Starting /dee2/code/volunteer_pipeline.sh SRR12671699 current disk space = 3049172889600 free memory = 1337841908 SRR12671699 SRAfilesize a323c09f1b67eede82fd60e0f454261b SRR12671699.sra SRR12671699.sra file validated SRR12671699 is paired end SRR12671699 is conventional basespace SRR12671699 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671699_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.389 37.0 37.0 37.0 37.0 37.0 2 36.24025 37.0 37.0 37.0 37.0 37.0 3 36.4835 37.0 37.0 37.0 37.0 37.0 4 36.5985 37.0 37.0 37.0 37.0 37.0 5 36.607 37.0 37.0 37.0 37.0 37.0 6 36.5935 37.0 37.0 37.0 37.0 37.0 7 36.4345 37.0 37.0 37.0 37.0 37.0 8 36.548 37.0 37.0 37.0 37.0 37.0 9 36.483 37.0 37.0 37.0 37.0 37.0 10-14 36.4645 37.0 37.0 37.0 37.0 37.0 15-19 36.5417 37.0 37.0 37.0 37.0 37.0 20-24 36.494800000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.432300000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4653 37.0 37.0 37.0 37.0 37.0 35-39 36.4428 37.0 37.0 37.0 37.0 37.0 40-44 36.4531 37.0 37.0 37.0 37.0 37.0 45-49 36.401599999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.403499999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.3568 37.0 37.0 37.0 37.0 37.0 60-64 36.3656 37.0 37.0 37.0 37.0 37.0 65-69 36.394400000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3637 37.0 37.0 37.0 37.0 37.0 75-79 36.2808 37.0 37.0 37.0 37.0 37.0 80-84 36.265 37.0 37.0 37.0 37.0 37.0 85-89 36.2664 37.0 37.0 37.0 37.0 37.0 90-94 36.2278 37.0 37.0 37.0 37.0 37.0 95-99 36.1951 37.0 37.0 37.0 37.0 37.0 100-104 36.218399999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.107600000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.0464 37.0 37.0 37.0 37.0 37.0 115-119 36.0933 37.0 37.0 37.0 37.0 37.0 120-124 36.0646 37.0 37.0 37.0 37.0 37.0 125-129 35.9916 37.0 37.0 37.0 37.0 37.0 130-134 35.954600000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.8803 37.0 37.0 37.0 37.0 37.0 140-144 35.8664 37.0 37.0 37.0 37.0 37.0 145-149 35.8552 37.0 37.0 37.0 37.0 37.0 150-151 35.359 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 4.0 27 7.0 28 9.0 29 18.0 30 26.0 31 36.0 32 43.0 33 76.0 34 151.0 35 345.0 36 2930.0 37 354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.675 13.625000000000002 12.25 46.45 2 19.358878036563986 20.836463811670423 40.52091159529176 19.28374655647383 3 19.15 24.975 26.900000000000002 28.975 4 21.975 35.3 22.075 20.65 5 20.3 36.8 24.425 18.475 6 15.75 37.25 26.275 20.724999999999998 7 13.100000000000001 19.650000000000002 46.675 20.575 8 17.575 21.5 30.7 30.225 9 17.775 21.3 32.425 28.499999999999996 10-14 19.335 29.225 26.950000000000003 24.490000000000002 15-19 19.895 27.965 27.915 24.224999999999998 20-24 19.345000000000002 28.415000000000003 28.044999999999998 24.195 25-29 18.815 28.7 28.03 24.455 30-34 19.405 28.715000000000003 28.075 23.805 35-39 20.02 28.625 27.46 23.895 40-44 19.665 28.294999999999998 28.095 23.945 45-49 19.545 28.26 27.810000000000002 24.385 50-54 20.1 28.860000000000003 27.67 23.369999999999997 55-59 20.47 27.96 27.88 23.69 60-64 19.35 28.560000000000002 27.52 24.57 65-69 19.855 28.155 28.015 23.974999999999998 70-74 19.395 28.04 28.499999999999996 24.065 75-79 20.205000000000002 28.4 27.26 24.135 80-84 19.97 27.96 28.01 24.060000000000002 85-89 20.65 28.53 27.375 