Starting /dee2/code/volunteer_pipeline.sh SRR12671698 current disk space = 3049135857664 free memory = 1574554076 SRR12671698 SRAfilesize 8f892eebab93d2314d4b66d4aa8d5ec0 SRR12671698.sra SRR12671698.sra file validated SRR12671698 is paired end SRR12671698 is conventional basespace SRR12671698 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671698_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.386 37.0 37.0 37.0 37.0 37.0 2 36.22275 37.0 37.0 37.0 37.0 37.0 3 36.4665 37.0 37.0 37.0 37.0 37.0 4 36.577 37.0 37.0 37.0 37.0 37.0 5 36.572 37.0 37.0 37.0 37.0 37.0 6 36.4995 37.0 37.0 37.0 37.0 37.0 7 36.463 37.0 37.0 37.0 37.0 37.0 8 36.587 37.0 37.0 37.0 37.0 37.0 9 36.455 37.0 37.0 37.0 37.0 37.0 10-14 36.5651 37.0 37.0 37.0 37.0 37.0 15-19 36.5489 37.0 37.0 37.0 37.0 37.0 20-24 36.548300000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.496399999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.4854 37.0 37.0 37.0 37.0 37.0 35-39 36.459 37.0 37.0 37.0 37.0 37.0 40-44 36.4773 37.0 37.0 37.0 37.0 37.0 45-49 36.4097 37.0 37.0 37.0 37.0 37.0 50-54 36.381899999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.350100000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.397800000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.330299999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.3338 37.0 37.0 37.0 37.0 37.0 75-79 36.2677 37.0 37.0 37.0 37.0 37.0 80-84 36.287699999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.2914 37.0 37.0 37.0 37.0 37.0 90-94 36.2252 37.0 37.0 37.0 37.0 37.0 95-99 36.193 37.0 37.0 37.0 37.0 37.0 100-104 36.2121 37.0 37.0 37.0 37.0 37.0 105-109 36.1365 37.0 37.0 37.0 37.0 37.0 110-114 36.1356 37.0 37.0 37.0 37.0 37.0 115-119 36.14919999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.074200000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.1171 37.0 37.0 37.0 37.0 37.0 130-134 35.9897 37.0 37.0 37.0 37.0 37.0 135-139 35.9599 37.0 37.0 37.0 37.0 37.0 140-144 35.8976 37.0 37.0 37.0 37.0 37.0 145-149 35.865500000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.41375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 2.0 26 4.0 27 3.0 28 12.0 29 18.0 30 24.0 31 37.0 32 56.0 33 69.0 34 111.0 35 349.0 36 2913.0 37 401.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.075 14.249999999999998 11.700000000000001 45.975 2 18.961625282167045 20.767494356659142 40.0300978179082 20.240782543265613 3 18.825 24.95 26.924999999999997 29.299999999999997 4 22.85 34.1 21.325 21.725 5 20.599999999999998 37.55 23.5 18.35 6 17.8 36.175000000000004 25.15 20.875 7 13.65 20.875 44.574999999999996 20.9 8 17.25 22.400000000000002 30.525000000000002 29.825000000000003 9 17.849999999999998 21.525 33.15 27.474999999999998 10-14 19.655 29.065 27.29 23.990000000000002 15-19 20.29 27.655 28.155 23.9 20-24 19.62 28.349999999999998 27.38 24.65 25-29 19.900000000000002 28.255000000000003 27.48 24.365000000000002 30-34 19.825 28.62 27.445000000000004 24.11 35-39 20.474999999999998 28.060000000000002 27.474999999999998 23.990000000000002 40-44 19.775000000000002 28.444999999999997 27.589999999999996 24.19 45-49 19.71 27.839999999999996 28.01 24.44 50-54 20.035 28.215 27.505000000000003 24.245 55-59 20.064999999999998 28.38 27.395000000000003 24.16 60-64 20.165 27.894999999999996 27.779999999999998 24.16 65-69 20.16 