25 0.00% 40 18 0.00% 41 30 0.00% 42 30 0.00% 43 22 0.00% 44 28 0.00% 45 29 0.00% 46 42 0.00% 47 34 0.00% 48 36 0.00% 49 40 0.00% 50 55 0.00% 51 48 0.00% 52 74 0.00% 53 61 0.00% 54 69 0.00% 55 57 0.00% 56 71 0.00% 57 91 0.00% 58 98 0.00% 59 105 0.00% 60 97 0.00% 61 120 0.00% 62 136 0.00% 63 166 0.00% 64 156 0.00% 65 149 0.00% 66 164 0.00% 67 190 0.00% 68 186 0.00% 69 258 0.00% 70 277 0.00% 71 274 0.00% 72 344 0.00% 73 375 0.00% 74 424 0.00% 75 458 0.00% 76 495 0.00% 77 506 0.00% 78 571 0.00% 79 624 0.00% 80 647 0.00% 81 768 0.00% 82 917 0.00% 83 1023 0.00% 84 1209 0.01% 85 1184 0.01% 86 1223 0.01% 87 1383 0.01% 88 1360 0.01% 89 1636 0.01% 90 1676 0.01% 91 1878 0.01% 92 2076 0.01% 93 2311 0.01% 94 2566 0.01% 95 2805 0.01% 96 2886 0.01% 97 2932 0.01% 98 3268 0.02% 99 3413 0.02% 100 3497 0.02% 101 3814 0.02% 102 4028 0.02% 103 4475 0.02% 104 4718 0.02% 105 4877 0.02% 106 5202 0.02% 107 5504 0.03% 108 5691 0.03% 109 5908 0.03% 110 6207 0.03% 111 6610 0.03% 112 6896 0.03% 113 7180 0.03% 114 7735 0.04% 115 7987 0.04% 116 8608 0.04% 117 8677 0.04% 118 9010 0.04% 119 9291 0.04% 120 9715 0.04% 121 10120 0.05% 122 10512 0.05% 123 11203 0.05% 124 11709 0.05% 125 12350 0.06% 126 12757 0.06% 127 12935 0.06% 128 13587 0.06% 129 14159 0.07% 130 14139 0.07% 131 14858 0.07% 132 15316 0.07% 133 16121 0.07% 134 17042 0.08% 135 17571 0.08% 136 17938 0.08% 137 18457 0.08% 138 19081 0.09% 139 19721 0.09% 140 19925 0.09% 141 20488 0.09% 142 21317 0.10% 143 22051 0.10% 144 23579 0.11% 145 23631 0.11% 146 24934 0.11% 147 25041 0.12% 148 25986 0.12% 149 26244 0.12% 150 26683 0.12% 151 21026667 96.69% 21746097 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=25 prefix-density=0.37 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=12.94 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=3.3 sequence=TCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAAACTTTGATTTCTCATAAGGTGCTGGCGGAGTCCTAAAAGCAACATCCGCCAATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCA criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=34 prefix-density=1.10 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=51.31 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.8 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACA SRR12671697 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 11:36:02 Started mapping on | Apr 10 11:36:03 Finished on | Apr 10 11:38:23 Mapping speed, Million of reads per hour | 559.19 Number of input reads | 21746097 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 20241482 Uniquely mapped reads % | 93.08% Average mapped length | 299.25 Number of splices: Total | 20335273 Number of splices: Annotated (sjdb) | 19892826 Number of splices: GT/AG | 19946460 Number of splices: GC/AG | 313059 Number of splices: AT/AC | 12195 Number of splices: Non-canonical | 63559 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 532792 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 224502 % of reads mapped to too many loci | 1.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 971823 971823 971823 N_multimapping 532792 532792 532792 N_noFeature 833908 19861418 940833 N_ambiguous 405128 1935 130870 UnstrandedReadsAssigned:19002446 PositiveStrandReadsAssigned:378129 NegativeStrandReadsAssigned:19169779 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671697 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671697-trimmed-pair1.fastq SRR12671697-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,746,097 reads, 19,132,392 reads pseudoaligned [quant] estimated average fragment length: 313.462 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR12671697.ke.tsv 34699 SRR12671697.se.tsv 87100 total ==> SRR12671697.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1705.54 907 22.6191 Potri.005G024800.1.v4.1 1035 722.538 578 34.0248 Potri.004G059700.1.v4.1 961 648.998 1 0.0655369 Potri.007G009000.2.v4.1 1416 1103.54 0 0 Potri.003G141000.2.v4.1 2943 2630.54 1367.82 22.1164 Potri.016G087400.1.v4.1 270 66.4724 960.717 614.728 Potri.015G069301.1.v4.1 564 279.593 0 0 Potri.010G195200.1.v4.1 1773 1460.54 315 9.17333 Potri.012G127500.1.v4.1 977 664.785 137 8.76533 ==> SRR12671697.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 156 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 51 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 27 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671697 completed mapping pipeline successfully