23.445 90-94 19.725 28.660000000000004 27.365000000000002 24.25 95-99 19.915 27.800000000000004 27.915 24.37 100-104 19.705000000000002 27.915 28.48 23.9 105-109 20.05 28.189999999999998 27.529999999999998 24.23 110-114 20.75 27.639999999999997 27.74 23.87 115-119 20.330000000000002 28.515 27.139999999999997 24.015 120-124 20.74 28.599999999999998 27.310000000000002 23.35 125-129 20.724999999999998 27.755000000000003 27.255000000000003 24.265 130-134 19.89 28.26 27.74 24.11 135-139 20.244999999999997 28.310000000000002 27.485 23.96 140-144 20.46 28.360000000000003 27.29 23.89 145-149 20.18 28.345 27.855 23.62 150-151 21.0125 28.325 27.775 22.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 2.0 24 3.0 25 3.5 26 4.0 27 7.5 28 8.5 29 11.0 30 18.5 31 29.0 32 37.0 33 44.0 34 60.0 35 71.0 36 87.0 37 123.0 38 153.0 39 162.0 40 182.0 41 221.0 42 254.5 43 272.0 44 258.5 45 258.5 46 255.5 47 231.0 48 220.5 49 201.0 50 172.0 51 135.0 52 111.5 53 103.5 54 75.0 55 49.5 56 43.0 57 39.5 58 27.0 59 16.5 60 12.0 61 7.0 62 8.0 63 6.5 64 3.5 65 3.0 66 1.5 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.05 #Duplication Level Percentage of deduplicated Percentage of total 1 94.04572036150984 88.44999999999999 2 5.582137161084529 10.5 3 0.3721424774056353 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.7625 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.0125 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.375 0.0 0.0 0.0 0.0 130-131 2.575 0.0 0.0 0.0 0.0 132-133 2.8125 0.0 0.0 0.0 0.0 134-135 3.05 0.0 0.0 0.0 0.0 136-137 3.4000000000000004 0.0 0.0 0.0 0.0 138-139 3.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCACCT 10 0.006830828 145.0 145 CAGTTCC 20 3.5877043E-4 108.75 3 CCAGTTC 30 1.4118372E-5 96.666664 2 >>END_MODULE SRR12671699 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671699_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.262 37.0 37.0 37.0 37.0 37.0 2 36.0175 37.0 37.0 37.0 37.0 37.0 3 36.137 37.0 37.0 37.0 37.0 37.0 4 36.236 37.0 37.0 37.0 37.0 37.0 5 36.258 37.0 37.0 37.0 37.0 37.0 6 36.2325 37.0 37.0 37.0 37.0 37.0 7 36.2155 37.0 37.0 37.0 37.0 37.0 8 36.3415 37.0 37.0 37.0 37.0 37.0 9 36.3285 37.0 37.0 37.0 37.0 37.0 10-14 36.319 37.0 37.0 37.0 37.0 37.0 15-19 36.268600000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.291399999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.2002 37.0 37.0 37.0 37.0 37.0 30-34 36.1354 37.0 37.0 37.0 37.0 37.0 35-39 36.166399999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.114700000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.126099999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.0603 37.0 37.0 37.0 37.0 37.0 55-59 36.0259 37.0 37.0 37.0 37.0 37.0 60-64 35.9836 37.0 37.0 37.0 37.0 37.0 65-69 35.9459 37.0 37.0 37.0 37.0 37.0 70-74 35.964600000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.829499999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.8566 37.0 37.0 37.0 37.0 37.0 85-89 35.881 37.0 37.0 37.0 37.0 37.0 90-94 35.727000000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.794900000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.659800000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.701800000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.6471 37.0 37.0 37.0 37.0 37.0 115-119 