Starting /dee2/code/volunteer_pipeline.sh SRR12671700 current disk space = 3049129750528 free memory = 1492000144 SRR12671700 SRAfilesize 384170cc78e515ddaab9cdf8b701d8ff SRR12671700.sra SRR12671700.sra file validated SRR12671700 is paired end SRR12671700 is conventional basespace SRR12671700 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671700_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.422 37.0 37.0 37.0 37.0 37.0 2 36.117 37.0 37.0 37.0 37.0 37.0 3 36.5615 37.0 37.0 37.0 37.0 37.0 4 36.5475 37.0 37.0 37.0 37.0 37.0 5 36.519 37.0 37.0 37.0 37.0 37.0 6 36.4985 37.0 37.0 37.0 37.0 37.0 7 36.441 37.0 37.0 37.0 37.0 37.0 8 36.5825 37.0 37.0 37.0 37.0 37.0 9 36.5745 37.0 37.0 37.0 37.0 37.0 10-14 36.555099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5227 37.0 37.0 37.0 37.0 37.0 20-24 36.5248 37.0 37.0 37.0 37.0 37.0 25-29 36.4795 37.0 37.0 37.0 37.0 37.0 30-34 36.4548 37.0 37.0 37.0 37.0 37.0 35-39 36.4203 37.0 37.0 37.0 37.0 37.0 40-44 36.4063 37.0 37.0 37.0 37.0 37.0 45-49 36.3839 37.0 37.0 37.0 37.0 37.0 50-54 36.387 37.0 37.0 37.0 37.0 37.0 55-59 36.3644 37.0 37.0 37.0 37.0 37.0 60-64 36.3656 37.0 37.0 37.0 37.0 37.0 65-69 36.3898 37.0 37.0 37.0 37.0 37.0 70-74 36.3133 37.0 37.0 37.0 37.0 37.0 75-79 36.32000000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.305 37.0 37.0 37.0 37.0 37.0 85-89 36.2676 37.0 37.0 37.0 37.0 37.0 90-94 36.2436 37.0 37.0 37.0 37.0 37.0 95-99 36.1367 37.0 37.0 37.0 37.0 37.0 100-104 36.170399999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.103500000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.099199999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.099399999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.0077 37.0 37.0 37.0 37.0 37.0 125-129 35.9932 37.0 37.0 37.0 37.0 37.0 130-134 35.9115 37.0 37.0 37.0 37.0 37.0 135-139 35.90259999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.835899999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.847699999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.30175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 2.0 26 7.0 27 8.0 28 14.0 29 22.0 30 24.0 31 30.0 32 48.0 33 70.0 34 137.0 35 312.0 36 2966.0 37 359.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.874999999999996 14.674999999999999 9.25 44.2 2 17.13497240341194 20.747616658304064 42.548921224284996 19.568489713998996 3 16.900000000000002 26.0 28.000000000000004 29.099999999999998 4 21.625 32.4 22.575 23.400000000000002 5 20.825 36.9 24.325 17.95 6 16.25 36.8 25.924999999999997 21.025 7 13.8 20.974999999999998 45.775 19.45 8 17.95 21.8 29.975 30.275000000000002 9 17.25 22.05 32.225 28.475 10-14 20.01 29.310000000000002 26.584999999999997 24.095 15-19 19.585 28.305000000000003 28.189999999999998 23.919999999999998 20-24 19.535 28.655 28.115000000000002 23.695 25-29 20.01 28.615000000000002 27.76 23.615 30-34 19.79 28.854999999999997 27.584999999999997 23.77 35-39 20.04 28.044999999999998 27.815 24.099999999999998 40-44 19.525000000000002 28.705000000000002 28.025 23.745 45-49 19.794999999999998 28.425 27.595 24.185000000000002 50-54 20.005 27.894999999999996 28.13 23.97 55-59 19.705000000000002 28.665000000000003 27.655 23.974999999999998 60-64 20.27 