28.01 27.61 24.22 70-74 20.265 27.944999999999997 27.689999999999998 24.099999999999998 75-79 20.755000000000003 28.225 27.575 23.445 80-84 20.51 28.000000000000004 27.165 24.325 85-89 19.965 28.549999999999997 27.775 23.71 90-94 20.369999999999997 28.144999999999996 27.595 23.89 95-99 20.44 28.315 27.250000000000004 23.995 100-104 20.595 28.015 27.355 24.035 105-109 20.715 28.22 27.435 23.630000000000003 110-114 20.61 28.244999999999997 27.495000000000005 23.65 115-119 21.17 27.965 27.400000000000002 23.465 120-124 20.75 28.060000000000002 27.089999999999996 24.099999999999998 125-129 21.295 27.694999999999997 27.165 23.845 130-134 21.025 27.224999999999998 27.944999999999997 23.805 135-139 21.37 28.37 26.945000000000004 23.315 140-144 21.654999999999998 27.915 26.66 23.77 145-149 21.215 28.035 27.045 23.705000000000002 150-151 20.3375 28.762500000000003 26.85 24.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 1.5 23 1.5 24 2.5 25 3.0 26 4.5 27 5.5 28 9.0 29 13.5 30 16.0 31 21.5 32 27.0 33 40.5 34 58.0 35 72.0 36 91.0 37 108.0 38 129.0 39 151.0 40 180.0 41 215.5 42 249.5 43 261.5 44 247.5 45 257.5 46 253.0 47 234.5 48 226.5 49 211.0 50 191.5 51 157.5 52 119.5 53 94.0 54 86.5 55 72.5 56 48.0 57 33.5 58 29.5 59 24.0 60 19.0 61 13.0 62 6.0 63 3.5 64 3.0 65 3.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.79935275080906 86.02499999999999 2 6.634304207119741 12.3 3 0.4584681769147788 1.275 4 0.10787486515641855 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.3624999999999998 0.0 0.0 0.0 0.0 116-117 1.525 0.0 0.0 0.0 0.0 118-119 1.7 0.0 0.0 0.0 0.0 120-121 1.9625 0.0 0.0 0.0 0.0 122-123 2.2125 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.525 0.0 0.0 0.0 0.0 128-129 2.7249999999999996 0.0 0.0 0.0 0.0 130-131 2.9749999999999996 0.0 0.0 0.0 0.0 132-133 3.2249999999999996 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.262499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGAAG 10 0.006830828 145.0 5 >>END_MODULE SRR12671698 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671698_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.164 37.0 37.0 37.0 37.0 37.0 2 36.0815 37.0 37.0 37.0 37.0 37.0 3 36.171 37.0 37.0 37.0 37.0 37.0 4 36.1255 37.0 37.0 37.0 37.0 37.0 5 36.2705 37.0 37.0 37.0 37.0 37.0 6 36.172 37.0 37.0 37.0 37.0 37.0 7 36.304 37.0 37.0 37.0 37.0 37.0 8 36.3115 37.0 37.0 37.0 37.0 37.0 9 36.2435 37.0 37.0 37.0 37.0 37.0 10-14 36.2795 37.0 37.0 37.0 37.0 37.0 15-19 36.2272 37.0 37.0 37.0 37.0 37.0 20-24 36.20649999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.1254 37.0 37.0 37.0 37.0 37.0 30-34 36.1414 37.0 37.0 37.0 37.0 37.0 35-39 36.119 37.0 37.0 37.0 37.0 37.0 40-44 36.0789 37.0 37.0 37.0 37.0 37.0 45-49 36.0615 37.0 37.0 37.0 37.0 37.0 50-54 36.0213 37.0 37.0 37.0 37.0 37.0 55-59 35.9842 37.0 37.0 37.0 37.0 37.0 60-64 35.9905 37.0 37.0 37.0 37.0 37.0 65-69 35.9286 37.0 37.0 37.0 37.0 37.0 70-74 35.950599999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.848200000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.8373 37.0 37.0 37.0 37.0 37.0 85-89 35.83630000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.7671 37.0 37.0 37.0 37.0 37.0 95-99 35.8354 37.0 37.0 37.0 37.0 37.0 100-104 35.8202 37.0 37.0 37.0 37.0 37.0 105-109 35.706100000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.6233 37.0 37.0 37.0 37.0 37.0 115-119 35.58919999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.6269 37.0 37.0 37.0 37.0 37.0 125-129 35.538599999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.5724 37.0 37.0 37.0 37.0 37.0 135-139 35.533699999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.2589 37.0 37.0 37.0 32.2 37.0 145-149 35.3601 37.0 37.0 37.0 32.2 37.0 150-151 34.9705 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 0.0 15 4.