35.62220000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.6288 37.0 37.0 37.0 37.0 37.0 125-129 35.572799999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.565200000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.555 37.0 37.0 37.0 37.0 37.0 140-144 35.3569 37.0 37.0 37.0 37.0 37.0 145-149 35.426 37.0 37.0 37.0 34.6 37.0 150-151 34.960499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 1.0 18 2.0 19 0.0 20 1.0 21 1.0 22 1.0 23 2.0 24 4.0 25 6.0 26 6.0 27 15.0 28 24.0 29 18.0 30 29.0 31 58.0 32 79.0 33 119.0 34 196.0 35 550.0 36 2665.0 37 221.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.925000000000004 16.8 15.8 36.475 2 24.8 22.75 36.9 15.55 3 19.225 25.474999999999998 31.35 23.95 4 21.65 35.0 23.625 19.725 5 24.025 36.925000000000004 22.1 16.950000000000003 6 18.55 38.85 23.0 19.6 7 17.925 17.325 43.575 21.175 8 19.45 23.799999999999997 29.7 27.05 9 21.625 23.724999999999998 29.25 25.4 10-14 22.345000000000002 28.189999999999998 27.325 22.14 15-19 22.435 27.415 28.599999999999998 21.55 20-24 22.275 27.845 28.249999999999996 21.63 25-29 21.82 28.494999999999997 27.99 21.695 30-34 22.095000000000002 28.035 28.285 21.584999999999997 35-39 22.335 27.994999999999997 28.084999999999997 21.584999999999997 40-44 22.040000000000003 27.97 28.42 21.57 45-49 22.220000000000002 28.185 27.93 21.665 50-54 22.545 28.29 27.284999999999997 21.88 55-59 22.825 27.685 27.794999999999998 21.695 60-64 22.375 28.139999999999997 27.88 21.605 65-69 22.775000000000002 27.245 28.27 21.709999999999997 70-74 22.36 27.994999999999997 27.79 21.855 75-79 23.169999999999998 27.775 27.834999999999997 21.22 80-84 23.25 28.13 27.265 21.355 85-89 23.325000000000003 27.77 27.92 20.985 90-94 23.655 28.175 27.66 20.51 95-99 23.79 27.61 27.215 21.385 100-104 23.27 27.705000000000002 27.689999999999998 21.335 105-109 23.49 28.055000000000003 27.82 20.635 110-114 23.474999999999998 28.560000000000002 27.555000000000003 20.41 115-119 24.099999999999998 27.800000000000004 27.245 20.855 120-124 24.32 28.005000000000003 27.1 20.575 125-129 24.834999999999997 27.435 27.195000000000004 20.535 130-134 24.16 27.435 27.33 21.075 135-139 24.375 27.800000000000004 27.584999999999997 20.24 140-144 24.485 27.91 26.900000000000002 20.705000000000002 145-149 24.104999999999997 27.735 27.865000000000002 20.294999999999998 150-151 25.5125 28.625 26.0375 19.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 1.0 17 1.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 0.5 24 1.0 25 4.0 26 5.0 27 5.5 28 10.5 29 10.5 30 11.5 31 19.0 32 33.0 33 47.0 34 60.0 35 80.0 36 92.5 37 104.5 38 125.5 39 153.0 40 185.5 41 221.0 42 244.5 43 256.0 44 257.0 45 256.0 46 263.0 47 254.0 48 225.5 49 202.5 50 179.5 51 142.5 52 110.5 53 88.5 54 74.5 55 64.5 56 49.0 57 39.5 58 30.5 59 18.0 60 18.5 61 15.0 62 8.0 63 6.5 64 3.5 65 2.0 66 1.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.85 #Duplication Level Percentage of deduplicated Percentage of total 1 94.1928609483218 88.4 2 5.301012253596165 9.950000000000001 3 0.31965903036760784 0.8999999999999999 4 0.13319126265316997 0.5 5 0.05327650506126798 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit CTTTTATATCCCCTATTCTCTTCGTGAAGATGTCTTGCTGTGGAGGAAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1625 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.425 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 1.9875 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.425 0.0 0.0 0.0 0.0 130-131 2.625 0.0 0.0 0.0 0.0 132-133 2.8625 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.4749999999999996 0.0 0.0 0.0 0.0 138-139 3.