27.560000000000002 27.875 24.295 65-69 19.735 28.525 27.74 24.0 70-74 20.625 28.205000000000002 27.61 23.56 75-79 19.744999999999997 28.625 27.389999999999997 24.240000000000002 80-84 20.200000000000003 27.575 27.815 24.41 85-89 20.205000000000002 28.17 28.09 23.535 90-94 19.875 28.43 27.584999999999997 24.11 95-99 20.135 28.384999999999998 27.474999999999998 24.005000000000003 100-104 20.595 28.925 27.21 23.27 105-109 20.605 27.88 28.26 23.255 110-114 20.64 28.005000000000003 27.279999999999998 24.075 115-119 21.075 28.54 26.655 23.73 120-124 20.45 28.084999999999997 27.79 23.674999999999997 125-129 20.285 28.799999999999997 27.155 23.76 130-134 21.47 28.675 26.505000000000003 23.35 135-139 20.89 27.93 27.68 23.5 140-144 21.18 27.655 27.465 23.7 145-149 20.8 29.075 27.150000000000002 22.975 150-151 21.5375 28.1125 26.7625 23.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 2.0 24 2.5 25 2.0 26 2.0 27 7.5 28 13.5 29 20.0 30 29.5 31 29.0 32 31.5 33 42.0 34 59.5 35 88.0 36 103.0 37 110.0 38 121.5 39 149.5 40 179.5 41 199.5 42 236.0 43 243.5 44 256.5 45 280.0 46 260.0 47 249.5 48 234.0 49 215.0 50 186.0 51 148.0 52 120.0 53 92.5 54 75.5 55 56.0 56 37.5 57 36.5 58 29.5 59 17.0 60 14.0 61 6.0 62 3.0 63 3.0 64 2.0 65 0.5 66 0.0 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.98296059637913 88.25 2 5.5910543130990416 10.5 3 0.3993610223642172 1.125 4 0.0 0.0 5 0.026624068157614485 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5249999999999999 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.6125 0.0 0.0 0.0 0.0 120-121 1.8624999999999998 0.0 0.0 0.0 0.0 122-123 2.075 0.0 0.0 0.0 0.0 124-125 2.4625 0.0 0.0 0.0 0.0 126-127 2.6625 0.0 0.0 0.0 0.0 128-129 2.825 0.0 0.0 0.0 0.0 130-131 3.225 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.7375 0.0 0.0 0.0 0.0 136-137 4.1875 0.0 0.0 0.0 0.0 138-139 4.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGTTT 10 0.006830828 145.0 1 >>END_MODULE SRR12671700 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671700_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9745 37.0 37.0 37.0 37.0 37.0 2 35.824 37.0 37.0 37.0 37.0 37.0 3 35.9355 37.0 37.0 37.0 37.0 37.0 4 35.905 37.0 37.0 37.0 37.0 37.0 5 36.092 37.0 37.0 37.0 37.0 37.0 6 36.0575 37.0 37.0 37.0 37.0 37.0 7 36.097 37.0 37.0 37.0 37.0 37.0 8 36.08 37.0 37.0 37.0 37.0 37.0 9 36.1425 37.0 37.0 37.0 37.0 37.0 10-14 36.0963 37.0 37.0 37.0 37.0 37.0 15-19 36.0467 37.0 37.0 37.0 37.0 37.0 20-24 36.0531 37.0 37.0 37.0 37.0 37.0 25-29 35.983799999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.987899999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.9309 37.0 37.0 37.0 37.0 37.0 40-44 35.902499999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.903000000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.775099999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.7476 37.0 37.0 37.0 37.0 37.0 60-64 35.7648 37.0 37.0 37.0 37.0 37.0 65-69 35.732499999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.789 37.0 37.0 37.0 37.0 37.0 75-79 35.6382 37.0 37.0 37.0 37.0 37.0 80-84 35.6691 37.0 37.0 37.0 37.0 37.0 85-89 35.6101 37.0 37.0 37.0 37.0 37.0 90-94 35.5438 37.0 37.0 37.0 37.0 37.0 95-99 35.6136 37.0 37.0 37.0 37.0 37.0 100-104 