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 4.0 22 4.0 23 0.0 24 9.0 25 3.0 26 16.0 27 18.0 28 14.0 29 23.0 30 27.0 31 39.0 32 58.0 33 120.0 34 185.0 35 557.0 36 2687.0 37 225.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.175 16.25 15.65 35.925000000000004 2 24.825 22.975 37.15 15.049999999999999 3 19.675 25.825 31.724999999999998 22.775000000000002 4 22.525000000000002 34.9 21.75 20.825 5 23.0 37.2 22.525000000000002 17.275 6 18.875 36.775000000000006 23.150000000000002 21.2 7 16.675 17.1 43.9 22.325 8 18.675 24.099999999999998 26.450000000000003 30.775000000000002 9 20.625 22.975 31.175000000000004 25.224999999999998 10-14 22.425 28.110000000000003 26.584999999999997 22.88 15-19 22.29 28.199999999999996 27.415 22.095000000000002 20-24 22.384999999999998 27.74 27.465 22.41 25-29 22.285 28.51 27.675 21.529999999999998 30-34 22.435 27.860000000000003 27.595 22.11 35-39 22.055 27.894999999999996 28.175 21.875 40-44 22.625 27.589999999999996 27.694999999999997 22.09 45-49 22.314999999999998 27.810000000000002 28.015 21.86 50-54 22.435 27.49 28.015 22.06 55-59 22.705000000000002 26.915 28.405 21.975 60-64 22.75 26.845000000000002 28.025 22.38 65-69 22.895 27.065 27.544999999999998 22.495 70-74 22.605 27.72 28.050000000000004 21.625 75-79 22.705000000000002 27.415 27.595 22.285 80-84 23.150000000000002 28.205000000000002 27.18 21.465 85-89 23.055 26.840000000000003 27.96 22.145 90-94 23.02 27.305 27.355 22.32 95-99 23.369999999999997 27.025 28.09 21.515 100-104 23.185 28.075 27.405 21.335 105-109 23.195 27.644999999999996 27.565 21.595 110-114 23.625 27.500000000000004 27.505000000000003 21.37 115-119 23.27 28.09 27.229999999999997 21.41 120-124 23.775 27.405 27.6 21.22 125-129 24.01 27.500000000000004 27.245 21.245 130-134 24.8 27.310000000000002 27.36 20.53 135-139 24.54 27.284999999999997 27.084999999999997 21.09 140-144 24.72 27.66 26.650000000000002 20.97 145-149 24.665 27.82 27.105 20.41 150-151 25.5625 27.437499999999996 26.6125 20.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.5 22 3.0 23 1.5 24 3.0 25 4.0 26 9.0 27 11.0 28 5.0 29 6.5 30 12.0 31 16.0 32 21.5 33 31.0 34 40.5 35 59.0 36 81.5 37 106.0 38 124.5 39 147.5 40 194.0 41 216.0 42 232.0 43 253.0 44 269.0 45 274.0 46 251.5 47 237.0 48 229.0 49 213.0 50 178.5 51 136.0 52 114.0 53 104.0 54 88.5 55 69.5 56 57.0 57 46.5 58 32.0 59 25.5 60 25.0 61 16.5 62 10.0 63 11.5 64 9.5 65 4.0 66 0.5 67 0.5 68 1.