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTCTA 10 0.006830828 145.0 145 CTTATGT 10 0.006830828 145.0 3 GTGATTT 10 0.006830828 145.0 1 >>END_MODULE Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756220 spots for SRR12671699.sra Written 756220 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra Read 756218 spots for SRR12671699.sra Written 756218 spots for SRR12671699.sra SRR ids: ['SRR12671699.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vgshm8rm SRR12671699.sra spots: 15124362 blocks: [[1, 756218], [756219, 1512436], [1512437, 2268654], [2268655, 3024872], [3024873, 3781090], [3781091, 4537308], [4537309, 5293526], [5293527, 6049744], [6049745, 6805962], [6805963, 7562180], [7562181, 8318398], [8318399, 9074616], [9074617, 9830834], [9830835, 10587052], [10587053, 11343270], [11343271, 12099488], [12099489, 12855706], [12855707, 13611924], [13611925, 14368142], [14368143, 15124362]] SRR12671699 file size 5118219 SRR12671699 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671699 SRR12671699_1.fastq SRR12671699_2.fastq Input file: SRR12671699_1.fastq Paired file: SRR12671699_2.fastq trimmed: SRR12671699-trimmed-pair1.fastq, SRR12671699-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:34:18 2025 >> started Wed Feb 12 04:34:42 2025 >> done (24.373s) 15124362 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 1032 ( 0.01%) empty read pairs filtered out after trimming by size control 15123310 (99.99%) read pairs available; of these: 893281 ( 5.91%) trimmed read pairs available after processing 14230029 (94.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 2 0.00% 21 7 0.00% 22 5 0.00% 23 8 0.00% 24 7 0.00% 25 8 0.00% 26 3 0.00% 27 12 0.00% 28 14 0.00% 29 15 0.00% 30 21 0.00% 31 16 0.00% 32 18 0.00% 33 22 0.00% 34 31 0.00% 35 24 0.00% 36 26 0.00% 37 30 0.00% 38 48 0.00% 39 47 0.00% 40 40 0.00% 41 44 0.00% 42 45 0.00% 43 41 0.00% 44 49 0.00% 45 46 0.00% 46 57 0.00% 47 54 0.00% 48 79 0.00% 49 77 0.00% 50 73 0.00% 51 70 0.00% 52 112 0.00% 53 79 0.00% 54 100 0.00% 55 101 0.00% 56 106 0.00% 57 117 0.00% 58 131 0.00% 59 129 0.00% 60 159 0.00% 61 186 0.00% 62 190 0.00% 63 197 0.00% 64 226 0.00% 65 214 0.00% 66 275 0.00% 67 309 0.00% 68 313 0.00% 69 381 0.00% 70 380 0.00% 71 431 0.00% 72 516 0.00% 73 563 0.00% 74 612 0.00% 75 697 0.00% 76 762 0.01% 77 858 0.01% 78 866 0.01% 79 959 0.01% 80 1102 0.01% 81 1159 0.01% 82 1269 0.01% 83 1541 0.01% 84 1590 0.01% 85 1823 0.01% 86 1944 0.01% 87 2118 0.01% 88 2389 0.02% 89 2548 0.02% 90 2735 0.02% 91 2980 0.02% 92 3160 0.02% 93 3521 0.02% 94 3713 0.02% 95 3978 0.03% 96 4199 0.03% 97 4600 0.03% 98 4707 0.03% 99 4988 0.03% 100 5337 0.04% 101 5830 0.04% 102 6042 0.04% 103 6342 0.04% 104 6791 0.04% 105 6972 0.05% 106 7314 0.05% 107 7833 0.05% 108 8069 0.05% 109 8413 0.06% 110 8688 0.06% 111 9117 0.06% 112 9620 0.06% 113 9995 0.07% 114 10306 0.07% 115 10898 0.07% 116 11401 0.08% 117 12137 0.08% 118 11792 0.08% 119 12692 0.08% 120 13175 0.09% 121 13599 0.09% 122 13923 0.09% 