35.5601 37.0 37.0 37.0 37.0 37.0 105-109 35.4717 37.0 37.0 37.0 37.0 37.0 110-114 35.4374 37.0 37.0 37.0 37.0 37.0 115-119 35.367900000000006 37.0 37.0 37.0 32.2 37.0 120-124 35.4443 37.0 37.0 37.0 37.0 37.0 125-129 35.368 37.0 37.0 37.0 34.6 37.0 130-134 35.298500000000004 37.0 37.0 37.0 32.2 37.0 135-139 35.2606 37.0 37.0 37.0 32.2 37.0 140-144 34.959900000000005 37.0 37.0 37.0 25.0 37.0 145-149 35.050799999999995 37.0 37.0 37.0 27.4 37.0 150-151 34.53475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 2.0 16 0.0 17 1.0 18 0.0 19 0.0 20 2.0 21 5.0 22 1.0 23 5.0 24 9.0 25 17.0 26 13.0 27 18.0 28 19.0 29 25.0 30 43.0 31 53.0 32 88.0 33 137.0 34 251.0 35 644.0 36 2486.0 37 176.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.325 16.825000000000003 12.5 35.35 2 21.65 24.175 40.375 13.8 3 19.85 25.825 32.25 22.075 4 23.400000000000002 34.0 22.3 20.3 5 23.974999999999998 36.675000000000004 22.925 16.425 6 16.900000000000002 38.75 24.5 19.85 7 17.4 17.025000000000002 44.25 21.325 8 19.650000000000002 21.475 30.775000000000002 28.1 9 22.6 23.1 29.25 25.05 10-14 22.795 28.155 26.840000000000003 22.21 15-19 22.264999999999997 27.955000000000002 28.26 21.52 20-24 22.384999999999998 28.634999999999998 28.1 20.880000000000003 25-29 22.42 28.37 28.375 20.835 30-34 21.675 27.66 28.57 22.095000000000002 35-39 22.259999999999998 27.560000000000002 28.4 21.78 40-44 22.42 27.900000000000002 28.139999999999997 21.54 45-49 22.0 28.03 28.225 21.745 50-54 22.29 28.535 27.675 21.5 55-59 22.71 27.595 28.515 21.18 60-64 23.28 27.584999999999997 27.544999999999998 21.59 65-69 23.485 27.694999999999997 27.36 21.46 70-74 22.81 28.189999999999998 27.715 21.285 75-79 23.24 27.744999999999997 27.755000000000003 21.26 80-84 23.805 27.675 27.455000000000002 21.065 85-89 23.615 27.395000000000003 27.794999999999998 21.195 90-94 23.0 27.47 28.28 21.25 95-99 24.125 27.534999999999997 27.495000000000005 20.845 100-104 23.685000000000002 27.589999999999996 27.495000000000005 21.23 105-109 23.46 28.355000000000004 27.265 20.919999999999998 110-114 23.474999999999998 28.475 27.450000000000003 20.599999999999998 115-119 23.79 27.935 27.384999999999998 20.89 120-124 23.705000000000002 26.974999999999998 27.875 21.445 125-129 23.549999999999997 28.17 27.500000000000004 20.78 130-134 24.11 28.325 27.77 19.794999999999998 135-139 24.47 27.065 27.96 20.505000000000003 140-144 24.81 27.555000000000003 27.47 20.165 145-149 25.240000000000002 27.694999999999997 27.334999999999997 19.73 150-151 25.0375 28.1375 26.75 20.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 2.0 23 4.5 24 4.0 25 3.5 26 6.5 27 10.0 28 11.5 29 13.0 30 21.0 31 23.5 32 30.5 33 44.5 34 54.0 35 68.0 36 86.0 37 102.0 38 124.0 39 161.5 40 190.0 41 208.0 42 228.0 43 248.0 44 257.0 45 248.0 46 249.0 47 254.5 48 253.0 49 226.0 50 181.0 51 138.0 52 113.0 53 106.0 54 84.5 55 60.0 56 43.0 57 41.5 58 32.0 59 17.5 60 14.5 61 9.5 62 5.0 63 3.0 64 2.0 65 2.5 66 2.