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.7 #Duplication Level Percentage of deduplicated Percentage of total 1 93.09600862998921 86.3 2 6.3646170442286945 11.799999999999999 3 0.35059331175836034 0.975 4 0.08090614886731393 0.3 5 0.05393743257820927 0.25 6 0.0 0.0 7 0.026968716289104636 0.17500000000000002 8 0.026968716289104636 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 8 0.2 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 7 0.17500000000000002 No Hit TGTCATTCAGCTTTTATATCCCCTATTCTCTTCGTGAAGATGTCTTGCTG 5 0.125 No Hit CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.1125 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.55 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.9625 0.0 0.0 0.0 0.0 122-123 2.2249999999999996 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.525 0.0 0.0 0.0 0.0 128-129 2.7249999999999996 0.0 0.0 0.0 0.0 130-131 2.9749999999999996 0.0 0.0 0.0 0.0 132-133 3.2249999999999996 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.8375000000000004 0.0 0.0 0.0 0.0 138-139 4.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050444 spots for SRR12671698.sra Written 1050444 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra Read 1050427 spots for SRR12671698.sra Written 1050427 spots for SRR12671698.sra SRR ids: ['SRR12671698.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_baa1yl4m SRR12671698.sra spots: 21008557 blocks: [[1, 1050427], [1050428, 2100854], [2100855, 3151281], [3151282, 4201708], [4201709, 5252135], [5252136, 6302562], [6302563, 7352989], [7352990, 8403416], [8403417, 9453843], [9453844, 10504270], [10504271, 11554697], [11554698, 12605124], [12605125, 13655551], [13655552, 14705978], [14705979, 15756405], [15756406, 16806832], [16806833, 17857259], [17857260, 18907686], [18907687, 19958113], [19958114, 21008557]] SRR12671698 file size 7117926 SRR12671698 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671698 SRR12671698_1.fastq SRR12671698_2.fastq Input file: SRR12671698_1.fastq Paired file: SRR12671698_2.fastq trimmed: SRR12671698-trimmed-pair1.fastq, SRR12671698-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:21:25 2025 >> started Wed Feb 12 04:21:48 2025 >> done (23.268s) 21008557 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 962 ( 0.00%) empty read pairs filtered out after trimming by size control 21007579 (100.00%) read pairs available; of these: 1405858 ( 6.69%) trimmed read pairs available after processing 19601721 (93.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 1 0.00% 21 3 0.00% 22 2 0.00% 23 3 0.00% 24 5 0.00% 25 6 0.00% 26 3 0.00% 27 2 0.00% 28 1 0.00% 29 6 0.00% 30 7 0.00% 31 5 0.00% 32 16 0.00% 33 13 0.00% 34 7 0.00% 35 11 0.00% 36 15 0.00% 37 13 0.00% 38 22 0.00% 39 18 0.00% 40 25 0.00% 41 32 0.00% 42 18 0.00% 43 33 0.00% 44 38 0.00% 45 39 0.00% 46 27 0.00% 47 45 0.00% 48 48 0.00% 49 41 0.00% 50 52 0.00% 51 58 0.00% 52 65 0.00% 53 70 0.00% 54 67 0.00% 55 79 0.00% 56 95 0.00% 57 103 0.00% 58 122 0.00% 59 134 0.00% 60 143 0.00% 61 186 0.00% 62 216 0.00% 63 243 0.00% 64 240 0.00% 65 253 0.00% 66 269 0.00% 67 326 0.00% 68 335 0.00% 69 392 0.00% 70 453 0.00% 71 512 0.00% 72 562 0.00% 73 680 0.00% 74 770 0.00% 75 926 0.00% 76 975 0.00% 77 999 0.00% 78 1105 0.01% 79 1259 0.01% 80 1466 0.01% 81 1632 0.01% 82 1850 0.01% 83 2061 0.01% 84 2248 0.01% 85 2630 0.01% 86 2823 0.01% 87 2969 0.01% 88 3228 0.02% 89 3588 0.02% 90 3849 0.02% 91 4337 0.02% 92 4750 0.02% 93 5285 0.03% 94 5916 0.03% 95 5990 0.03% 96 6554 0.03% 97 6978 0.03% 98 7232 0.03% 99 7764 0.04% 100 8445 0.04% 101 8823 0.04% 102 9488 0.05% 103 10112 0.05% 104 10545 0.05% 105 11319 0.05% 106 11872 0.06% 107 12440 0.06% 108 13120 0.06% 109 13591 0.06% 110 14322 0.07% 111 15070 0.07% 112 15856 