123 14791 0.10% 124 14993 0.10% 125 15549 0.10% 126 16069 0.11% 127 16582 0.11% 128 17156 0.11% 129 17119 0.11% 130 18253 0.12% 131 18546 0.12% 132 19035 0.13% 133 20163 0.13% 134 20668 0.14% 135 20916 0.14% 136 21481 0.14% 137 21726 0.14% 138 22636 0.15% 139 23407 0.15% 140 23534 0.16% 141 23982 0.16% 142 24788 0.16% 143 25317 0.17% 144 26320 0.17% 145 26726 0.18% 146 27354 0.18% 147 27429 0.18% 148 28324 0.19% 149 28390 0.19% 150 28663 0.19% 151 14230029 94.09% 15123310 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=33 prefix-density=0.48 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=103.59 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=8.1 sequence=TCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGATATAGCTAGGGACACATCAAGTTCTGGGACGACTTAGACACCTTTCGGCTTGGCGGCAATAAAGCTGATGCACTGCACTTGACG criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=33 prefix-density=0.67 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=33 fanout-score=23.66 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=1.4 sequence=TGGCTTCCTCTACGCTCTCCCCTGCCACTCCCTCACAGCTATGCTCTAGCAAGAGTGGCATGTTCTCTCCTACACATGCGGTGTTTGTGAAACCAACAAGGACAAATATGGTG SRR12671699 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:35:24 Started mapping on | Feb 12 04:35:24 Finished on | Feb 12 04:37:10 Mapping speed, Million of reads per hour | 513.62 Number of input reads | 15123310 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14252447 Uniquely mapped reads % | 94.24% Average mapped length | 297.94 Number of splices: Total | 14541520 Number of splices: Annotated (sjdb) | 14232114 Number of splices: GT/AG | 14254613 Number of splices: GC/AG | 235126 Number of splices: AT/AC | 8223 Number of splices: Non-canonical | 43558 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 362482 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 91893 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.63% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 508381 508381 508381 N_multimapping 362482 362482 362482 N_noFeature 545487 14045064 616102 N_ambiguous 232477 1069 95133 UnstrandedReadsAssigned:13474483 PositiveStrandReadsAssigned:206314 NegativeStrandReadsAssigned:13541212 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671699 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671699-trimmed-pair1.fastq SRR12671699-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,123,310 reads, 13,538,245 reads pseudoaligned [quant] estimated average fragment length: 309.415 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52401 SRR12671699.ke.tsv 34699 SRR12671699.se.tsv 87100 total ==> SRR12671699.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1709.59 592 24.949 Potri.005G024800.1.v4.1 1035 726.585 309 30.6404 Potri.004G059700.1.v4.1 961 653.375 0 0 Potri.007G009000.2.v4.1 1416 1107.59 0 0 Potri.003G141000.2.v4.1 2943 2634.59 725 19.8266 Potri.016G087400.1.v4.1 270 77.2129 671 626.116 Potri.015G069301.1.v4.1 564 290.008 0 0 Potri.010G195200.1.v4.1 1773 1464.59 81 3.98467 Potri.012G127500.1.v4.1 977 668.994 97 10.4465 ==> SRR12671699.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 159 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 196 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR12671699 completed mapping pipeline successfully