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.75 #Duplication Level Percentage of deduplicated Percentage of total 1 94.24 88.35 2 5.093333333333333 9.55 3 0.5333333333333333 1.5 4 0.08 0.3 5 0.0 0.0 6 0.05333333333333334 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.325 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.8875000000000002 0.0 0.0 0.0 0.0 122-123 2.0999999999999996 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 2.875 0.0 0.0 0.0 0.0 130-131 3.275 0.0 0.0 0.0 0.0 132-133 3.475 0.0 0.0 0.0 0.0 134-135 3.7875 0.0 0.0 0.0 0.0 136-137 4.2375 0.0 0.0 0.0 0.0 138-139 4.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAGTC 10 0.006830828 145.0 145 AGTCCAA 10 0.006830828 145.0 9 >>END_MODULE Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066122 spots for SRR12671700.sra Written 1066122 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra Read 1066114 spots for SRR12671700.sra Written 1066114 spots for SRR12671700.sra SRR ids: ['SRR12671700.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mn4006hz SRR12671700.sra spots: 21322288 blocks: [[1, 1066114], [1066115, 2132228], [2132229, 3198342], [3198343, 4264456], [4264457, 5330570], [5330571, 6396684], [6396685, 7462798], [7462799, 8528912], [8528913, 9595026], [9595027, 10661140], [10661141, 11727254], [11727255, 12793368], [12793369, 13859482], [13859483, 14925596], [14925597, 15991710], [15991711, 17057824], [17057825, 18123938], [18123939, 19190052], [19190053, 20256166], [20256167, 21322288]] SRR12671700 file size 7224545 SRR12671700 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671700 SRR12671700_1.fastq SRR12671700_2.fastq Input file: SRR12671700_1.fastq Paired file: SRR12671700_2.fastq trimmed: SRR12671700-trimmed-pair1.fastq, SRR12671700-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:39:03 2025 >> started Wed Feb 12 04:39:25 2025 >> done (21.551s) 21322288 read pairs processed; of these: 11 ( 0.00%) short read pairs filtered out after trimming by size control 3704 ( 0.02%) empty read pairs filtered out after trimming by size control 21318573 (99.98%) read pairs available; of these: 1387171 ( 6.51%) trimmed read pairs available after processing 19931402 (93.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 3 0.00% 21 4 0.00% 22 5 0.00% 23 1 0.00% 24 4 0.00% 25 5 0.00% 26 6 0.00% 27 6 0.00% 28 10 0.00% 29 7 0.00% 30 11 0.00% 31 12 0.00% 32 6 0.00% 33 14 0.00% 34 14 0.00% 35 12 0.00% 36 15 0.00% 37 24 0.00% 38 22 0.00% 39 14 0.00% 40 24 0.00% 41 15 0.00% 42 26 0.00% 43 28 0.00% 44 42 0.00% 45 34 0.00% 46 38 0.00% 47 39 0.00% 48 60 0.00% 49 67 0.00% 50 61 0.00% 51 76 0.00% 52 87 0.00% 53 97 0.00% 54 102 0.00% 55 91 0.00% 56 96 0.00% 57 132 0.00% 58 125 0.00% 59 165 0.00% 60 209 0.00% 61 194 0.00% 62 215 0.00% 63 212 0.00% 64 314 0.00% 65 284 0.00% 66 311 0.00% 67 393 0.00% 68 393 0.00% 69 461 0.00% 70 531 0.00% 71 567 0.00% 72 671 0.00% 73 815 0.00% 74 914 0.00% 75 954 0.00% 76 1066 0.01% 77 1199 0.01% 78 1340 0.01% 79 1499 0.01% 80 1578 0.01% 81 1772 0.01% 82 2079 0.01% 83 2206 0.01% 84 2507 0.01% 85 2661 0.01% 86 2880 0.01% 87 3162 0.01% 88 3635 0.02% 89 3751 0.02% 90 4199 0.02% 91 4442 0.02% 92 4794 0.02% 93 5361 0.03% 94 5834 0.03% 95 6185 0.03% 96 6636 0.03% 97 7102 0.03% 98 7507 0.04% 99 7719 0.04% 100 8254 0.04% 101 8720 0.04% 102 9321 0.04% 103 9970 0.05% 104 10381 0.05% 105 10981 0.05% 106 11692 0.05% 107 11930 0.06% 108 12561 0.06% 109 13159 0.06% 110 13521 0.06% 111 14493 0.07% 112 14808 0.07% 113 15168 0.07% 