0.08% 113 16255 0.08% 114 17041 0.08% 115 18146 0.09% 116 18684 0.09% 117 19375 0.09% 118 19963 0.10% 119 20345 0.10% 120 21156 0.10% 121 22079 0.11% 122 22685 0.11% 123 23740 0.11% 124 24437 0.12% 125 25310 0.12% 126 25933 0.12% 127 26808 0.13% 128 27754 0.13% 129 27761 0.13% 130 28360 0.13% 131 29332 0.14% 132 30307 0.14% 133 31756 0.15% 134 32413 0.15% 135 33242 0.16% 136 34081 0.16% 137 34803 0.17% 138 35396 0.17% 139 36427 0.17% 140 36133 0.17% 141 37569 0.18% 142 38628 0.18% 143 39268 0.19% 144 41144 0.20% 145 41524 0.20% 146 43184 0.21% 147 42700 0.20% 148 43281 0.21% 149 44035 0.21% 150 44451 0.21% 151 19601721 93.31% 21007579 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=18 prefix-density=0.59 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=11.68 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.3 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=23 prefix-density=0.82 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=45.59 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=2.3 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACA SRR12671698 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:22:32 Started mapping on | Feb 12 04:22:32 Finished on | Feb 12 04:24:32 Mapping speed, Million of reads per hour | 630.23 Number of input reads | 21007579 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19849190 Uniquely mapped reads % | 94.49% Average mapped length | 297.78 Number of splices: Total | 20191084 Number of splices: Annotated (sjdb) | 19776808 Number of splices: GT/AG | 19782431 Number of splices: GC/AG | 340532 Number of splices: AT/AC | 13887 Number of splices: Non-canonical | 54234 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 540519 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 193780 % of reads mapped to too many loci | 0.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.86% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 617870 617870 617870 N_multimapping 540519 540519 540519 N_noFeature 694188 19524518 805730 N_ambiguous 337766 1558 123655 UnstrandedReadsAssigned:18817236 PositiveStrandReadsAssigned:323114 NegativeStrandReadsAssigned:18919805 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671698 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671698-trimmed-pair1.fastq SRR12671698-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,007,579 reads, 18,931,854 reads pseudoaligned [quant] estimated average fragment length: 295.872 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,012 rounds 52401 SRR12671698.ke.tsv 34699 SRR12671698.se.tsv 87100 total ==> SRR12671698.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1723.13 531 14.9283 Potri.005G024800.1.v4.1 1035 740.128 100 6.54527 Potri.004G059700.1.v4.1 961 666.647 17 1.23534 Potri.007G009000.2.v4.1 1416 1121.13 0 0 Potri.003G141000.2.v4.1 2943 2648.13 794.374 14.5318 Potri.016G087400.1.v4.1 270 77.588 907 566.3 Potri.015G069301.1.v4.1 564 295.898 0 0 Potri.010G195200.1.v4.1 1773 1478.13 58 1.90086 Potri.012G127500.1.v4.1 977 682.427 149 10.577 ==> SRR12671698.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 470 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 184 Potri.001G212900.v4.1 18 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 5 SRR12671698 completed mapping pipeline successfully