114 16207 0.08% 115 17221 0.08% 116 17687 0.08% 117 18013 0.08% 118 18900 0.09% 119 19618 0.09% 120 20542 0.10% 121 21185 0.10% 122 21666 0.10% 123 22888 0.11% 124 23577 0.11% 125 24391 0.11% 126 25042 0.12% 127 26040 0.12% 128 26665 0.13% 129 27470 0.13% 130 28119 0.13% 131 28584 0.13% 132 29555 0.14% 133 31025 0.15% 134 32161 0.15% 135 32848 0.15% 136 33750 0.16% 137 33993 0.16% 138 34745 0.16% 139 35869 0.17% 140 36545 0.17% 141 37156 0.17% 142 38750 0.18% 143 39602 0.19% 144 41445 0.19% 145 41746 0.20% 146 42592 0.20% 147 42816 0.20% 148 44486 0.21% 149 44396 0.21% 150 44760 0.21% 151 19931402 93.49% 21318573 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=19 prefix-density=0.55 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=19.20 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.2 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=19 prefix-density=0.78 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=17.27 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.9 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA SRR12671700 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:40:09 Started mapping on | Feb 12 04:40:09 Finished on | Feb 12 04:42:11 Mapping speed, Million of reads per hour | 629.07 Number of input reads | 21318573 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20201387 Uniquely mapped reads % | 94.76% Average mapped length | 297.76 Number of splices: Total | 20299995 Number of splices: Annotated (sjdb) | 19902102 Number of splices: GT/AG | 19899549 Number of splices: GC/AG | 332999 Number of splices: AT/AC | 11765 Number of splices: Non-canonical | 55682 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 468892 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 93786 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.50% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 648294 648294 648294 N_multimapping 468892 468892 468892 N_noFeature 767263 19905785 869929 N_ambiguous 325345 1332 131564 UnstrandedReadsAssigned:19108779 PositiveStrandReadsAssigned:294270 NegativeStrandReadsAssigned:19199894 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671700 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671700-trimmed-pair1.fastq SRR12671700-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,318,573 reads, 19,235,697 reads pseudoaligned [quant] estimated average fragment length: 297.029 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 955 rounds 52401 SRR12671700.ke.tsv 34699 SRR12671700.se.tsv 87100 total ==> SRR12671700.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1721.97 891 26.645 Potri.005G024800.1.v4.1 1035 738.971 326 22.7171 Potri.004G059700.1.v4.1 961 665.573 4 0.309476 Potri.007G009000.2.v4.1 1416 1119.97 0 0 Potri.003G141000.2.v4.1 2943 2646.97 993.274 19.3234 Potri.016G087400.1.v4.1 270 78.2324 806 530.533 Potri.015G069301.1.v4.1 564 296.878 0 0 Potri.010G195200.1.v4.1 1773 1476.97 66 2.3011 Potri.012G127500.1.v4.1 977 681.3 159 12.0177 ==> SRR12671700.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 331 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 263 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12671700 completed mapping pipeline successfully